Este trabajo fue apoyado por la National Aeronautics and Space Administration West Virginia Espacio de Grant Consorcio (NASA WVSGC), Cystic Fibrosis Foundation (CFF-YU11G0) y ​​NIH P20RR016477 y P20GM103434 a la Red IDEA West Virginia para la Investigación Biomédica de Excelencia. Damos las gracias a M. Vonya Eisinger para la asistencia técnica con este trabajo.

1. Preparación de cepas bacterianas y biparental Conjugación <ol><li> Inocular E. coli SM10/λpir/pFAC en 5 ml de caldo Luria (LB) suplementado con 15 g / ml de gentamicina y colocar en una incubadora de agitación durante la noche a 37 ° C. </li><li> Inocular P. aeruginosa cepa PAO1 en 5 ml de LB, y colóquelo en un incubador con agitación durante la noche a 42 ° C. </li><li> Mida OD 600 de cultivos de una noche y mezclar cantidades iguales de PAO1 y E. coli Pfac de tal manera que el volumen final es de entre 1-1,4 ml. </li><li> Mezcla Centrifugar a 6000 xg durante 5 min. </li><li> Mientras tanto, secar placas de LB para la conjugación: deje los platos abiertos en una incubadora a 37 ° C durante 10-15 min. </li><li> Retire todos menos 50 l de sobrenadante de la mezcla de células. </li><li> Resuspender el sedimento celular en los 50 l restantes de sobrenadante y la pipeta sobre una placa de LB seco en una gotita compacto. </li><li> Coloque con cuidado la placa bajo una campana extractora que se seque (IMPONota rtante: No permita que las células se distribuyen en la placa, esto disminuirá significativamente la eficacia de la conjugación). </li><li> Una vez que la gotita está seco, invertir la placa de LB y se incuba a 37 ° C durante 4-6 horas. </li><li> Mientras que la mezcla de células se está incubando, preparar grandes (150 mm DE x 15 mm) Placas de PIA con 300 g / ml de gentamicina. Antes de su uso, eliminar la humedad residual mediante la colocación en una incubadora a 37 ° C durante 15-20 min. </li><li> Después de la incubación de la mezcla de células es completa, recoger las células usando un asa de inoculación estéril y en un tubo de microcentrífuga que contiene 1 ml de LB y vórtice, o una pipeta, para mezclar a fondo. </li><li> Separe las células uniformemente sobre las planchas de PIA contienen 300 g / ml de gentamicina. (IMPORTANTE: Para este paso, lo mejor es añadir volúmenes crecientes de la mezcla de células para separar las placas (por ejemplo, la placa 1: 10 l, de la Plata 2: 50 l, de la Plata 3: 100 l, de la Plata 4: 500 l, etc) . </li><li> Incubar durante la noche a 37° C. </li></ol> 2. Detección y aislamiento de colonias mucosas <ol><li> Retire las placas de la incubadora y examinar las colonias mucoides. </li><li> Aislar una sola colonia mucoide y consecutivas para el aislamiento en placas pequeñas (OD 100 x 10 mm) con PIA y 300 g / ml de gentamicina. </li><li> Incubar toda la noche a 37 ° C. </li><li> Repita el paso 2.2 en el cultivo de la noche anterior. </li><li> Repita los pasos 2.2 hasta 2.4 dos veces más para determinar la estabilidad de la cepa mucoide. </li><li> Después de la etapa final de aislamiento, inocular 4,5 ml de LB con una sola colonia mucoide e incubar en agitador durante la noche a 37 ° C. </li><li> Al día siguiente, la etiqueta 3 tubos de microcentrífuga para cada mutante mucoide. </li><li> Preparar dos alícuotas de 1,25 ml de cultivo de una noche en 2 tubos para la extracción de ADN genómico y la identificación del sitio de inserción del transposón (véase el Protocolo 3). </li><li> Además, archivar cada mutante mucoide con la pipeta 1 ml de cultivo durante la noche en una CRÉDITOScriovial Ely marcado que contiene un volumen igual de leche descremada 10%. Almacenar a -86 ° C. </li></ol> 3. ADNg digestión de restricción y la ligadura <ol><li> Extracto de ADNg de la mutante mucoide usando cualquier método preferido (fenol-cloroformo, por ejemplo, la columna. Espín, etc.) </li><li> Determinar la concentración de la ADNg, digerir un total de 2 g con 1 l de la endonucleasa de restricción SalI, 0,5 l de albúmina de suero bovino, 5 l de tampón de enzima SalI (NaCl 100 mM, Tris-HCl 50, 10 mM de MgCl 2 , 1 mM de ditiotreitol (DTT), pH 7,9 a temperatura ambiente), y el volumen apropiado de dH2O para conseguir un volumen total de 50 l. </li><li> Digerir el ADN durante la noche a 37 ° C. (IMPORTANTE:. Dependiendo de la eficiencia de la enzima de restricción, puede ser necesario añadir un adicional de 1 l para la noche a la mañana digest y se incuba a 37 ° C durante 1-2 horas Esto es además de la noche a la mañana digest.) </li><li> Se purifica el digeSTED ADN usando cualquier método preferido (por ejemplo, purificación en gel de agarosa, columnas de centrifugado) y se eluye con 25 l de tampón. </li><li> Se liga el ADN digerido mediante la mezcla de 11 l de ADN purificado con una concentración preferida de ~ 10-20 ng / l, 1,5 l de tampón de ligadura (330 mM de Tris-acetato, pH 7,5, 660 mM de acetato de potasio, acetato de magnesio 100 mM, 5 mM TDT), 1,5 l de ATP 100 mM y 1 l de ADN ligasa. </li><li> Incubar la mezcla durante 15 min a temperatura ambiente, y después inactivar la enzima por incubación durante 15 min a 70 ° C. (Nota: la incubación de la mezcla a temperatura ambiente durante más tiempo puede aumentar el éxito de la ligadura). </li></ol> 4. PCR inversa (iPCR) y Análisis de Secuencia <ol><li> Realice iPCR el producto de ligación utilizando la siguiente adelante y atrás primers y ciclos térmicos condiciones: -Forward Primer (Gm3OUT): GGGCATACGGGAAGAAGTGA -Reverse Primer (Gm5OUT): GACTGCCCTGCTGCGTAACA Termociclador Condiciones: 1. 94 ° C durante 1 min. 2. 94 ° C durante 1 min. 3. 58 ° C durante 2 min. 4. 72 ° C durante 2 min. 5. 72 ° C durante 8 min. 6. 10 ° C espera. Repita los pasos 2-4 para 34 ciclos. (NOTA: Los productos de Amplified iPCR pueden almacenarse a 4 ° C) </li><li> Realice la electroforesis en gel de agarosa para confirmar la amplificación exitosa iPCR. </li><li> Lleve a cabo la secuenciación del producto iPCR utilizando los cebadores Gm3OUT y Gm5OUT. El sitio de inserción y la orientación de Himar1 se asignan a cabo. </li></ol>

<ol>
	<li>Govan, J. R., Deretic, V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Microbial+pathogenesis+in+cystic+fibrosis:+mucoid+Pseudomonas+aeruginosa+and+Burkholderia+cepacia.">Microbial pathogenesis in cystic fibrosis: mucoid Pseudomonas aeruginosa and Burkholderia cepacia.</a> Microbiol. Rev. 60, 539-574 (1996).</li><li>Chitnis, C. E., Ohman, D. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genetic+analysis+of+the+alginate+biosynthetic+gene+cluster+of+Pseudomonas+aeruginosa+shows+evidence+of+an+operonic+structure.">Genetic analysis of the alginate biosynthetic gene cluster of Pseudomonas aeruginosa shows evidence of an operonic structure.</a> Mol. Microbiol. 8, 583-593 (1993).</li><li>Franklin, M. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Pseudomonas+aeruginosa+AlgG+is+a+polymer+level+alginate+C5-mannuronan+epimerase.">Pseudomonas aeruginosa AlgG is a polymer level alginate C5-mannuronan epimerase.</a> J. Bacteriol. 176, 1821-1830 (1994).</li><li>Franklin, M. J., Ohman, D. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mutant+analysis+and+cellular+localization+of+the+AlgI,+AlgJ,+and+AlgF+proteins+required+for+O+acetylation+of+alginate+in+Pseudomonas+aeruginosa.">Mutant analysis and cellular localization of the AlgI, AlgJ, and AlgF proteins required for O acetylation of alginate in Pseudomonas aeruginosa.</a> J. Bacteriol. 184, 3000-3007 (2002).</li><li>Deretic, V., Gill, J. F., Chakrabarty, A. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Gene+algD+coding+for+GDPmannose+dehydrogenase+is+transcriptionally+activated+in+mucoid+Pseudomonas+aeruginosa.">Gene algD coding for GDPmannose dehydrogenase is transcriptionally activated in mucoid Pseudomonas aeruginosa.</a> J. Bacteriol. 169, 351-358 (1987).</li><li>Mathee, K., McPherson, C. J., Ohman, D. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Posttranslational+control+of+the+algT+(algU)-encoded+sigma22+for+expression+of+the+alginate+regulon+in+Pseudomonas+aeruginosa+and+localization+of+its+antagonist+proteins+MucA+and+MucB+(AlgN)..">Posttranslational control of the algT (algU)-encoded sigma22 for expression of the alginate regulon in Pseudomonas aeruginosa and localization of its antagonist proteins MucA and MucB (AlgN)..</a> J. Bacteriol. 179, 3711-3720 (1997).</li><li>Boucher, J. C., Schurr, M. J., Yu, H., Rowen, D. W., Deretic, V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Pseudomonas+aeruginosa+in+cystic+fibrosis:+role+of+mucC+in+the+regulation+of+alginate+production+and+stress+sensitivity.">Pseudomonas aeruginosa in cystic fibrosis: role of mucC in the regulation of alginate production and stress sensitivity.</a> Microbiology. 143, 3473-3480 (1997).</li><li>Martin, D. W., Holloway, B. W., Deretic, V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Characterization+of+a+locus+determining+the+mucoid+status+of+Pseudomonas+aeruginosa:+AlgU+shows+sequence+similarities+with+a+Bacillus+sigma+factor.">Characterization of a locus determining the mucoid status of Pseudomonas aeruginosa: AlgU shows sequence similarities with a Bacillus sigma factor.</a> J. Bacteriol. 175, 1153-1164 (1993).</li><li>Damron, F. H., Goldberg, J. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Proteolytic+regulation+of+alginate+overproduction+in+Pseudomonas+aeruginosa.">Proteolytic regulation of alginate overproduction in Pseudomonas aeruginosa.</a> Mol. Microbiol. 84 (4), 595-607 (2012).</li><li>Browne, P., Barret, M., O'Gara, F., Morrissey, J. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Computational+prediction+of+the+Crc+regulon+identifies+genus-wide+and+species-specific+targets+of+catabolite+repression+control+in+Pseudomonas+bacteria.">Computational prediction of the Crc regulon identifies genus-wide and species-specific targets of catabolite repression control in Pseudomonas bacteria.</a> BMC Microbiol. 10, 300 (2010).</li><li>Damron, F. H., Qiu, D., Yu, H. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+Pseudomonas+aeruginosa+sensor+kinase+KinB+negatively+controls+alginate+production+through+AlgW-dependent+MucA+proteolysis.">The Pseudomonas aeruginosa sensor kinase KinB negatively controls alginate production through AlgW-dependent MucA proteolysis.</a> J. Bacteriol. 191, 2285-2295 (2009).</li><li>Damron, F. H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Analysis+of+the+Pseudomonas+aeruginosa+regulon+controlled+by+the+sensor+kinase+KinB+and+sigma+factor+RpoN.">Analysis of the Pseudomonas aeruginosa regulon controlled by the sensor kinase KinB and sigma factor RpoN.</a> J. Bacteriol. 194, 1317-1330 (2012).</li><li>Qiu, D., Eisinger, V. M., Rowen, D. W., Yu, H. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Regulated+proteolysis+controls+mucoid+conversion+in+Pseudomonas+aeruginosa.">Regulated proteolysis controls mucoid conversion in Pseudomonas aeruginosa.</a> Proc. Natl. Acad. Sci. U.S.A. 104, 8107-8112 (2007).</li><li>Schurr, M. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Which+bacterial+biofilm+exopolysaccharide+is+preferred,+Psl+or+alginate.">Which bacterial biofilm exopolysaccharide is preferred, Psl or alginate.</a> J. Bacteriol. 195, 1623-1626 (2013).</li><li>Wong, S. M., Mekalanos, J. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genetic+footprinting+with+mariner-based+transposition+in+Pseudomonas+aeruginosa.">Genetic footprinting with mariner-based transposition in Pseudomonas aeruginosa.</a> Proc. Natl. Acad. Sci. U.S.A. 97, 10191-10196 (2000).</li><li>Lampe, D. J., Akerley, B. J., Rubin, E. J., Mekalanos, J. J., Robertson, H. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Hyperactive+transposase+mutants+of+the+Himar1+mariner+transposon.">Hyperactive transposase mutants of the Himar1 mariner transposon.</a> Proc. Natl. Acad. Sci. U.S.A. 96, 11428-11433 (1999).</li></ol>

El autor Hongwei D. Yu es el oficial científico jefe y cofundador de progénesis Technologies, LLC.

Es importante señalar que este método se puede utilizar en otras especies de Pseudomonas con estas alteraciones: incubar P. y P. fluorescens putida a 30 ° C, y P. stutzeri a 42 ° C; P. stuzeri debe cultivarse en placas de LB suplementadas con 150 g / ml de gentamicina; en el paso 1,11, p células stutzeri deben transferirse en 500 l de LB en lugar de 1 ml. Además, hay dos pasos críticos para este protocolo. En primer lugar, la cepa receptora debe culti...

La capacidad de la oportunista, patógenos Gram-negativa Pseudomonas aeruginosa para sobreproducir alginato es un factor importante en su capacidad para establecer un biofilm. La sobreproducción de alginato es un fenotipo a menudo referido como mucoidy. El aislamiento de colonias mucosas de los esputos de los individuos que sufren de fibrosis quística (FQ) es indicativo de una infección crónica y se asocia directamente con una disminución general de la salud del paciente 1. En la actualidad, se entiende que la regulación y la producción de alginato en P. aeruginosa se ​​produce principalmente en dos operones. El primero es el operón biosintético de alginato, que contiene 12 genes (algD - Alg8 - Alg44 - algK - Alge - AlgG - Algx - algL - Algi - algJ - algF - alga) que son responsables de la síntesis y la exportación del polímero de alginato través el periplasma para el med extracelularnt 2-5. El segundo operón es un grupo de genes a partir de la alternativa sigma factor AlgU / T y continuando con mucA, mucB y MUCD. AlgU / T es un regulador positivo, mientras que MUCAB-D se clasifican como reguladores negativos de la producción de alginato 6-8. Además, los reguladores transcripcionales, tales como ALGB, AlgQ, ALGR, y RpoN, así como post-transcripcional y post-translacional modificación por el control de la represión catabólica, la actividad quinasa (KinB) y intramembrane proteólisis, también se han demostrado estar involucrados en alginato regulación 9-14. El vector transposón mini-Himar1 conocida como Comisión PFA fue creado originalmente en el laboratorio del Dr. Mekalanos &#39;en Harvard Medical School 15. El plásmido PFA consta de un elemento transponible flanqueado por dos repeticiones invertidas de 27 pb y un casete de gentamicina de resistencia en el medio (aacC1: 534 pb), un gen que codifica la hyperactive transposasa Mariner 16, y una codificación de β-lactamasa gen (bla) (Figura 1). Secuencia de la información para el elemento de transposición de la Comisión PFA está disponible en el número de acceso de GenBank: DQ366300 13. En la Comisión PFA, hay un sitio de clonación múltiple (MCS) detrás del gen aacC1 que se utiliza para la identificación del sitio de inserción cromosómica utilizando PCR inversa. Una gran ventaja con el uso del transposón mini-Himar1 es que no se requieren factores del huésped específicos de transposición (mutagénesis). Además, hay una alta abundancia de los sitios de inserción de dinucleótidos TA se encuentran en todo el genoma de P. aeruginosa. Por ejemplo, AT sitios de inserción dinucleótido produce 94.404 y 100.229 veces en el PAO1 (6.264.404 bps, número de acceso GenBank NC_002516.2) y PA14 (6.537.648 bps; número de acceso GenBank NC_008463) genomas, respectivamente. Debido a la abundancia de TA dinucleótido en el genoma, mini-Himar1 </em&gt; Transposón puede causar que el de alta densidad y mutagénesis aleatoria, que es particularmente adecuado para el análisis de genes de virulencia y los genes que están altamente regulados. Teóricamente, el transposón mini-Himar1 puede insertar en cualquier gen no esencial dentro del genoma de P. aeruginosa. Esto proporciona aproximadamente 18 sitios de inserción de asistencia técnica al marco de lectura abierto en el genoma PAO1. Aquí se describe un protocolo utilizando mini-Himar1 transposón mutagénesis mediada por identificar nuevos reguladores de mucoidy en P. aeruginosa. Más específicamente, biparental conjugamos el vector de la Comisión PFA contiene un transposón mini-Himar1 de E. coli SM10/λpir en el nonmucoid cepa PAO1 prototrophic. Después de que el transposón se integra en el genoma, la cepa receptora se cultiva en Pseudomonas aislamiento agar (PIA) que contiene triclosán que inhibe el crecimiento de E. coli. Por lo tanto, una biblioteca de mutantes de <em&gt; P. aeruginosa puede ser seleccionado por el crecimiento en la placa de PIA suplementado con gentamicina y la presencia del fenotipo mucoide. Tenga en cuenta, un transposón mediada vs un mutante verdadera integración tendrá un fenotipo resistente y carbenicilina sensible gentamicina. En este estudio, aproximadamente 80.000 mutantes de inserción de PAO1 se aislaron a través de cuatro conjugaciones separadas. Hemos examinado a continuación para los aislados mucoides, y se determinó el sitio de inserción por la digestión con enzimas de restricción, ligación y PCR inversa. Se realizó análisis de transferencia de Southern usando la casete de resistencia a gentamicina como una sonda para ver el número de inserción por genoma. Se determinó que más de 90% de los mutantes obtenidos por la conjugación utilizando este protocolo tenía sólo una única copia de la Himar1 en el genoma y se muestra el fenotipo resistente y-carbenicilina sensible gentamicina. Se identificaron un total de 32 cepas mucoides, 22 de ellas fueron asignadas a diferentes loci del P. aeruginosa PAO1cromosoma. Esta tasa de inserción proporciona una cobertura adecuada para identificar varios reguladores novedosos de la sobreproducción de alginato.

<table border="0" cellpadding="0" cellspacing="0" width="780">
	<colgroup>
		<col />
		<col />
		<col />
		<col />
	</colgroup>
	<tbody>
		<tr height="22">
			<td height="22" style="height:22px;width:267px;">Luria Broth</td>
			<td style="width:187px;">Difco</td>
			<td style="width:125px;">240230</td>
			<td style="width:203px;">via Fisher Scientific</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Pseudomonas isolation agar</td>
			<td>Difco</td>
			<td>292710</td>
			<td>via Fisher Scientific</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Small Plates (100 O.D. x 10 mm)</td>
			<td>Fisher Scientific</td>
			<td>08-757-13</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Large Plates (150 O.D. x 15 mm)</td>
			<td>Fisher Scientific</td>
			<td>08-757-14</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Glycerol</td>
			<td>Fisher Scientific</td>
			<td>BP229-4</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Benchtop Shaking Incubator</td>
			<td>New Brunswick Scientific</td>
			<td>Innova 4080</td>
			<td>shake at 200 rpm</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Cabinet Incubator</td>
			<td>VWR</td>
			<td>1540</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Benchtop Microcentrifuge</td>
			<td>Sorvall</td>
			<td>75-003-287</td>
			<td>via Fisher Scientific</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">SmartSpec Plus Spectrophotometer</td>
			<td>Bio-Rad</td>
			<td>170-2525</td>
			<td>or preferred method/vendor</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Diposable Inoculation Loops</td>
			<td>Fisher Scientific</td>
			<td>22-363-597</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">1.5 mL Microcentrifuge Tubes</td>
			<td>Fisher Scientific</td>
			<td>05-408-129</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">2.0 mL Cryogenic Vials</td>
			<td>Corning</td>
			<td>430659</td>
			<td>via Fisher Scientific</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">15 mL Tubes</td>
			<td>Fisher Scientific</td>
			<td>05-539-12</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Skim Milk</td>
			<td>Difco</td>
			<td>DF0032-17-3</td>
			<td>via Fisher Scientific</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">DNeasy Blood and Tissue (250)&#160;</td>
			<td>Qiagen</td>
			<td>69506</td>
			<td>or preferred method/vendor</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">QIAquick PCR Purification Kit (250)</td>
			<td>Qiagen</td>
			<td>28106</td>
			<td>or preferred method/vendor</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">QIAprep Spin Miniprep Kit (250)&#160;</td>
			<td>Qiagen</td>
			<td>27106</td>
			<td>or preferred method/vendor</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">FastLink II DNA Ligation Kit</td>
			<td>Epicentre Technologies</td>
			<td>LK6201H</td>
			<td>via Fisher Scientific</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Accu block Digital Dry Bath&#160;</td>
			<td>Labnet</td>
			<td>NC0205808</td>
			<td>via Fisher Scientific</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Sal1, restriction endonuclease</td>
			<td>New England BioLabs</td>
			<td>R0138L</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">EasyStart Micro 50</td>
			<td>Molecular BioProducts</td>
			<td>6020</td>
			<td>via Fisher Scientific</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Taq DNA Polymerase</td>
			<td>New England BioLabs</td>
			<td>M0267L</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">iCycler, Thermocycler</td>
			<td>Bio-Rad</td>
			<td>170-8740</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">LE agarose</td>
			<td>Genemate</td>
			<td>3120-500</td>
			<td>via Fisher Scientific</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Gentamycin Sulfate</td>
			<td>Fisher Scientific</td>
			<td>BP918-1</td>
			<td></td>
		</tr>
		<tr height="22">
			<td height="22" style="height:22px;">2.0 mL Cryogenic Vials</td>
			<td>Corning</td>
			<td>430659</td>
			<td>via Fisher Scientific</td>
		</tr>
	</tbody>
</table>

identification of novel genes associated with alginate production in pseudomonas aeruginosa using mini-himar1 mariner transposon-mediated mutagenesis

Pseudomonas aeruginosa es una bacteria Gram-negativa, del medio ambiente con capacidades metabólicas versátiles. P. aeruginosa es una bacteria patógena oportunista que produce infecciones pulmonares crónicas en pacientes con fibrosis quística (FQ). La sobreproducción de un polisacárido capsular llamado alginato, también conocido como mucoidy, promueve la formación de biopelículas mucoides que son más resistentes que las células planctónicas a la quimioterapia antibiótico y las defensas del huésped. Además, la conversión de la nonmucoid a fenotipo mucoide es un marcador clínico para el inicio de la infección crónica en la FQ. Sobreproducción de alginato por P. aeruginosa es un proceso que en gran medida endergónica impuestos sobre la energía celular. Por lo tanto, la producción de alginato está muy regulada en P. aeruginosa. Para entender mejor la regulación de alginato, se describe un protocolo usando el transposón de mutagénesis de mini-Himar1 para la identificación de nuevos regulador de alginatos en una cepa PAO1 prototípico. El procedimiento consta de dos pasos básicos. En primer lugar, hemos transferido el transposón mini-Himar1 (PFA) del huésped E. coli SM10/λpir en receptor P. aeruginosa PAO1 a través de la conjugación biparental para crear una biblioteca de mutantes de inserción de alta densidad, los cuales fueron seleccionados en placas de agar de Pseudomonas aislamiento suplementado con gentamicina. En segundo lugar, hemos examinado y aislaron las colonias mucoides para asignar el lugar de la inserción a través de PCR inversa usando cebadores de ADN que apuntan hacia el exterior desde el casete de gentamicina y la secuenciación del ADN. El uso de este protocolo, se han identificado dos nuevos reguladores de alginato, Muce (PA4033) y kinB (PA5484), en PAO1 cepa con una de tipo salvaje mucA codifica el factor anti-sigma MUCA para el maestro de alginato regulador AlgU (ALGT, σ 22) . Este protocolo de mutagénesis de alto rendimiento puede ser modificado para la identificación de otros genes relacionados con la virulencia que causa el cambio en Colomorfología ny.

Como se ilustra en la Figura 1, el vector de transposón mariner-Mini Himar1, PFA, contiene dos repeticiones invertidas de 27 pb con sitios de inserción de AT que flanquean el casete de resistencia a gentamicina aacC1, con su promotor σ 70-dependientes, y un sitio de clonación múltiple (MCS). Además, el vector de la Comisión PFA contiene genes que codifican la transposasa altamente activo Himar1, β-lactamasa (bla), y el operón de transferencia de <e...

Watch this Scientific Journal Video about Identification of Novel Genes Associated with Alginate Production in Pseudomonas aeruginosa Using Mini-himar1 Mariner Transposon-mediated Mutagenesis at JoVE.

Identification of Novel Genes Associated with Alginate Production in Pseudomonas aeruginosa Using Mini-himar1 Mariner Transposon-mediated Mutagenesis

Aquí se describe un protocolo utilizando el navegante mutagénesis-mini Himar1 transposón mediada para generar una biblioteca de mutantes de inserción de alta densidad de la pantalla, aislar e identificar nuevos reguladores de alginato en el prototípico cepa PAO1 Pseudomonas aeruginosa.

Identificación de nuevos genes asociados con alginato producción en<em&gt; Pseudomonas aeruginosa</em&gt; Uso de Mini-<em&gt; Himar1</em&gt; La mutagénesis mediada por transposón Mariner

Pseudomonas aeruginosa is a Gram-negative, environmental bacterium with versatile metabolic capabilities. P. aeruginosa is an opportunistic bacterial ...

identification-novel-genes-associated-with-alginate-production

Research

JoVE Journal

Immunology and Infection

Identification of Novel Genes Associated with Alginate Production in Pseudomonas aeruginosa Using Mini-himar1 Mariner Transposon-mediated Mutagenesis

12.2K vistas.  Marshall University.  Aquí se describe un protocolo utilizando el navegante mutagénesis-mini Himar1 transposón mediada para generar una biblioteca de mutantes de inserción de alta densidad de la pantalla, aislar e identificar nuevos reguladores de alginato en el prototípico cepa PAO1 Pseudomonas aeruginosa. 

Video: Identification of Novel Genes Associated with Alginate Production in Pseudomonas aeruginosa Using Mini-himar1 Mariner Transposon-mediated Mutagenesis

Co-culture Models of Pseudomonas aeruginosa Biofilms Grown on Live Human Airway Cells

Bacterial biofilms have been associated with a number of different human diseases, but biofilm development has generally been studied on non-living surfaces. In this paper, we describe protocols for forming Pseudomonas aeruginosa biofilms on human airway epithelial cells (CFBE cells) grown in culture. In the first method (termed the Static Co-culture Biofilm Model), P. aeruginosa is incubated with CFBE cells grown as confluent monolayers on standard tissue culture plates. Although the bacterium is quite toxic to epithelial cells, the addition of arginine delays the destruction of the monolayer long enough for biofilms to form on the CFBE cells. The second method (termed the Flow Cell Co-culture Biofilm Model), involves adaptation of a biofilm flow cell apparatus, which is often used in biofilm research, to accommodate a glass coverslip supporting a confluent monolayer of CFBE cells. This monolayer is inoculated with P. aeruginosa and a peristaltic pump then flows fresh medium across the cells. In both systems, bacterial biofilms form within 6-8 hours after inoculation. Visualization of the biofilm is enhanced by the use of P. aeruginosa strains constitutively expressing green fluorescent protein (GFP). The Static and Flow Cell Co-culture Biofilm assays are model systems for early P. aeruginosa infection of the Cystic Fibrosis (CF) lung, and these techniques allow different aspects of P. aeruginosa biofilm formation and virulence to be studied, including biofilm cytotoxicity, measurement of biofilm CFU, and staining and visualizing the biofilm.

Co-culture Models of Pseudomonas aeruginosa Biofilms Grown on Live Human Airway Cells

This paper describes different methods of growing Pseudomonas aeruginosa biofilms on cultured human airway epithelial cells. These protocols can be adapted to study different aspects of biofilm formation, including visualization of the biofilm, staining of the biofilm, measuring the colony forming units (CFU) of the biofilm, and studying biofilm cytotoxicity.

Los modelos de co-cultivo de Pseudomonas aeruginosa Biofilms Cultivado en las células vivas las vías respiratorias humanas

Bacterial biofilms have been associated with a number of different human diseases, but biofilm development has generally been studied on non-living ...

Investigación

Inmunología e Infección

Transfection and Mutagenesis of Target Genes in Mosquito Cells by Locked Nucleic Acid-modified Oligonucleotides

Plasmodium parasites, the causative agent of malaria, are transmitted through the bites of infected Anopheles mosquitoes resulting in over 250 million new infections each year. Despite decades of research, there is still no vaccine against malaria, highlighting the need for novel control strategies. One innovative approach is the use of genetically modified mosquitoes to effectively control malaria parasite transmission. Deliberate alterations of cell signaling pathways in the mosquito, via targeted mutagenesis, have been found to regulate parasite development 1. From these studies, we can begin to identify potential gene targets for transformation. Targeted mutagenesis has traditionally relied upon the homologous recombination between a target gene and a large DNA molecule. However, the construction and use of such complex DNA molecules for generation of stably transformed cell lines is costly, time consuming and often inefficient. Therefore, a strategy using locked nucleic acid-modified oligonucleotides (LNA-ONs) provides a useful alternative for introducing artificial single nucleotide substitutions into episomal and chromosomal DNA gene targets (reviewed in 2). LNA-ON-mediated targeted mutagenesis has been used to introduce point mutations into genes of interest in cultured cells of both yeast and mice 3,4. We show here that LNA-ONs can be used to introduce a single nucleotide change in a transfected episomal target that results in a switch from blue fluorescent protein (BFP) expression to green fluorescent protein (GFP) expression in both Anopheles gambiae and Anopheles stephensi cells. This conversion demonstrates for the first time that effective mutagenesis of target genes in mosquito cells can be mediated by LNA-ONs and suggests that this technique may be applicable to mutagenesis of chromosomal targets in vitro and in vivo.

Oligonucleotides can be used to site specifically substitute a single nucleotide of transfected target genes in both Anopheles gambiae and Anopheles stephensi cells.

Transfección y mutagénesis de los genes diana en células de mosquito por nucleico cerrado modificado ácido oligonucleótidos

Plasmodium parasites, the causative agent of malaria, are transmitted through the bites of infected Anopheles mosquitoes resulting in over 250 million new ...

Pseudomonas aeruginosa and Saccharomyces cerevisiae Biofilm in Flow Cells

Many microbial cells have the ability to form sessile microbial communities defined as biofilms that have altered physiological and pathological properties compared to free living microorganisms. Biofilms in nature are often difficult to investigate and reside under poorly defined conditions1. Using a transparent substratum it is possible to device a system where simple biofilms can be examined in a non-destructive way in real-time: here we demonstrate the assembly and operation of a flow cell model system, for in vitro 3D studies of microbial biofilms generating high reproducibility under well-defined conditions2,3.
The system consists of a flow cell that serves as growth chamber for the biofilm. The flow cell is supplied with nutrients and oxygen from a medium flask via a peristaltic pump and spent medium is collected in a waste container. This construction of the flow system allows a continuous supply of nutrients and administration of e.g. antibiotics with minimal disturbance of the cells grown in the flow chamber. Moreover, the flow conditions within the flow cell allow studies of biofilm exposed to shear stress. A bubble trapping device confines air bubbles from the tubing which otherwise could disrupt the biofilm structure in the flow cell.
The flow cell system is compatible with Confocal Laser Scanning Microscopy (CLSM) and can thereby provide highly detailed 3D information about developing microbial biofilms. Cells in the biofilm can be labeled with fluorescent probes or proteins compatible with CLSM analysis. This enables online visualization and allows investigation of niches in the developing biofilm. Microbial interrelationship, investigation of antimicrobial agents or the expression of specific genes, are of the many experimental setups that can be investigated in the flow cell system.

Pseudomonas aeruginosa and Saccharomyces cerevisiae Biofilm in Flow Cells

Protocol describing the application of a flow cell system for growing and analyzing microbial biofilms for Confocal Laser Scanning Microscopy (CLSM).

Pseudomonas aeruginosa y Biofilm Saccharomyces cerevisiae en las celdas de flujo

Many microbial cells have the ability to form sessile microbial communities defined as biofilms that have altered physiological and pathological ...

RNA Isolation of Pseudomonas aeruginosa Colonizing the Murine Gastrointestinal Tract

Pseudomonas aeruginosa (PA) infections result in significant morbidity and mortality in hosts with compromised immune systems, such as patients with leukemia, severe burn wounds, or organ transplants1. In patients at high-risk for developing PA bloodstream infections, the gastrointestinal (GI) tract is the main reservoir for colonization2, but the mechanisms by which PA transitions from an asymptomatic colonizing microbe to an invasive, and often deadly, pathogen are unclear. Previously, we performed in vivo transcription profiling experiments by recovering PA mRNA from bacterial cells residing in the cecums of colonized mice 3 in order to identify changes in bacterial gene expression during alterations to the host&#x2019;s immune status.
As with any transcription profiling experiment, the rate-limiting step is in the isolation of sufficient amounts of high quality mRNA. Given the abundance of enzymes, debris, food residues, and particulate matter in the GI tract, the challenge of RNA isolation is daunting. Here, we present a method for reliable and reproducible isolation of bacterial RNA recovered from the murine GI tract. This method utilizes a well-established murine model of PA GI colonization and neutropenia-induced dissemination4. Once GI colonization with PA is confirmed, mice are euthanized and cecal contents are recovered and flash frozen. RNA is then extracted using a combination of mechanical disruption, boiling, phenol/chloroform extractions, DNase treatment, and affinity chromatography. Quantity and purity are confirmed by spectrophotometry (Nanodrop Technologies) and bioanalyzer (Agilent Technologies) (Fig 1). This method of GI microbial RNA isolation can easily be adapted to other bacteria and fungi as well.

RNA Isolation of Pseudomonas aeruginosa Colonizing the Murine Gastrointestinal Tract

A reliable method for the RNA isolation of Pseudomonas aeruginosa recovered from murine cecums is described. The RNA recovered is of sufficient quantity and quality for subsequent qPCR, transcription profiling, and RNA Seq experiments. This technique can be adapted for RNA isolation of other intestinal microbes.

El aislamiento de ARN Pseudomonas aeruginosa Que colonizan el tracto gastrointestinal murino

Pseudomonas aeruginosa (PA) infections result in significant morbidity and mortality in hosts with compromised immune systems, such as patients with ...

Use of Artificial Sputum Medium to Test Antibiotic Efficacy Against Pseudomonas aeruginosa in Conditions More Relevant to the Cystic Fibrosis Lung

There is growing concern about the relevance of in vitro antimicrobial susceptibility tests when applied to isolates of P. aeruginosa from cystic fibrosis (CF) patients. Existing methods rely on single or a few isolates grown aerobically and planktonically. Predetermined cut-offs are used to define whether the bacteria are sensitive or resistant to any given antibiotic1. However, during chronic lung infections in CF, P. aeruginosa populations exist in biofilms and there is evidence that the environment is largely microaerophilic2. The stark difference in conditions between bacteria in the lung and those during diagnostic testing has called into question the reliability and even relevance of these tests3.
 Artificial sputum medium (ASM) is a culture medium containing the components of CF patient sputum, including amino acids, mucin and free DNA. P. aeruginosa growth in ASM mimics growth during CF infections, with the formation of self-aggregating biofilm structures and population divergence4,5,6. The aim of this study was to develop a microtitre-plate assay to study antimicrobial susceptibility of P. aeruginosa based on growth in ASM, which is applicable to both microaerophilic and aerobic conditions.
 An ASM assay was developed in a microtitre plate format. P. aeruginosa biofilms were allowed to develop for 3 days prior to incubation with antimicrobial agents at different concentrations for 24 hours. After biofilm disruption, cell viability was measured by staining with resazurin. This assay was used to ascertain the sessile cell minimum inhibitory concentration (SMIC) of tobramycin for 15 different P. aeruginosa isolates under aerobic and microaerophilic conditions and SMIC values were compared to those obtained with standard broth growth. Whilst there was some evidence for increased MIC values for isolates grown in ASM when compared to their planktonic counterparts, the biggest differences were found with bacteria tested in microaerophilic conditions, which showed a much increased resistance up to a &gt;128 fold, towards tobramycin in the ASM system when compared to assays carried out in aerobic conditions.
 The lack of association between current susceptibility testing methods and clinical outcome has questioned the validity of current methods3. Several in vitro models have been used previously to study P. aeruginosa biofilms7, 8. However, these methods rely on surface attached biofilms, whereas the ASM biofilms resemble those observed in the CF lung9 . In addition, reduced oxygen concentration in the mucus has been shown to alter the behavior of P. aeruginosa2 and affect antibiotic susceptibility10. Therefore using ASM under microaerophilic conditions may provide a more realistic environment in which to study antimicrobial susceptibility.

Use of Artificial Sputum Medium to Test Antibiotic Efficacy Against Pseudomonas aeruginosa in Conditions More Relevant to the Cystic Fibrosis Lung

Current diagnostic antimicrobial susceptibility testing relies on the planktonic growth of isolates in nutrient rich, aerobic conditions. Here, we employ an alternative artificial sputum medium to study antimicrobial susceptibility of Pseudomonas aeruginosa biofilms under both aerobic and microaerophilic conditions more representative of the cystic fibrosis lung.

Uso de un medio artificial de esputo para probar la eficacia de antibióticos contra la<em&gt; Pseudomonas aeruginosa</em&gt; En condiciones más pertinentes a la fibrosis quística pulmonar

There  is growing concern about the relevance of in vitro antimicrobial  susceptibility tests when applied to isolates of P. aeruginosa from  cystic ...

Long Term Chronic Pseudomonas aeruginosa Airway Infection in Mice

A mouse model of chronic airway infection is a key asset in cystic fibrosis (CF) research, although there are a number of concerns regarding the model itself. Early phases of inflammation and infection have been widely studied by using the Pseudomonas aeruginosa agar-beads mouse model, while only few reports have focused on the long-term chronic infection in vivo. The main challenge for long term chronic infection remains the low bacterial burden by P. aeruginosa and the low percentage of infected mice weeks after challenge, indicating that bacterial cells are progressively cleared by the host.
This paper presents a method for obtaining efficient long-term chronic infection in mice. This method is based on the embedding of the P. aeruginosa clinical strains in the agar-beads in vitro, followed by intratracheal instillation in C57Bl/6NCrl mice. Bilateral lung infection is associated with several measurable read-outs including weight loss, mortality, chronic infection, and inflammatory response. The P. aeruginosa RP73 clinical strain was preferred over the PAO1 reference laboratory strain since it resulted in a comparatively lower mortality, more severe lesions, and higher chronic infection. P. aeruginosa colonization may persist in the lung for over three months. Murine lung pathology resembles that of CF patients with advanced chronic pulmonary disease.
This murine model most closely mimics the course of the human disease and can be used both for studies on the pathogenesis and for the evaluation of novel therapies.

Long Term Chronic Pseudomonas aeruginosa Airway Infection in Mice

We describe the agar-beads method to establish persistent long-term chronic Pseudomonas aeruginosa airway infection in the mouse model.

Crónica a largo plazo<em&gt; Pseudomonas aeruginosa</em&gt; Infección de las vías respiratorias en los ratones

A mouse model of chronic airway infection is a key asset in cystic fibrosis (CF) research, although there are a number of concerns regarding the model ...

Pseudomonas aeruginosa Induced Lung Injury Model

In order to study human acute lung injury and pneumonia, it is important to develop animal models to mimic various pathological features of this disease. Here we have developed a mouse lung injury model by intra-tracheal injection of bacteria Pseudomonas aeruginosa (P. aeruginosa or PA). Using this model, we were able to show lung inflammation at the early phase of injury. In addition, alveolar epithelial barrier leakiness was observed by analyzing bronchoalveolar lavage (BAL); and alveolar cell death was observed by Tunel assay using tissue prepared from injured lungs. At a later phase following injury, we observed cell proliferation required for the repair process. The injury was resolved 7 days from the initiation of P. aeruginosa injection. This model mimics the sequential course of lung inflammation, injury and repair during pneumonia. This clinically relevant animal model is suitable for studying pathology, mechanism of repair, following acute lung injury, and also can be used to test potential therapeutic agents for this disease.

Pseudomonas aeruginosa Induced Lung Injury Model

We have developed a mouse lung injury model by intra-tracheal injection of bacteria Pseudomonas aeruginosa. This model mimics lung injury during pneumonia and is clinically relevant.

Pseudomonas aeruginosa inducida por la lesión pulmonar Modelo

In order to study human acute lung injury and pneumonia, it is important to develop animal models to mimic various pathological features of this disease. ...

Isolation of Salmonella typhimurium-containing Phagosomes from Macrophages

Salmonella typhimurium is a facultative intracellular bacterium that causes gastroenteritis in humans. After invasion of the lamina propria, S. typhimurium bacteria are quickly detected and phagocytized by macrophages, and contained in vesicles known as phagosomes in order to be degraded. Isolation of S. typhimurium-containing phagosomes have been widely used to study how S. typhimurium infection alters the process of phagosome maturation to prevent bacterial degradation. Classically, the isolation of bacteria-containing phagosomes has been performed by sucrose gradient centrifugation. However, this process is time-consuming, and requires specialized equipment and a certain degree of dexterity. Described here is a simple and quick method for the isolation of S. typhimurium-containing phagosomes from macrophages by coating the bacteria with biotin-streptavidin-conjugated magnetic beads. Phagosomes obtained by this method can be suspended in any buffer of choice, allowing the utilization of isolated phagosomes for a broad range of assays, such as protein, metabolite, and lipid analysis. In summary, this method for the isolation of S. typhimurium-containing phagosomes is specific, efficient, rapid, requires minimum equipment, and is more versatile than the classical method of isolation by sucrose gradient-ultracentrifugation.

Isolation of Salmonella typhimurium-containing Phagosomes from Macrophages

We describe here a simple and quick method for the isolation of Salmonella typhimurium-containing phagosomes from macrophages by coating the bacteria with biotin and streptavidin.

Aislamiento de Salmonella typhimurium-que contienen fagosomas de los macrófagos

Salmonella typhimurium is a facultative intracellular bacterium that causes gastroenteritis in humans. After invasion of the lamina propria, S. ...

Replication of the Ordered, Nonredundant Library of Pseudomonas aeruginosa strain PA14 Transposon Insertion Mutants

Pseudomonas aeruginosa is a phenotypically and genotypically diverse and adaptable Gram-negative bacterium ubiquitous in human environments. P. aeruginosa is able to form biofilms, develop antibiotic resistance, produce virulence factors, and rapidly evolve in the course of a chronic infection. Thus P. aeruginosa can cause both acute and chronic, difficult to treat infections, resulting in significant morbidity in certain patient populations. P. aeruginosa strain PA14 is a human clinical isolate with a conserved genome structure that infects a variety of mammalian and nonvertebrate hosts making PA14 an attractive strain for studying this pathogen. In 2006, a nonredundant transposon insertion mutant library containing 5,459 mutants corresponding to 4,596 predicted PA14 genes was generated. Since then, distribution of the PA14 library has allowed the research community to better understand the function of individual genes and complex pathways of P. aeruginosa. Maintenance of library integrity through the replication process requires proper handling and precise techniques. To that end, this manuscript presents protocols that describe in detail the steps involved in library replication, library quality control and proper storage of individual mutants.

Replication of the Ordered, Nonredundant Library of Pseudomonas aeruginosa strain PA14 Transposon Insertion Mutants

Pseudomonas aeruginosa infection causes significant morbidity in vulnerable hosts. The nonredundant transposon insertion mutant library of P. aeruginosa strain PA14, designated as PA14NR Set, facilitates analysis of gene functionality in numerous processes. Presented here is a protocol to generate high-quality copies of the PA14NR Set mutant library.

Replicación de la ordena, no redundante biblioteca de Pseudomonas aeruginosa cepa PA14 mutantes de inserción de transposones

Pseudomonas aeruginosa is a phenotypically and genotypically diverse and adaptable Gram-negative bacterium ubiquitous in human environments. P. aeruginosa ...

Methods for Detecting Cytotoxic Amyloids Following Infection of Pulmonary Endothelial Cells by Pseudomonas aeruginosa

Patients who survive pneumonia have elevated death rates in the months following hospital discharge. It has been hypothesized that infection of pulmonary tissue during pneumonia results in the production of long-lived cytotoxins that can lead to subsequent end organ failure. We have developed in vitro assays to test the hypothesis that cytotoxins are produced during pulmonary infection. Isolated rat pulmonary endothelial cells and the bacterium Pseudomonas aeruginosa are used as model systems, and the production of cytoxins following infection of the endothelial cells by the bacteria is demonstrated using cell culture followed by direct quantitation using lactate dehydrogenase assays and a novel microscopic method utilizing ImageJ technology. The amyloid nature of these cytotoxins was demonstrated by thioflavin T binding assays and by immunoblotting and immunodepletion using A11 anti-amyloid antibody. Further analyses using immunoblotting demonstrated that oligomeric tau and A&#946; were produced and released by endothelial cells following infection by P. aeruginosa. These methods should be readily adaptable to analyses of human clinical samples.

Methods for Detecting Cytotoxic Amyloids Following Infection of Pulmonary Endothelial Cells by Pseudomonas aeruginosa

Simple methods are described for demonstrating the production of cytotoxic amyloids following infection of pulmonary endothelium by Pseudomonas aeruginosa.

Métodos para la detección de amiloides siguiente infección de pulmonar endotelial células citotóxicas por Pseudomonas aeruginosa

Patients who survive pneumonia have elevated death rates in the months following hospital discharge. It has been hypothesized that infection of pulmonary ...