The authors would like to acknowledge the Utah Science Technology and Research fund for support of YML and the Korea National Research Foundation grants (2009-0069679 and 2010-0010154) for support of SIY. This research was supported by the Utah Agricultural Experiment Station, Utah State University, and approved as journal paper number UAES #8753. Also, the authors thank Dr. Deborah McClellan for editorial assistance.

The authors have declared that they have no competing financial interests.

El protocolo actual ha sido utilizado con éxito para generar de larga duración clones de cDNA infecciosos para dos cepas diferentes (CNU / LP2 27 y SA 14 -14-2 28) de JEV, un flavivirus cuyo cDNA funcional ha demostrado ser inherentemente difícil de construir y propagar debido a la toxicidad de la célula huésped y la inestabilidad genética del cDNA clonado 8,74-76 Este protocolo implica tres componentes principales:. primeros, maximizando la síntesis / amplificación de una copia de ADNc fieles de la ARN viral de alta fidelidad utilizando transcriptasa inversa / ADN polimerasa; segundo, la clonación de la región viral prM-E de codificación que contiene secuencias tóxicas (datos no publicados) 74,77,78 en un muy bajo número de copias del vector BAC a partir del ADNc inicial subclonación a las de longitud completa pasos finales de montaje cDNA; y tercero, la utilización de un BAC vector de clonación que puede acomodar un ADN extraño con un tamaño medio de 120 a 350 kb, 19-21 que aparentemente tolera más grande inse DNArts que hacen otros vectores de clonación. Este enfoque de clonación será generalmente aplicable a muchos otros virus de ARN de cadena positiva, particularmente aquellos con un gran genoma de ARN de ~ 10 a 32 kb. Generación de un clon de cDNA infeccioso es un paso clave en el desarrollo de un sistema de genética inversa para los virus de ARN, especialmente para los virus de ARN de cadena positiva, porque su genoma actúa como ARNm viral que se traduce en proteínas por los ribosomas de la célula huésped. Por lo tanto, la replicación viral puede ser iniciado por la introducción de un genoma de ARN de longitud molécula de ADNc derivado en una célula huésped susceptible. La disponibilidad de un clon de ADNc infeccioso JEV, cuando se combina con la tecnología de ADN recombinante, se ha incrementado nuestra comprensión de los diversos aspectos del ciclo de vida viral a nivel molecular, tales como la expresión génica y la replicación del genoma 73,79. 63,64 Además, una ADNc de longitud completa JEV clon ha demostrado ser una herramienta valiosa para el desarrollo de vacunas antivirales 28 y vectores de suministro de genes. &lt;sup&gt; 80,81 Al igual que con todos los virus de ARN de cadena positiva, hay múltiples pasos críticos en la construcción de un ADNc funcional confiable para JEV partir de la cual RNAs altamente infecciosas se pueden sintetizar in vitro. Idealmente, la secuencia de los ARN sintéticos transcritos a partir de un clon del ADNc de longitud completa debe ser idéntica a la del ARN genómico viral, en particular los 5&#39;-y 3&#39;-terminales secuencias que se requieren para la iniciación de la replicación viral RNA . de 60-62 En el protocolo actual, el auténtico 5&#39;-y 3&#39;-extremos se aseguraron mediante la colocación de la secuencia del promotor SP6 aguas arriba de la primera de nucleótidos de adenina del genoma viral y el posicionamiento de un sitio artificial única restricción Xba I aguas abajo de la última timina nucleótidos del genoma viral, respectivamente. Capsulado RNAs sintéticos con el auténtico 5 &#39;y 3&#39; se produjeron mediante transcripción run-off de un cDNA te Xba I-linealizado y tratado con MBNmplate usando SP6 ARN polimerasa cebada con la m 7 G (5 &#39;) ppp (5&#39;) Un análogo de tapa. Este protocolo puede ser modificado de varias maneras. Para la transcripción in vitro, otro ARN del bacteriófago polimerasa (por ejemplo, T3 o T7) se puede utilizar en conjunción con su secuencia promotora bien definido. 27 Como un sitio run-off, un sitio de restricción diferente se puede utilizar si no está presente en el genoma viral y si ARN sintético a partir del ADNc linealizado termina con el final auténtico 3 &#39;. La importancia de la secuencia de nucleótidos del extremo 3 &#39;se ha demostrado por una disminución de ~ 10 veces en la infectividad del ARN cuando un ARN sintético contiene tres o cuatro nucleótidos-virus no relacionado en su extremo 3&#39;. 27 En una reacción de transcripción in vitro, tanto la m 7 G (5 &#39;) ppp (5&#39;) A y m 7 G (5 &#39;) ppp (5&#39;) G analógico tapa puede ser utilizado igualmente bien, aunque los últimos lugares una relación G nucleótidos extra de aguas arriba de la viral 5 &#39;-end, pero queAdemás no altera la infectividad o replicación del ARN sintético. 27 Por otra parte, la eliminación de la plantilla de ADNc a partir de los transcritos de ARN por digestión con DNasa I no es necesario para las pruebas de ARN de infectividad, porque la plantilla de cDNA en sí no es infecciosa. 27 La tecnología BAC ahora se ha aplicado a la construcción de clones de cDNA infecciosos para un puñado de virus de ARN de cadena positiva, a saber, dos JEVs, CNU / LP2 27 y SA 14 -14-2 28 (tamaño del genoma, ~ 11 kb); dos virus del dengue, BR / 90 26 y NGC 29 (~ 11 kb); la diarrea viral bovina virus, SD1 (~ 12 kb); 25 de dos virus de la peste porcina clásica, C y Paderborn (~ 12 kb); 24 el virus de la enfermedad de fronteras, Gifhorn (~ 12 kb); 24 el virus del síndrome reproductivo y respiratorio porcino , PL97-1 / LP1 (~ 15 kb); 30 el virus de la gastroenteritis transmisible, PUR46-MAD (~ 29 kb); 16 el virus de la peritonitis infecciosa felina,DF-2 (~ 29 kb); 32 el síndrome severo coronavirus respiratorio agudo, Urbani (~ 30 kb); 9 el síndrome respiratorio coronavirus Oriente Medio, EMC / 2012 (~ 30 kb); 17 y el coronavirus humano OC43 (~ 31 kb) 31 La principal ventaja de usar BAC para la construcción de ADNc es la alta estabilidad genética de los grandes, plásmidos BAC de 1 o 2 copias.; sin embargo, la naturaleza intrínseca de su número extremadamente bajo de copia es también una gran desventaja, debido a muy bajos rendimientos de ADN BAC y la consiguiente reducción en la pureza del ADN de BAC con respecto a la sede de ADN cromosómico. En el protocolo actual, el rendimiento de ADN de BAC se maximiza por el crecimiento de E. coli DH10B transformó con el pBAC BAC infeccioso / SA 14 -14-2 en un medio rico en nutrientes, 2xYT. A pesar de este esfuerzo, el rendimiento promedio es de sólo ~ 15 g de ADN BAC a partir de 500 ml de caldo 2xYT. Además, la pureza del ADN de BAC se logra mejor mediante el uso de CsCl-EtBr centrifugación en gradiente de densidad para la purificación, En lugar del plásmido aislamiento basado en columnas de uso común. Sin embargo, es importante tener en cuenta que la E. BAC-transformado coli no debe crecer demasiado, ya que podría poner en peligro la estabilidad genética del cDNA clonado, y un mayor crecimiento no necesariamente conducir a mayores rendimientos o ADN BAC de mayor pureza. El protocolo descrito aquí es un optimizado, y el método aerodinámico eficiente para la construcción y propagación de una larga duración cDNA clon infeccioso genéticamente estable como un BAC de JEV, un procedimiento, una vez pensó prácticamente imposible. Esta misma estrategia de clonación se puede aplicar también a muchos otros virus de ARN de cadena positiva. En general, los clones de ADNc infecciosos nos permiten introducir una variedad de mutaciones (por ejemplo, deleciones, inserciones, y mutaciones puntuales) en un genoma de ARN viral para estudiar sus funciones biológicas en la replicación viral y la patogénesis. Este sistema de genética inversa basada en cDNA hace que sea posible desarrollar y TESt vacuna y candidatos terapéuticos dirigidos a un factor de virulencia (s) de un virus de ARN de cadena positiva particular de interés. Además, esta tecnología cDNA infeccioso también puede ser utilizado como un vector viral, capaz de expresar un gen extraño (s) de interés para muchas aplicaciones en la investigación biomédica.

Para virólogos de ARN, el advenimiento de la tecnología del ADN recombinante a finales de 1970 hizo posible convertir genomas de ARN viral en los clones de ADNc, que luego podrían ser propagan como plásmidos en bacterias para la manipulación genética de los virus de ARN. 1 La primera virus de ARN para ser molecularmente clonado se Qß bacteriófago, un virus de ARN de cadena positiva que infecta a Escherichia coli. Un plásmido que contiene una copia completa de ADNc del ARN genómico Qß dio lugar a fagos Qß infecciosas cuando se introduce en E. coli. 2 Poco después, esta técnica se aplicó a poliovirus, un virus de ARN de cadena positiva de los seres humanos y animales. Un plásmido que lleva un ADNc de longitud completa del ARN genómico poliovirus se infecciosas cuando se transfecta en células de mamífero y capaz de producir viriones infecciosos 3 En este enfoque &quot;DNA-puesto en marcha&quot;, los ADNc clonados deben ser transcritas intracelularmente para iniciar la replicación del ARN viral.;Sin embargo, no está claro cómo se inicia la transcripción y cómo las transcripciones se procesan a la secuencia viral correcta. Esta preocupación ha llevado al desarrollo de un &quot;RNA-lanzado&quot; enfoque alternativo, en el que se clona una copia completa de ADNc del genoma de ARN viral bajo un promotor reconocido por una E. coli o ARN polimerasa del fago para la producción de RNAs sintéticos in vitro con definido 5 &#39;y 3&#39;, que se someten al ciclo de replicación viral completa cuando se introduce en células huésped. 4,5 El primer éxito con este enfoque se informó para el virus del mosaico del bromo 6,7, un virus de ARN de cadena positiva de las plantas. Desde entonces, el enfoque de ARN-lanzado ha sido desarrollado para una amplia gama de virus de ARN de cadena positiva, incluyendo calicivirus, flavivirus, alfavirus, arterivirus y coronavirus. 1,4,5,8 Tanto en el ADN y ARN-lanzado sistemas de genética inversa, la construcción de un full de longitud clon de ADNc es la clave para la generación de ADN o ARN infecciosa de los virus de ARN de cadena positiva, pero se convierte en un considerable reto técnico como el tamaño de los aumentos del genoma viral. 9-17 En particular, un gran genoma de ARN de ~ 10 -32 kb presenta tres principales obstáculos para la clonación de un ADNc funcional de cuerpo entero. 18 La primera dificultad es la síntesis de una fiel copia de ADNc, ya que la fidelidad de RT-PCR es inversamente proporcional a la longitud del ARN viral. El segundo obstáculo es la presencia de secuencias potencialmente tóxicos, ya que las moléculas de ARN largas son más propensas a contener secuencias inesperadas capaces de hacer que el fragmento de ADNc en los plásmidos inestables en E. coli. La tercera y más importante problema es la disponibilidad de un vector adecuado, ya que es difícil encontrar un vector de clonación que puede albergar un inserto de ADNc viral de&gt; 10 kb. Durante las últimas tres décadas, estas barreras han sido superadas por varios avances en enzimología, la metodología, un. d vectorología 1,4,5,8 De éstos, el desarrollo más prometedor e innovador es la clonación de grandes virus de ARN de cadena positiva cromosomas artificiales bacterianos (BAC como infecciosas). El vector de BAC es un plásmido de bajo copia clonación (1-2 copias / célula) basado en el E. factor de fertilidad coli, con un tamaño medio de inserto de ADN de ~ 120-350 kb 19 a 21 Un fragmento de ADN se inserta en el vector de BAC en una manera similar a la clonación en vectores de clonación generales.; los clones BAC resultantes son estables a lo largo de muchas generaciones en E. . coli 22,23 Hasta la fecha, la tecnología BAC se ha utilizado para crear clones de cDNA infecciosos para&gt; 10 miembros de tres familias de virus de ARN de cadena positiva, es decir, Flaviviridae, 24-29 de Arteriviridae, 30 y Coronaviridae. 9,16,17 , 31,32 El uso de virus de la encefalitis japonesa (JEV) como ejemplo, el presente trabajo presenta los procedimientos detallados que pueden serutilizado para construir un integral BAC infeccioso genéticamente estable para una variedad de virus de ARN de cadena positiva. JEV es un flavivirus zoonótica 33 que se transmite en la naturaleza entre las aves, cerdos y otros huéspedes vertebrados por mosquitos vectores 34,35. En los seres humanos, la infección por JEV puede causar la enfermedad neurológica encefalitis japonesa a menudo fatal grave (JE), 36 que se produce en Asia y partes del Pacífico occidental, 37,38, con una incidencia anual estimada de ~ 50,000-175,000 casos clínicos. 39,40 El genoma de JEV es un ~ 11 kb, de sentido positivo molécula de ARN de cadena simple y consiste en termina un solo marco de lectura abierto (ORF) flanqueada por dos regiones no codificantes (NCR) en los extremos 5 &#39;y 3&#39;. 41,42 El ORF codifica una poliproteína que se escinde por el anfitrión y proteasas virales para generar 10 proteínas individuales, designada C, prM, E, NS1, NS2A, NS2B, NS3, NS4A, NS4B y NS5 en el N- a la dirección C-terminal. 34,43,44 Además, un correoforma Xtended de NS1 (NS1) se expresa por -1 frameshifting ribosomal en los codones 8-9 de NS2A. 45,46 De estas 11 proteínas, las tres proteínas estructurales (C, prM y E) son esenciales para la formación de infecciosa viriones, 47,48 y los restantes ocho proteínas no estructurales (NS1 a NS5 y NS1 &#39;) son cruciales para la replicación viral ARN, ensamblaje de partículas 49-51, 52-56 y evasión de la inmunidad innata. 57-59 Tanto el 5&#39; y 3 &#39;NCR contienen conservan secuencias primarias y las estructuras de forma de ARN secundarias / terciarias, 60-62, que son importantes para la modulación de la replicación del ARN viral. 63,64 Este protocolo describe las herramientas, métodos y estrategias para la generación de un larga duración infecciosa BAC de JEV SA 14 -14-2. 28 Este clon BAC funcional contiene una copia completa de ADNc del ARN genómico JEV, 65 que está rodeada por un promotor para la ARN polimerasa SP6 aguas arribadel viral extremo 5 &#39;y un sitio de restricción Xba I único aguas abajo del extremo 3&#39; viral para la transcripción in vitro de escorrentía. Esta tecnología BAC es aplicable a la construcción de un clon de ADNc molecular totalmente funcional para una gran variedad de virus de ARN de cadena positiva.

<table border="0" cellpadding="0" cellspacing="0" width="1054">
	<tbody>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">1. Molecular Cloning</td>
			<td style="width:275px;"></td>
			<td style="width:243px;"></td>
			<td style="width:235px;"></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">2xYT Broth</td>
			<td style="width:275px;">Sigma-Aldrich</td>
			<td style="width:243px;">Y2377</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">[3H]UTP</td>
			<td style="width:275px;">PerkinElmer</td>
			<td style="width:243px;">NET380250UC</td>
			<td>Radioactive</td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">50-mL Tube</td>
			<td style="width:275px;">Thermo Scientific (Nalgene)</td>
			<td style="width:243px;">3114-0050</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">250-mL Bottle</td>
			<td style="width:275px;">Beckman Coulter</td>
			<td style="width:243px;">356011</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Agarose</td>
			<td style="width:275px;">Lonza</td>
			<td style="width:243px;">50004</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Agarose (Low Melting Point)</td>
			<td style="width:275px;">Life Technologies (Invitrogen)</td>
			<td style="width:243px;">16520-100</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">AvaI</td>
			<td style="width:275px;">New England BioLabs</td>
			<td style="width:243px;">R0152S</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">AvrII</td>
			<td style="width:275px;">New England BioLabs</td>
			<td style="width:243px;">R0174S</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">BamHI</td>
			<td style="width:275px;">New England BioLabs</td>
			<td style="width:243px;">R0136S</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">BsiWI</td>
			<td style="width:275px;">New England BioLabs</td>
			<td style="width:243px;">R0553S</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">BsrGI</td>
			<td style="width:275px;">New England BioLabs</td>
			<td style="width:243px;">R0575S</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Butanol</td>
			<td style="width:275px;">Fisher Scientific</td>
			<td style="width:243px;">A399-1&#160;</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Cap Analog [m7G(5&#697;)ppp(5&#697;)A]</td>
			<td style="width:275px;">New England BioLabs</td>
			<td style="width:243px;">S1405S</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Cesium Chloride</td>
			<td style="width:275px;">Fisher Scientific</td>
			<td style="width:243px;">BP1595-1</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Chloramphenicol</td>
			<td style="width:275px;">Sigma-Aldrich</td>
			<td style="width:243px;">C0378</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Chloroform</td>
			<td style="width:275px;">Sigma-Aldrich</td>
			<td style="width:243px;">C2432</td>
			<td>Carcinogenic</td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">DE-81 Filter Paper</td>
			<td style="width:275px;">GE Healthcare Life Sciences</td>
			<td style="width:243px;">3658-023</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">dNTP mix</td>
			<td style="width:275px;">Life Technologies (Invitrogen)</td>
			<td style="width:243px;">18427-088</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">E. coli DH10B&#160;</td>
			<td style="width:275px;">Life Technologies (Invitrogen)</td>
			<td style="width:243px;">18297-010</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">EDTA</td>
			<td style="width:275px;">Sigma-Aldrich</td>
			<td style="width:243px;">E5134</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Ethanol&#160;</td>
			<td style="width:275px;">Sigma-Aldrich</td>
			<td style="width:243px;">E7023</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Ethidium Bromide</td>
			<td style="width:275px;">Sigma-Aldrich</td>
			<td style="width:243px;">E7637</td>
			<td>Toxic and highly mutagenic</td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Filter Column (Plasmid Maxiprep Kit)</td>
			<td style="width:275px;">Life Technologies (Invitrogen)</td>
			<td style="width:243px;">K2100-26</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Glacial Acetic Acid</td>
			<td style="width:275px;">Sigma-Aldrich</td>
			<td style="width:243px;">A6283</td>
			<td>Irritating</td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Glucose</td>
			<td style="width:275px;">Sigma-Aldrich</td>
			<td style="width:243px;">G5400</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Glycogen&#160;</td>
			<td style="width:275px;">Roche</td>
			<td style="width:243px;">10901393001</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">High-Fidelity DNA Polymerase</td>
			<td style="width:275px;">New England BioLabs</td>
			<td style="width:243px;">M0491S</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Isoamyl Alcohol</td>
			<td style="width:275px;">Sigma-Aldrich</td>
			<td style="width:243px;">I9392</td>
			<td>Flammable</td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Isopropanol&#160;</td>
			<td style="width:275px;">Amresco</td>
			<td style="width:243px;">0918</td>
			<td>Flammable</td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">LB Broth</td>
			<td style="width:275px;">Life Technologies (Invitrogen)</td>
			<td style="width:243px;">12795-027</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Lithium Chloride</td>
			<td style="width:275px;">Sigma-Aldrich</td>
			<td style="width:243px;">L9650</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Lysozyme</td>
			<td style="width:275px;">Amresco</td>
			<td style="width:243px;">0663</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Magnesium Chloride</td>
			<td style="width:275px;">Sigma-Aldrich</td>
			<td style="width:243px;">M8266</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">M-MLV Reverse Transcriptase</td>
			<td style="width:275px;">Life Technologies (Invitrogen)</td>
			<td style="width:243px;">18080-044</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Mung Bean Nuclease</td>
			<td style="width:275px;">New England BioLabs</td>
			<td style="width:243px;">M0250S</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Needle (18G, 20G)</td>
			<td style="width:275px;">BD</td>
			<td style="width:243px;">305196, 305175</td>
			<td>Biohazardous (Sharps waste)</td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">NotI</td>
			<td style="width:275px;">New England BioLabs</td>
			<td style="width:243px;">R0189S</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Oligonucleotide</td>
			<td style="width:275px;">Integrated DNA Technologies</td>
			<td style="width:243px;">Custom Oligonucleotide Synthesis</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">PacI</td>
			<td style="width:275px;">New England BioLabs</td>
			<td style="width:243px;">R0547S</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">pBeloBAC11</td>
			<td style="width:275px;">New England BioLabs</td>
			<td style="width:243px;">ER2420S (E4154S)</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Phenol (Buffer-Saturated)</td>
			<td style="width:275px;">Life Technologies (Invitrogen)</td>
			<td style="width:243px;">15513-039</td>
			<td>Toxic and highly corrosive</td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Phenol:Chloroform:Isoamyl Alcohol</td>
			<td style="width:275px;">Life Technologies (Invitrogen)</td>
			<td style="width:243px;">15593-031</td>
			<td>Toxic and highly corrosive</td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Phenol:Guanidine Isothiocyanate</td>
			<td style="width:275px;">Life Technologies (Ambion)</td>
			<td style="width:243px;">10296-010</td>
			<td>Toxic, corrosive, and irritating</td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Pme I</td>
			<td style="width:275px;">New England BioLabs</td>
			<td style="width:243px;">R0560S</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Potassium Acetate</td>
			<td style="width:275px;">Amresco</td>
			<td style="width:243px;">0698</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">RNase Inhibitor</td>
			<td style="width:275px;">Life Technologies (Invitrogen)</td>
			<td style="width:243px;">10777-019</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">rNTP Set</td>
			<td style="width:275px;">GE Healthcare Life Sciences</td>
			<td style="width:243px;">27-2025-01</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Sealable Polypropylene Tube (16 &#215; 76 mm)&#160;</td>
			<td style="width:275px;">Beckman Coulter</td>
			<td style="width:243px;">342413</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">SfiI</td>
			<td style="width:275px;">New England BioLabs</td>
			<td style="width:243px;">R0123S</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Sma I</td>
			<td style="width:275px;">New England BioLabs</td>
			<td style="width:243px;">R0141S</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Sodium Acetate</td>
			<td style="width:275px;">Sigma-Aldrich</td>
			<td style="width:243px;">S2889</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Sodium Dodecyl Sulfate</td>
			<td style="width:275px;">Amresco</td>
			<td style="width:243px;">0227</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Sodium Hydroxide</td>
			<td style="width:275px;">Sigma-Aldrich</td>
			<td style="width:243px;">S5881</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">SP6 RNA Polymerase</td>
			<td style="width:275px;">New England BioLabs</td>
			<td style="width:243px;">M0207S</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Spin Column (Plasmid Miniprep Kit)</td>
			<td style="width:275px;">Life Technologies (Invitrogen)</td>
			<td style="width:243px;">K2100-11</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Syringe</td>
			<td style="width:275px;">HSW NORM-JECT</td>
			<td style="width:243px;">4200.000V0</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">T4 DNA Ligase</td>
			<td style="width:275px;">New England BioLabs</td>
			<td style="width:243px;">M0202S</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Tris</td>
			<td style="width:275px;">Amresco</td>
			<td style="width:243px;">0826</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">tRNA (yeast)</td>
			<td style="width:275px;">Life Technologies (Invitrogen)</td>
			<td style="width:243px;">15401-011</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">XbaI&#160;</td>
			<td style="width:275px;">New England BioLabs</td>
			<td style="width:243px;">R0145S</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Name</td>
			<td style="width:275px;">Company</td>
			<td style="width:243px;">Catalog Number</td>
			<td>Comments</td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">2. Cell Culture</td>
			<td style="width:275px;"></td>
			<td style="width:243px;"></td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Alpha Minimal Essential Medium</td>
			<td style="width:275px;">Life Technologies (Gibco)</td>
			<td style="width:243px;">12561-049</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Conical Tube (50 mL)</td>
			<td style="width:275px;">VWR</td>
			<td style="width:243px;">21008-242</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Crystal Violet&#160;</td>
			<td style="width:275px;">Sigma-Aldrich</td>
			<td style="width:243px;">C0775</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Culture Dish (150 mm)&#160;</td>
			<td style="width:275px;">TPP</td>
			<td style="width:243px;">93150&#160;</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Cuvette (2-mm Gap)</td>
			<td style="width:275px;">Harvard Apparatus</td>
			<td style="width:243px;">450125&#160;</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Fetal Bovine Serum&#160;</td>
			<td style="width:275px;">Life Technologies (Gibco)</td>
			<td style="width:243px;">16000-044</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Formaldehyde</td>
			<td style="width:275px;">Sigma-Aldrich</td>
			<td style="width:243px;">F1635</td>
			<td>Toxic and carcinogenic</td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Glutamine</td>
			<td style="width:275px;">Life Technologies (Gibco)</td>
			<td style="width:243px;">25030-081</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Minimal Essential Medium</td>
			<td style="width:275px;">Life Technologies (Gibco)</td>
			<td style="width:243px;">61100-061</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Penicillin/Streptomycin</td>
			<td style="width:275px;">Life Technologies (Gibco)</td>
			<td style="width:243px;">15070-063</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Potassium Chloride</td>
			<td style="width:275px;">Sigma-Aldrich</td>
			<td style="width:243px;">P3911</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Potassium Phosphate Monobasic</td>
			<td style="width:275px;">Sigma-Aldrich</td>
			<td style="width:243px;">P9791</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Six-Well Plate</td>
			<td style="width:275px;">TPP</td>
			<td style="width:243px;">92006</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Sodium Chloride</td>
			<td style="width:275px;">Sigma-Aldrich</td>
			<td style="width:243px;">S3014</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Sodium Phosphate Dibasic</td>
			<td style="width:275px;">Sigma-Aldrich</td>
			<td style="width:243px;">S3264</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Trypsin-EDTA (0.25%)</td>
			<td style="width:275px;">Life Technologies (Gibco)</td>
			<td style="width:243px;">25200-056</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Vitamins</td>
			<td style="width:275px;">Sigma-Aldrich</td>
			<td style="width:243px;">M6895</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Name</td>
			<td style="width:275px;">Company</td>
			<td style="width:243px;">Catalog Number</td>
			<td>Comments</td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">3. Equipment</td>
			<td style="width:275px;"></td>
			<td style="width:243px;"></td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Agarose Gel Electrophoresis System</td>
			<td style="width:275px;">Mupid</td>
			<td style="width:243px;">MPDEXU-01</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">CO2 Incubator</td>
			<td style="width:275px;">Thermo Scientific</td>
			<td style="width:243px;">Heracell 150i</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Desktop Centrifuge&#160;</td>
			<td style="width:275px;">Thermo Scientific</td>
			<td style="width:243px;">ST16R</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Electroporator</td>
			<td style="width:275px;">Harvard Apparatus</td>
			<td style="width:243px;">ECM 830</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Longwave Ultraviolet Lamps (Handheld)</td>
			<td style="width:275px;">UVP</td>
			<td style="width:243px;">UVGL-58</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Tabletop Centrifuge</td>
			<td style="width:275px;">Beckman Coulter</td>
			<td style="width:243px;">368826</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Thermocycler</td>
			<td style="width:275px;">Life Technologies (Applied Biosystems)</td>
			<td style="width:243px;">GeneAmp PCR System 9700</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Vortexer</td>
			<td style="width:275px;">Scientific Industries</td>
			<td style="width:243px;">G-560</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Water Bath</td>
			<td style="width:275px;">Jeio Tech</td>
			<td style="width:243px;">WB-10E</td>
			<td></td>
		</tr>
	</tbody>
</table>

bacterial artificial chromosomes: a functional genomics tool for the study of positive-strand rna viruses

Reverse genetics, an approach to rescue infectious virus entirely from a cloned cDNA, has revolutionized the field of positive-strand RNA viruses, whose genomes have the same polarity as cellular mRNA. The cDNA-based reverse genetics system is a seminal method that enables direct manipulation of the viral genomic RNA, thereby generating recombinant viruses for molecular and genetic studies of both viral RNA elements and gene products in viral replication and pathogenesis. It also provides a valuable platform that allows the development of genetically defined vaccines and viral vectors for the delivery of foreign genes. For many positive-strand RNA viruses such as Japanese encephalitis virus (JEV), however, the cloned cDNAs are unstable, posing a major obstacle to the construction and propagation of the functional cDNA. Here, the present report describes the strategic considerations in creating and amplifying a genetically stable full-length infectious JEV cDNA as a bacterial artificial chromosome (BAC) using the following general experimental procedures: viral RNA isolation, cDNA synthesis, cDNA subcloning and modification, assembly of a full-length cDNA, cDNA linearization, in vitro RNA synthesis, and virus recovery. This protocol provides a general methodology applicable to cloning full-length cDNA for a range of positive-strand RNA viruses, particularly those with a genome of &gt;10 kb in length, into a BAC vector, from which infectious RNAs can be transcribed in vitro with a bacteriophage RNA polymerase.

Para todos los virus de ARN de cadena positiva, la fiabilidad y la eficiencia de un sistema de genética inversa dependen de la estabilidad genética de un ADNc de longitud completa clonado, cuya secuencia es equivalente a la secuencia consenso de ARN genómico viral. 27 La figura 1 muestra un anillo de cinco estrategia de paso para la construcción de un cDNA infeccioso de longitud completa como un BAC para JEV SA 14 -14-2 28: Paso 1, la purificación de ARN viral a partir del sobrenadante de cultivo celular de células BHK-21 infectadas por el JEV (Figura 1A); Paso 2, la síntesis de cuatro amplicones de ADNc superpuestas (F1 a F4) que abarcan todo el genoma viral (Figura 1B); Paso 3, la subclonación de cada uno de los cuatro fragmentos de ADNc contiguas en un vector BAC, creando pBAC / F1 a pBAC / F4 (Figura 1C); Paso 4, la modificación de los ADNc clonados para la transcripción in vitro el escurrimiento con SP6 ARN polimerasa, es decir, la colocación de un SP6secuencia del promotor inmediatamente corriente arriba del extremo 5 &#39;viral (pBAC / F1 SP6), la eliminación de una pre-existente sitio interno Xba I en el nucleótido 9131 mediante la introducción de una mutación puntual silenciosa, A 9134 → T (pBAC / F3 KO), y la inserción de un sitio de escorrentía nueva Xba artificial inmediatamente aguas abajo de la viral extremo 3 &#39;(pBAC / F4 RO) (Figura 1 D); y el Paso 5, el montaje de un álbum SA 14 -14-2 ADNc BAC, pBAC / SA 14 -14-2 (Figura 1E) Tabla. 1 se enumeran los oligonucleótidos utilizados en este procedimiento de clonación. 28 Para la construcción de un ADNc JEV funcional, el primer paso importante es la síntesis de los cuatro fragmentos de ADNc solapados utilizando el ARN viral purificado como molde para la RT-PCR. La Figura 2 proporciona un resultado representativo para los cuatro productos de RT-PCR que eran electroforesis en un 0,8%gel de agarosa. Este gel demuestra claramente que un ADNc de longitud completa JEV se amplifica en cuatro fragmentos de ADNc que se solapan. Ocasionalmente, las reacciones de RT-PCR podrían producir uno o más productos específicos del virus o no específicos que son en su mayoría más pequeño que el producto esperado, debido a la hibridación no específica de los cebadores durante la síntesis de ADNc / amplificación. Por otro lado, poca o ninguna espera que el producto de RT-PCR se amplificó debido a la contaminación accidental RNasa durante el aislamiento de ARN viral o impropio rendimiento RT-PCR. El siguiente paso clave es la clonación y la modificación de una de longitud completa parcial- o ADNc JEV en BAC, que es un procedimiento relativamente sencillo que utiliza técnicas estándar de ADN recombinante. 69 Figura 3 presenta un resultado representativo para la purificación del clon BAC que contiene un ADNc de longitud completa de JEV SA 14 -14-2 por bandas en un gradiente de CsCl-EtBr.En este experimento, después de centrifugación durante 16 horas a 401.700 xg, dos bandas distintas, es decir, el E. coli ADN cromosómico anterior y el plásmido de ADN superenrollado BAC a continuación, son visibles en el centro del tubo bajo luz ultravioleta de onda larga. Un volumen mínimo (~ 400 l) de la banda de ADN BAC inferior se recogió cuidadosamente por hacer un agujero con una jeringa en el lado del tubo. Posteriormente, el EtBr se extrajo a partir del ADN de BAC por extracción butanol, y el ADN BAC-EtBr libre se concentró por precipitación con etanol. El paso final es la determinación de la infectividad específica de los RNAs sintéticos transcritas in vitro a partir de longitud completa SA 14 -14-2 BAC (pBAC / SA 14 -14-2) después de transfección de ARN en las células permisivas (Figura 4). Este paso consiste en tres pasos secuenciales: Paso 1, linealización de los de larga duración SA 14 -14-2 cDNA en el 3 &#39;-end del genoma viral (Figura 4A); Paso 2, la producción de los ARN sintéticos a partir del ADNc linealizado por escorrentía de transcripción (Figura 4B); y el Paso 3, rescate de los virus recombinantes en células BHK-21 transfectadas con los ARN sintéticos (Figura 4C). Experimentalmente, dos clones independientes de pBAC / SA 14 -14-2 fueron linealizados con la digestión XbaI y tratados con MBN para quitar los cuatro-base 5 &#39;saliente generado por la digestión XbaI. Los BAC linealizadas se limpiaron mediante extracción con fenol-cloroformo, seguido de precipitación con etanol. La linealización de los dos BAC purificados se demostró en un gel de agarosa al 0,8% (Figura 5A). La extracción con fenol-cloroformo debe hacerse con cuidado para asegurarse de que la BAC linealizadas son RNasa libre. Cada uno de los dos BAC linealizadas sirvió como molde de ADNc para la transcripción run-off usando SP6 RNA polimerasa en presencia de la m 7 G (5 &#39;) ppp (5&#39;) Un análogo de tapa. La integridad de los ARN sintéticos se demostró mediante la ejecución de partes alícuotas de las dos mezclas de reacción de transcripción en un gel de agarosa al 0,6%, junto con una referencia 1 kb escalera de ADN (Figura 5B). En este sencillo ensayo, la banda principal de ARN prominente siempre migra justo por debajo de los 3 kb referencia banda de ADN y que parecía ser agudo. Sin embargo, la degradación de ARN tendría una apariencia manchada en el mismo gel. Un ensayo de centro infeccioso es el estándar de oro para determinar la infectividad específica de los ARN sintéticos. Este ensayo se realizó por electroporación células BHK-21 con muestras de ARN, la siembra de la igualdad de alícuotas de las 10 veces las células diluidas en serie a electroporación en placas de 6 pocillos que contienen células ingenuas BHK-21 (3 × 10 5 células / pocillo), y la superposición de agarosa sobre las monocapas de células. Después de la incubación durante 4 días, las células supervivientes se fijaron con formaldehído y se tiñeron con cristal violeta s unaolución para cuantificar el número de centros infecciosas (placas), que corresponde al número de moléculas de ARN infecciosos entregado en las células (Figura 6A). Puesto que el molde de cDNA usado para la transcripción in vitro se ha demostrado ser no infecciosa, 27 una parte alícuota de la mezcla de reacción de transcripción se usó directamente para la electroporación. La electroporación es el método preferido para la transfección de ARN; Alternativamente, los ARN se pueden transfectar por otros métodos que utilizan liposomas DEAE-dextrano y catiónicos. RNA electroporación es muy eficaz, pero &quot;arco&quot; del pulso eléctrico se produce raramente, si sales están presentes en la reacción de electroporación o si la cubeta de electroporación se reutiliza. La expresión de proteínas virales en las células transfectadas con ARN se examinó mediante ensayos de inmunofluorescencia utilizando un antisuero de conejo anti-NS1 (Figura 6B). La producción de partículas virales acumulados en los sobrenadantes de células transfectadas con ARN fue unaalyzed por ensayos de placa (Figura 6C). Los resultados de estos experimentos muestran claramente que los RNAs sintéticos derivados de cDNA son infecciosos en células permisivas BHK-21, generando un alto título de virus recombinantes. <table fo:keep-together.within-page="1"><tbody><tr><td> Oligonucleótido </td><td> Secuencia A (5 &#39;a 3&#39;) </td><td> Posición b </td><td> Polaridad </td></tr><tr><td> 1RT </td><td> TAGGGATCTGGGCGTTTCTG GCAAAT </td><td> 2578-2603 </td><td> Antisentido </td></tr><tr><td> 1F </td><td> aatcccgggAGAAGTTTATC TGTGTGAACTT </td><td> 1.22 </td><td> Sentido </td></tr><tr><td> 1R </td><td> attgcggccgcCCACGTCGT TGTGCACGAAGAT </td><td> 2532-2553 </td><td> Antisentido </td></tr><tr><td> 2RT </td><td> TTCTGCCTACTCTGCCCCTC CGTTGA </td><td> 5975-6000 </td><td> HormigaIntuyo </td></tr><tr><td> 2F </td><td> aatcccgggTCAAGCTCAGT GATGTTAACAT </td><td> 1800-1821 </td><td> Sentido </td></tr><tr><td> 2R </td><td> attgcggccgcGATGGGTTT CCGAGGATGACTC </td><td> 5929-5950 </td><td> Antisentido </td></tr><tr><td> 3RT </td><td> ACGGTCTTTCCTTCTGCTGC AGGTCT </td><td> 9426-9451 </td><td> Antisentido </td></tr><tr><td> 3F </td><td> aatcccgggGAGGATACATT GCTACCAAGGT </td><td> 5500-5521 </td><td> Sentido </td></tr><tr><td> 3R </td><td> attgcggccgcGTAAGTCAG TTCAATTATGGCT </td><td> 9380-9401 </td><td> Antisentido </td></tr><tr><td> 4RT </td><td> AGATCCTGTGTTCTTCCTCA CCACCA </td><td> 10952-10977 </td><td> Antisentido </td></tr><tr><td> 4F </td><td> aatcccgggAGTGGAAGGCT CAGGCGTCCAA </td><td> 9200-9221 </td><td> Sentido </td></tr><tr><td> 4R </td><td> attgcggccgcAGATCCTGT GTTCTTCCTCACC </td><td> 10.956 a 10977 </td><td> Antisentido </td></tr><tr><td> SP6F </td><td> cataccccgcgtattcccac ejército de reserva </td><td></td><td> Sentido </td></tr><tr><td> SP6R </td><td> ACAGATAAACTTCTctatag tgtcccctaaa </td><td> 01.14 </td><td> Antisentido </td></tr><tr><td> F1F </td><td> aggggacactatagAGAAGT TTATCTGTGTG </td><td> 1-17 </td><td> Sentido </td></tr><tr><td> F1R </td><td> TGGATCATTGCCCATGGTAA GCTTA </td><td> 638-662 </td><td> Antisentido </td></tr><tr><td> X1F </td><td> CGAATGGATCGCACAGTGTG GAGAG </td><td> 8403-8427 </td><td> Sentido </td></tr><tr><td> X1R </td><td> AAAGCTTCAAACTCAAGATA CCGTGCTCC </td><td> 9120-9148 </td><td> Antisentido </td></tr><tr><td> X2F </td><td> GGAGCACGGTATCTTGAGTT TGAAGCTTT </td><td> 9120-9148 </td><td> Sentido </td></tr><tr><td> X2R </td><td> cacgtggacgagggcatgcc tgcag </td><td></td><td> Antisentido </td></tr><tr><td> ROF </td><td> CCAGGAGGACTGGGTTACCA AAGCC </td><td> 10670 hasta 10694 </td><td> Sentido </td></tr><tr><td> ROR </td><td> agggcggccgctctagAGAT CCTGTGTTCTTCCTCACCAC </td><td> 10954 hasta 10.977 </td><td> Antisentido </td></tr><tr><td colspan="4"> unas secuencias JEV se muestran en letras mayúsculas, y las secuencias de BAC se indican en letras minúsculas. posición b nucleótidos se refiere a la secuencia completa del genoma de JEV SA 14 -14-2 (número de acceso GenBank JN604986). </td></tr></tbody></table> Tabla 1: Los oligonucleótidos utilizados para la síntesis de ADNc, amplificación por PCR, y mutagénesis de BAC. <img alt="Figura 1" src="/files/ftp_upload/53164/53164fig1.jpg" /> Figura 1.0; Estrategia para la construcción de un ADNc de longitud completa de JEV SA 14 -14-2 como BAC (A) Aislamiento de ARN viral de partículas JEV.. Se muestra un diagrama esquemático del ARN genómico de JEV SA 14 -14-2. (B) Síntesis de cuatro fragmentos de ADNc superpuestas (F1 a F4) que cubre la totalidad del genoma viral. (C) Subclonación de cuatro fragmentos de ADNc solapados en un vector BAC, creando pBAC / F1 a pBAC / F4. (D) La modificación de los ADNc clonados para la transcripción de escorrentía in vitro. pBAC / F1 SP6 es un derivado de pBAC / F1 que contiene la secuencia del promotor SP6 aguas arriba del extremo 5 &#39;viral. pBAC / F3 KO es un derivado de pBAC / F3 que contiene una mutación silenciosa punto (A → T 9134, asterisco). pBAC / F4 RO es un derivado de pBAC / F4 que contiene un sitio Xba I artificial escorrentía de aguas abajo del extremo 3 &#39;viral. (E </<html> strong&gt;) Asamblea de un álbum SA 14 -14-2 BAC (pBAC / SA 14 -14-2). <a href="https://www.jove.com/files/ftp_upload/53164/53164fig1large.jpg" target="_blank">Haga clic aquí para ver una versión más grande de esta figura.</a> <img alt="Figura 2" src="/files/ftp_upload/53164/53164fig2.jpg" /> Figura 2. Síntesis de cuatro fragmentos de ADNc superpuestas (F1 a F4) que abarca la longitud completa de ARN genómico de JEV SA 14 -14-2. Los cuatro productos de RT-PCR se evaluaron mediante electroforesis en un gel de agarosa al 0,8%. M, escalera de ADN de 1 kb. Los tamaños esperados de los cuatro fragmentos de ADNc se indican en la parte inferior de la imagen de gel. <a href="https://www.jove.com/files/ftp_upload/53164/53164fig2large.jpg" target="_blank">Por favor haga clic aquí para ver una versión más grande de esta figura.</a> /ftp_upload/53164/53164fig3.jpg &quot;/&gt; Figura 3. La purificación del BAC que contiene un ADNc de longitud completa de JEV SA 14 -14-2. El plásmido BAC está aislado de E. coli DH10B por el método de lisis alcalina y SDS-purificó adicionalmente por bandas en un gradiente de CsCl-EtBr. Se presenta un ejemplo de la gradiente de CsCl-EtBr usando un tubo de polipropileno sellable 16 × 76 mm. <a href="https://www.jove.com/files/ftp_upload/53164/53164fig3large.jpg" target="_blank">Por favor haga clic aquí para ver una versión más grande de esta figura.</a> <img alt="Figura 4" src="/files/ftp_upload/53164/53164fig4.jpg" /> Figura 4. Visión general de la recuperación de los virus infecciosos de un álbum JEV SA 14 -14-2 ADNc montado en un BAC. (A) Linealización de la plantilla de cDNA. La larga duración JEV BAC se corta conXba I y se trató con MBN. (B) Síntesis de los transcritos de ARN. El ADNc linealizado se transcribe por la ARN polimerasa SP6 en presencia del 7 m G (5 &#39;) ppp (5&#39;) Un análogo de tapa. (C) La recuperación de la JEVs sintético. Los in vitro ARN transcritos se transfectaron en células BHK-21 mediante electroporación, que genera un alto título de virus sintético. <a href="https://www.jove.com/files/ftp_upload/53164/53164fig4large.jpg" target="_blank">Por favor haga clic aquí para ver una versión más grande de esta figura.</a> <img alt="Figura 5" src="/files/ftp_upload/53164/53164fig5.jpg" /> Figura 5. Síntesis de los ARN por transcripción in vitro utilizando un JEV BAC de longitud completa como una plantilla de ADNc. (A) Generación de los de larga duración linealizado JEV BAC, pBAC / SA 14 -14-2. Dos clones independientes de pBAC/ SA 14 -14-2 (CL.1 y CL.2) se linealizadas por digestión con Xba I y posterior tratamiento con MBN. Los BAC linealizadas se examinan por electroforesis en un gel de agarosa al 0,8%. (B) Producción de los ARN sintéticos mediante transcripción escorrentía. Cada uno de los dos BAC linealizadas se usa como una plantilla para la transcripción de ARN polimerasa SP6 escorrentía. Las alícuotas de las dos reacciones de transcripción se ejecutan en un gel de agarosa al 0,6%. M, 1 kb escalera del ADN. <a href="https://www.jove.com/files/ftp_upload/53164/53164fig5large.jpg" target="_blank">Por favor haga clic aquí para ver una versión más grande de esta figura.</a> <img alt="Figura 6" src="/files/ftp_upload/53164/53164fig6.jpg" /> Figura 6. infectividad específica de los RNAs sintéticos transcritos a partir de un BAC JEV de longitud completa y la recuperación de virus sintético. Células BHK-21 son de forma simulada a electroporación (Mock) o electroporación con los transcritos de ARN derivados from cada uno de los dos clones independientes de los de larga duración JEV BAC (CL.1 y CL.2). (A) la infectividad del ARN. Las células se recubrieron con agarosa y se tiñeron con violeta cristal a los 4 días después de la transfección. RNA infectividad se determina mediante ensayos de centro infecciosas para estimar la cantidad de ARN infecciosa electroporación en las células (panel izquierdo). Además, se muestran imágenes representativas de centros infecciosos (panel derecho). (B) Expresión de proteínas. Las células se cultivan en portaobjetos de cámara de 4 pocillos. Expresión de la proteína viral en células de ARN-a electroporación en 20 horas después de la transfección (hpt) se analizó mediante ensayos de inmunofluorescencia utilizando un antisuero de conejo anti-NS1 primaria y una cabra conjugado con Cy3 secundario IgG anti-conejo (rojo). Los núcleos se contratiñeron con 4 &#39;, 6-diamidino-2-fenilindol (azul). Las imágenes de inmunofluorescencia se superponen en sus diferenciales correspondientes imágenes de contraste de interferencia. (C) de rendimiento Virus. Las células se cultivaron en 150 mm cultura platos. La producción de viriones infecciosos acumulados en los sobrenadantes de cultivo de células de ARN-electroporación en 22 y 40 hpt es examinado por ensayos de placa. <a href="https://www.jove.com/files/ftp_upload/53164/53164fig6large.jpg" target="_blank">Por favor haga clic aquí para ver una versión más grande de esta figura.</a>

Watch this Scientific Journal Video about Bacterial Artificial Chromosomes: A Functional Genomics Tool for the Study of Positive-strand RNA Viruses at JoVE.com

Bacterial Artificial Chromosomes: A Functional Genomics Tool for the Study of Positive-strand RNA Viruses

Here, a protocol is presented for creating an infectious bacterial artificial chromosome containing a full-length cDNA of the positive-strand genomic RNA of Japanese encephalitis virus. This protocol can be used to construct a functional cDNA of other positive-strand RNA viruses, making it a powerful genomic tool for studying virus biology.

Cromosomas artificiales bacterianos: una herramienta de Genómica Funcional para el Estudio de cadena positiva virus de ARN

Reverse genetics, an approach to rescue infectious virus entirely from a cloned cDNA, has revolutionized the field of positive-strand RNA viruses, whose ...

bacterial-artificial-chromosomes-functional-genomics-tool-for-study

Research

JoVE Journal

Immunology and Infection

21.2K vistas.  Utah State University. Here, a protocol is presented for creating an infectious bacterial artificial chromosome containing a full-length cDNA of the positive-strand genomic RNA of Japanese encephalitis virus. This protocol can be used to construct a functional cDNA of other positive-strand RNA viruses, making it a powerful genomic tool for studying virus biology.

Video: Bacterial Artificial Chromosomes: A Functional Genomics Tool for the Study of Positive-strand RNA Viruses

Isolation of Fidelity Variants of RNA Viruses and Characterization of Virus Mutation Frequency

RNA viruses use RNA dependent RNA polymerases to replicate their genomes. The intrinsically high error rate of these enzymes is a large contributor to the generation of extreme population diversity that facilitates virus adaptation and evolution. Increasing evidence shows that the intrinsic error rates, and the resulting mutation frequencies, of RNA viruses can be modulated by subtle amino acid changes to the viral polymerase. Although biochemical assays exist for some viral RNA polymerases that permit quantitative measure of incorporation fidelity, here we describe a simple method of measuring mutation frequencies of RNA viruses that has proven to be as accurate as biochemical approaches in identifying fidelity altering mutations. The approach uses conventional virological and sequencing techniques that can be performed in most biology laboratories. Based on our experience with a number of different viruses, we have identified the key steps that must be optimized to increase the likelihood of isolating fidelity variants and generating data of statistical significance. The isolation and characterization of fidelity altering mutations can provide new insights into polymerase structure and function1-3. Furthermore, these fidelity variants can be useful tools in characterizing mechanisms of virus adaptation and evolution4-7.

The present article describes the steps required to isolate and characterize RNA polymerase fidelity variants of RNA viruses and how to use mutation frequency data to confirm fidelity changes in tissue culture.

El aislamiento de las variantes de los virus de ARN de fidelidad y caracterización de la frecuencia de mutación de virus

RNA viruses use RNA dependent RNA polymerases to replicate their genomes. The intrinsically high error rate of these enzymes is a large contributor to the ...

Investigación

Inmunología e Infección

Separation of Single-stranded DNA, Double-stranded DNA and RNA from an Environmental Viral Community Using Hydroxyapatite Chromatography

Viruses, particularly bacteriophages (phages), are the most numerous biological entities on Earth1,2. Viruses modulate host cell abundance and diversity, contribute to the cycling of nutrients, alter host cell phenotype, and influence the evolution of both host cell and viral communities through the lateral transfer of genes 3. Numerous studies have highlighted the staggering genetic diversity of viruses and their functional potential in a variety of natural environments. 
Metagenomic techniques have been used to study the taxonomic diversity and functional potential of complex viral assemblages whose members contain single-stranded DNA (ssDNA), double-stranded DNA (dsDNA) and RNA genotypes 4-9. Current library construction protocols used to study environmental DNA-containing or RNA-containing viruses require an initial nuclease treatment in order to remove nontargeted templates 10. However, a comprehensive understanding of the collective gene complement of the virus community and virus diversity requires knowledge of all members regardless of genome composition. Fractionation of purified nucleic acid subtypes provides an effective mechanism by which to study viral assemblages without sacrificing a subset of the community&#x2019;s genetic signature. 
Hydroxyapatite, a crystalline form of calcium phosphate, has been employed in the separation of nucleic acids, as well as proteins and microbes, since the 1960s11. By exploiting the charge interaction between the positively-charged Ca2+ ions of the hydroxyapatite and the negatively charged phosphate backbone of the nucleic acid subtypes, it is possible to preferentially elute each nucleic acid subtype independent of the others. We recently employed this strategy to independently fractionate the genomes of ssDNA, dsDNA and RNA-containing viruses in preparation of DNA sequencing 12. Here, we present a method for the fractionation and recovery of ssDNA, dsDNA and RNA viral nucleic acids from mixed viral assemblages using hydroxyapatite chromotography.

We describe an efficient method to separate single-stranded DNA, double-stranded DNA and RNA molecules from environmental viral communities. Nucleic acids are fractionated using hydroxyapatite chromatography with increasing concentrations of phosphate-containing buffers. This method permits the isolation of all viral nucleic acid types from environmental samples.

La separación de una sola hebra de ADN, el ADN de doble cadena y el ARN de una comunidad ambiental viral mediante cromatografía de hidroxiapatita

Viruses, particularly bacteriophages (phages), are the most numerous biological entities on Earth1,2.  Viruses modulate host cell abundance and diversity, ...

Introducing Shear Stress in the Study of Bacterial Adhesion

During bacterial infections a sequence of interactions occur between the pathogen and its host. Bacterial adhesion to the host cell surface is often the initial and determining step of the pathogenesis. Although experimentally adhesion is mostly studied in static conditions adhesion actually takes place in the presence of flowing liquid. First encounters between bacteria and their host often occur at the mucosal level, mouth, lung, gut, eye, etc. where mucus flows along the surface of epithelial cells. Later in infection, pathogens occasionally access the blood circulation causing life-threatening illnesses such as septicemia, sepsis and meningitis. A defining feature of these infections is the ability of these pathogens to interact with endothelial cells in presence of circulating blood. The presence of flowing liquid, mucus or blood for instance, determines adhesion because it generates a mechanical force on the pathogen. To characterize the effect of flowing liquid one usually refers to the notion of shear stress, which is the tangential force exerted per unit area by a fluid moving near a stationary wall, expressed in dynes/cm2. Intensities of shear stress vary widely according to the different vessels type, size, organ, location etc. (0-100 dynes/cm2). Circulation in capillaries can reach very low shear stress values and even temporarily stop during periods ranging between a few seconds to several minutes 1. On the other end of the spectrum shear stress in arterioles can reach 100 dynes/cm2 2. The impact of shear stress on different biological processes has been clearly demonstrated as for instance during the interaction of leukocytes with the endothelium 3. To take into account this mechanical parameter in the process of bacterial adhesion we took advantage of an experimental procedure based on the use of a disposable flow chamber 4. Host cells are grown in the flow chamber and fluorescent bacteria are introduced in the flow controlled by a syringe pump. We initially focused our investigations on the bacterial pathogen Neisseria meningitidis, a Gram-negative bacterium responsible for septicemia and meningitis. The procedure described here allowed us to study the impact of shear stress on the ability of the bacteria to: adhere to cells 1, to proliferate on the cell surface 5and to detach to colonize new sites 6 (Figure 1). Complementary technical information can be found in reference 7. Shear stress values presented here were chosen based on our previous experience1 and to represent values found in the literature. The protocol should be applicable to a wide range of pathogens with specific adjustments depending on the objectives of the study.

During the infection process, a key step is the adhesion of pathogens with host cells. In most instances this adhesion step occurs in the presence of mechanical stress generated by flowing liquid. We describe a technique that introduces shear stress as an important parameter in the study of bacterial adhesion.

La introducción de la tensión de cizallamiento en el Estudio de la adhesión bacteriana

During bacterial infections a sequence of interactions occur between the pathogen and its host. Bacterial adhesion to the host cell surface is often the ...

Isolation and Genome Analysis of Single Virions using 'Single Virus Genomics'

Whole genome amplification and sequencing of single microbial cells enables genomic characterization without the need of cultivation 1-3. Viruses, which are ubiquitous and the most numerous entities on our planet 4 and important in all environments 5, have yet to be revealed via similar approaches. Here we describe an approach for isolating and characterizing the genomes of single virions called 'Single Virus Genomics' (SVG). SVG utilizes flow cytometry to isolate individual viruses and whole genome amplification to obtain high molecular weight genomic DNA (gDNA) that can be used in subsequent sequencing reactions.

Isolation and Genome Analysis of Single Virions using &#039;Single Virus Genomics&#039;

Single Virus Genomics (SVG) is a method to isolate and amplify the genomes of single virons. Viral suspensions of a mixed assemblage are sorted using flow cytometry onto a microscope slide with discrete wells containing agarose, thereby capturing the virion and reducing genome shearing during downstream processing. Whole genome amplification is achieved using multiple displacement amplification (MDA) resulting in genomic material that is suitable for sequencing.

Aislamiento y Análisis del Genoma de viriones individuales utilizando &quot;Genómica solo virus &#39;

Whole genome amplification and sequencing of single microbial cells enables genomic characterization without the need of cultivation 1-3. Viruses, which ...

Establishing a Liquid-covered Culture of Polarized Human Airway Epithelial Calu-3 Cells to Study Host Cell Response to Respiratory Pathogens In vitro

The apical and basolateral surfaces of airway epithelial cells demonstrate directional responses to pathogen exposure in vivo. Thus, ideal in vitro models for examining cellular responses to respiratory pathogens polarize, forming apical and basolateral surfaces. One such model is differentiated normal human bronchial epithelial cells (NHBE). However, this system requires lung tissue samples, expertise isolating and culturing epithelial cells from tissue, and time to generate an air-liquid interface culture.
Calu-3 cells, derived from a human bronchial adenocarcinoma, are an alternative model for examining the response of proximal airway epithelial cells to respiratory insult1, pharmacological compounds2-6, and bacterial7-9 and viral pathogens, including influenza virus, rhinovirus and severe acute respiratory syndrome - associated coronavirus10-14. Recently, we demonstrated that Calu-3 cells are susceptible to respiratory syncytial virus (RSV) infection in a manner consistent with NHBE15,16 . Here, we detail the establishment of a polarized, liquid-covered culture (LCC) of Calu-3 cells, focusing on the technical details of growing and culturing Calu-3 cells, maintaining cells that have been cultured into LCC, and we present the method for performing respiratory virus infection of polarized Calu-3 cells.
To consistently obtain polarized Calu-3 LCC, Calu-3 cells must be carefully subcultured before culturing in Transwell inserts. Calu-3 monolayer cultures should remain below 90% confluence, should be subcultured fewer than 10 times from frozen stock, and should regularly be supplied with fresh medium. Once cultured in Transwells, Calu-3 LCC must be handled with care. Irregular media changes and mechanical or physical disruption of the cell layers or plates negatively impact polarization for several hours or days. Polarization is monitored by evaluating trans-epithelial electrical resistance (TEER) and is verified by evaluating the passive equilibration of sodium fluorescein between the apical and basolateral compartments17,18 . Once TEER plateaus at or above 1,000 &Omega;&times;cm2, Calu-3 LCC are ready to use to examine cellular responses to respiratory pathogens.

Establishing a Liquid-covered Culture of Polarized Human Airway Epithelial Calu-3 Cells to Study Host Cell Response to Respiratory Pathogens In vitro

The findings and conclusions in this report are those of the authors and do not necessarily represent the views of the Centers for Disease Control and Prevention.

El establecimiento de un cultivo líquido cubierto de las vías respiratorias humanas epiteliales polarizadas Calu-3 células para estudiar la respuesta del huésped celular a patógenos respiratorios<em&gt; In vitro</em

The  apical and basolateral surfaces of airway epithelial cells demonstrate  directional responses to pathogen exposure in  vivo. Thus, ideal in vitro ...

Following in Real Time the Impact of Pneumococcal Virulence Factors in an Acute Mouse Pneumonia Model Using Bioluminescent Bacteria

Pneumonia is one of the major health care problems in developing and industrialized countries and is associated with considerable morbidity and mortality. Despite advances in knowledge of this illness, the availability of intensive care units (ICU), and the use of potent antimicrobial agents and effective vaccines, the mortality rates remain high1. Streptococcus pneumoniae is the leading pathogen of community-acquired pneumonia (CAP) and one of the most common causes of bacteremia in humans. This pathogen is equipped with an armamentarium of surface-exposed adhesins and virulence factors contributing to pneumonia and invasive pneumococcal disease (IPD). The assessment of the in vivo role of bacterial fitness or virulence factors is of utmost importance to unravel S. pneumoniae pathogenicity mechanisms. Murine models of pneumonia, bacteremia, and meningitis are being used to determine the impact of pneumococcal factors at different stages of the infection. Here we describe a protocol to monitor in real-time pneumococcal dissemination in mice after intranasal or intraperitoneal infections with bioluminescent bacteria. The results show the multiplication and dissemination of pneumococci in the lower respiratory tract and blood, which can be visualized and evaluated using an imaging system and the accompanying analysis software.

Streptococcus pneumoniae is the leading pathogen causing severe community-acquired pneumonia and responsible for over 2&#160;million deaths worldwide. The impact of bacterial factors implicated in fitness or virulence can be monitored in real-time in an acute mouse pneumonia or bacteremia model using bioluminescent bacteria.

Siguiendo en tiempo real el impacto de factores de virulencia neumocócica en un ratón de neumonía aguda modelo utilizando bacterias bioluminiscentes

Pneumonia is one of the major health care problems in developing and industrialized countries and is associated with considerable morbidity and mortality. ...

High-throughput Screening for Broad-spectrum Chemical Inhibitors of RNA Viruses

RNA viruses are responsible for major human diseases such as flu, bronchitis, dengue, Hepatitis C or measles. They also represent an emerging threat because of increased worldwide exchanges and human populations penetrating more and more natural ecosystems. A good example of such an emerging situation is chikungunya virus epidemics of 2005-2006 in the Indian Ocean. Recent progresses in our understanding of cellular pathways controlling viral replication suggest that compounds targeting host cell functions, rather than the virus itself, could inhibit a large panel of RNA viruses. Some broad-spectrum antiviral compounds have been identified with host target-oriented assays. However, measuring the inhibition of viral replication in cell cultures using reduction of cytopathic effects as a readout still represents a paramount screening strategy. Such functional screens have been greatly improved by the development of recombinant viruses expressing reporter enzymes capable of bioluminescence such as luciferase. In the present report, we detail a high-throughput screening pipeline, which combines recombinant measles and chikungunya viruses with cellular viability assays, to identify compounds with a broad-spectrum antiviral profile.

In vitro assays to measure virus replication have been greatly improved by the development of recombinant RNA viruses expressing luciferase or other enzymes capable of bioluminescence. Here we detail a high-throughput screening pipeline that combines such recombinant strains of measles and chikungunya viruses to isolate broad-spectrum antivirals from chemical libraries.

Screening de alto rendimiento para los de amplio espectro químico Inhibidores de Virus ARN

RNA viruses are responsible for major human diseases such as flu, bronchitis, dengue, Hepatitis C or measles. They also represent an emerging threat ...

Detecting Glycogen in Peripheral Blood Mononuclear Cells with Periodic Acid Schiff Staining

Periodic acid Schiff (PAS) staining is an immunohistochemical technique used on muscle biopsies and as a diagnostic tool for blood samples. Polysaccharides such as glycogen, glycoproteins, and glycolipids stain bright magenta making it easy to enumerate positive and negative cells within the tissue. In muscle cells PAS staining is used to determine the glycogen content in different types of muscle cells, while in blood cell samples PAS staining has been explored as a diagnostic tool for a variety of conditions. Blood contains a proportion of white blood cells that belong to the immune system. The notion that cells of the immune system possess glycogen and use it as an energy source has not been widely explored. Here, we describe an adapted version of the PAS staining protocol that can be applied on peripheral blood mononuclear immune cells from human venous blood. Small cells with PAS-positive granules and larger cells with diffuse PAS staining were observed. Treatment of samples with amylase abrogates these patterns confirming the specificity of the stain. An alternate technique based on enzymatic digestion confirmed the presence and amount of glycogen in the samples. This protocol is useful for hematologists or immunologists studying polysaccharide content in blood-derived lymphocytes.

Periodic acid Schiff staining is a technique that visualizes the polysaccharide content of tissues. This article demonstrates periodic acid Schiff staining protocol adapted for use on peripheral blood mononuclear cells purified from human venous blood. Such samples are enriched for lymphocytes and other white blood cells of the immune system.

La detección de glucógeno en las células mononucleares de sangre periférica con ácido periódico de Schiff tinción

Periodic acid Schiff (PAS) staining is an immunohistochemical technique used on muscle biopsies and as a diagnostic tool for blood samples. ...

Electroporation of Functional Bacterial Effectors into Mammalian Cells

The study of protein interactions in the context of living cells can generate critical information about localization, dynamics, and interacting partners. This information is particularly valuable in the context of host-pathogen interactions. Many pathogen proteins function within host cells in a variety of way such as, enabling evasion of the host immune system and survival within the intracellular environment. To study these pathogen-protein host-cell interactions, several approaches are commonly used, including: in vivo infection with a strain expressing a tagged or mutant protein, or introduction of pathogen genes via transfection or transduction. Each of these approaches has advantages and disadvantages. We sought a means to directly introduce exogenous proteins into cells. Electroporation is commonly used to introduce nucleic acids into cells, but has been more rarely applied to proteins although the biophysical basis is exactly the same. A standard electroporator was used to introduce affinity-tagged bacterial effectors into mammalian cells. Human epithelial and mouse macrophage cells were cultured by traditional methods, detached, and placed in 0.4 cm gap electroporation cuvettes with an exogenous bacterial pathogen protein of interest (e.g. Salmonella Typhimurium GtgE). After electroporation (0.3 kV) and a short (4 hr) recovery period, intracellular protein was verified by fluorescently labeling the protein via its affinity tag and examining spatial and temporal distribution by confocal microscopy. The electroporated protein was also shown to be functional inside the cell and capable of correct subcellular trafficking and protein-protein interaction. While the exogenous proteins tended to accumulate on the surface of the cells, the electroporated samples had large increases in intracellular effector concentration relative to incubation alone. The protocol is simple and fast enough to be done in a parallel fashion, allowing for high-throughput characterization of pathogen proteins in host cells including subcellular targeting and function of virulence proteins.

Electroporation was used to insert purified bacterial virulence effector proteins directly into living eukaryotic cells. Protein localization was monitored by confocal immunofluorescence microscopy. This method allows for studies on trafficking, function, and protein-protein interactions using active exogenous proteins, avoiding the need for heterologous expression in eukaryotic cells.

La electroporación de efectores bacterianos funcionales en células de mamífero

The study of protein interactions in the context of living cells can generate critical information about localization, dynamics, and interacting partners. ...

Intranasal Administration of Recombinant Influenza Vaccines in Chimeric Mouse Models to Study Mucosal Immunity

Vaccines are one of the greatest achievements of mankind, and have saved millions of lives over the last century. Paradoxically, little is known about the physiological mechanisms that mediate immune responses to vaccines perhaps due to the overall success of vaccination, which has reduced interest into the molecular and physiological mechanisms of vaccine immunity. However, several important human pathogens including influenza virus still pose a challenge for vaccination, and may benefit from immune-based strategies. 
Although influenza reverse genetics has been successfully applied to the generation of live-attenuated influenza vaccines (LAIVs), the addition of molecular tools in vaccine preparations such as tracer components to follow up the kinetics of vaccination in vivo, has not been addressed. In addition, the recent generation of mouse models that allow specific depletion of leukocytes during kinetic studies has opened a window of opportunity to understand the basic immune mechanisms underlying vaccine-elicited protection. Here, we describe how the combination of reverse genetics and chimeric mouse models may help to provide new insights into how vaccines work at physiological and molecular levels, using as example a recombinant, cold-adapted, live-attenuated influenza vaccine (LAIV). We utilized laboratory-generated LAIVs harboring cell tracers as well as competitive bone marrow chimeras (BMCs) to determine the early kinetics of vaccine immunity and the main physiological mechanisms responsible for the initiation of vaccine-specific adaptive immunity. In addition, we show how this technique may facilitate gene function studies in single animals during immune responses to vaccines. We propose that this technique can be applied to improve current prophylactic strategies against pathogens for which urgent medical countermeasures are needed, for example influenza, HIV, Plasmodium, and hemorrhagic fever viruses such as Ebola virus.

There is an overall lack of knowledge about how vaccines work. Here we propose the combined use of reverse genetics and bone marrow chimeric mice to gain insight into the early host immune responses to vaccines with a special focus on dendritic cells and T cell immunity.

Administración intranasal de vacunas contra la influenza recombinante en modelos de ratón quimérico para el Estudio de la mucosa Inmunidad

Vaccines are one of the greatest achievements of mankind, and have saved millions of lives over the last century. Paradoxically, little is known about the ...