Name: three-dimensional, serum-free culture system for lacrimal gland stem cells
Uploaded: 2022-06-02T13:00:00
Description: Watch this Scientific Journal Video about Three-Dimensional, Serum-Free Culture System for Lacrimal Gland Stem Cells at JoVE.com

This work was supported by a grant from the National Natural Science Foundation of China (No. 31871413) and two Programs of Guangdong Science and Technology (2017B020230002 and 2016B030231001). We are truly grateful to the researchers who have helped us during the study and to the staff members working in the animal center for their support in animal care.

All the experiments in this protocol followed the animal care guidelines of the Ethical Committee on Animal Trial of Sun Yat-sen University. All cell-related operations are to be performed on the ultraclean workbench in the cell operation room. All operations using xylene are to be carried out in fume hoods.
1. LGSC primary culture
<ol>
	<li>LG isolation
	<ol>
		<li>Obtain a 6-8-week-old BALB/c male mouse, and cut the skin behind the ear to expose the LG and the connective t...

<ol>
	<li>Zoukhri, D., Macari, E., Kublin, C. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+single+injection+of+interleukin-1+induces+reversible+aqueous+tear+deficiency,+lacrimal+gland+inflammation,+and+acinar+and+ductal+cell+proliferation.">A single injection of interleukin-1 induces reversible aqueous tear deficiency, lacrimal gland inflammation, and acinar and ductal cell proliferation.</a> Experimental Eye Research. 84 (5), 894-904 (2007).</li><li>Gromova, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Lacrimal+gland+repair+using+progenitor+cells.">Lacrimal gland repair using progenitor cells.</a> Stem Cells Translational Medicine. 6 (1), 88-98 (2016).</li><li>Buzhor, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cell-based+therapy+approaches:+the+hope+for+incurable+diseases.">Cell-based therapy approaches: the hope for incurable diseases.</a> Regenerative Medicine. 9 (5), 649-672 (2014).</li><li>Tiwari, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Establishing+human+lacrimal+gland+cultures+with+secretory+function.">Establishing human lacrimal gland cultures with secretory function.</a> PLoS One. 7 (1), 29458 (2012).</li><li>You, S., Kublin, C. L., Avidan, O., Miyasaki, D., Zoukhri, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Isolation+and+propagation+of+mesenchymal+stem+cells+from+the+lacrimal+gland.">Isolation and propagation of mesenchymal stem cells from the lacrimal gland.</a> Investigative Ophthalmology &amp; Visual Science. 52 (5), 2087-2094 (2011).</li><li>Ackermann, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Isolation+and+investigation+of+presumptive+murine+lacrimal+gland+stem+cells.">Isolation and investigation of presumptive murine lacrimal gland stem cells.</a> Investigative Ophthalmology &amp; Visual Science. 56 (8), 4350-4363 (2015).</li><li>Sato, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Single+Lgr5+stem+cells+build+crypt-villus+structures+in+vitro+without+a+mesenchymal+niche.">Single Lgr5 stem cells build crypt-villus structures in vitro without a mesenchymal niche.</a> Nature. 459 (7244), 262-265 (2009).</li><li>Lugli, N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=R-spondin+1+and+noggin+facilitate+expansion+of+resident+stem+cells+from+non-damaged+gallbladders.">R-spondin 1 and noggin facilitate expansion of resident stem cells from non-damaged gallbladders.</a> EMBO Reports. 17 (5), 769-779 (2016).</li><li>Huch, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Long-term+culture+of+genome-stable+bipotent+stem+cells+from+adult+human+liver.">Long-term culture of genome-stable bipotent stem cells from adult human liver.</a> Cell. 160 (1), 299-312 (2015).</li><li>Boj, S. F., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Organoid+models+of+human+and+mouse+ductal+pancreatic+cancer.">Organoid models of human and mouse ductal pancreatic cancer.</a> Cell. 160 (1), 324-338 (2015).</li><li>Barker, N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Lgr5+(ve)+stem+cells+drive+self-renewal+in+the+stomach+and+build+long-lived+gastric+units+in+vitro.">Lgr5+(ve) stem cells drive self-renewal in the stomach and build long-lived gastric units in vitro.</a> Cell Stem Cell. 6 (1), 25-36 (2010).</li><li>Linnemann, J. R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Quantification+of+regenerative+potential+in+primary+human+mammary+epithelial+cells.">Quantification of regenerative potential in primary human mammary epithelial cells.</a> Development. 142 (18), 3239-3251 (2015).</li><li>Rock, J. R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Basal+cells+as+stem+cells+of+the+mouse+trachea+and+human+airway+epithelium.">Basal cells as stem cells of the mouse trachea and human airway epithelium.</a> Proceedings of the National Academy of Sciences of the United States of America. 106 (31), 12771-12775 (2009).</li><li>Chua, C. W., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Single+luminal+epithelial+progenitors+can+generate+prostate+organoids+in+culture.">Single luminal epithelial progenitors can generate prostate organoids in culture.</a> Nature Cell Biology. 16 (1), 951-961 (2014).</li><li>Maimets, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Long-term+in+vitro+expansion+of+salivary+gland+stem+cells+driven+by+Wnt+signals.">Long-term in vitro expansion of salivary gland stem cells driven by Wnt signals.</a> Stem Cell Reports. 6 (1), 150-162 (2016).</li><li>Xiao, S., Zhang, Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Establishment+of+long-term+serum-free+culture+for+lacrimal+gland+stem+cells+aiming+at+lacrimal+gland+repair.">Establishment of long-term serum-free culture for lacrimal gland stem cells aiming at lacrimal gland repair.</a> Stem Cell Research &amp; Therapy. 11 (1), 20 (2020).</li><li>Shatos, M. A., Haugaard-Kedstrom, L., Hodges, R. R., Dartt, D. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Isolation+and+characterization+of+progenitor+cells+in+uninjured,+adult+rat+lacrimal+gland.">Isolation and characterization of progenitor cells in uninjured, adult rat lacrimal gland.</a> Investigative Ophthalmology &amp; Visual Science. 53 (6), 2749-2759 (2012).</li><li>Mishima, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transplantation+of+side+population+cells+restores+the+function+of+damaged+exocrine+glands+through+clusterin.">Transplantation of side population cells restores the function of damaged exocrine glands through clusterin.</a> Stem Cells. 30 (9), 1925-1937 (2012).</li><li>Aluri, H. S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Delivery+of+bone+marrow-derived+mesenchymal+stem+cells+improves+tear+production+in+a+mouse+model+of+sj&#246;gren's+syndrome.">Delivery of bone marrow-derived mesenchymal stem cells improves tear production in a mouse model of sj&#246;gren's syndrome.</a> Stem Cells International. 2017, 1-10 (2017).</li><li>Dietrich, J., Schrader, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Towards+lacrimal+gland+regeneration:+current+concepts+and+experimental+approaches.">Towards lacrimal gland regeneration: current concepts and experimental approaches.</a> Current Eye Research. 45 (3), 230-240 (2020).</li><li>Sato, T., Clevers, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=SnapShot:+growing+organoids+from+stem+cells.">SnapShot: growing organoids from stem cells.</a> Cell. 161 (7), 1700 (2015).</li><li>Kleinman, H. K., Martin, G. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Matrigel:+basement+membrane+matrix+with+biological+activity.">Matrigel: basement membrane matrix with biological activity.</a> Seminars in Cancer Biology. 15 (5), 378-386 (2005).</li><li>Arnaoutova, I., George, J., Kleinman, H. K., Benton, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Basement+membrane+matrix+(BME)+has+multiple+uses+with+stem+cells.">Basement membrane matrix (BME) has multiple uses with stem cells.</a> Stem Cell Reviews and Reports. 8 (1), 163-169 (2012).</li></ol>

There are well-established methods for the isolation and in vitro culture of lacrimal stem cells for lacrimal stem cell culture and LG injury repair. Shatos et al.17 and Ackermannet al.6 successfully cultured and subcultured lacrimal stem cells of rats and mice by 2D culture methods, respectively, making it possible to transplant lacrimal stem cells for the treatment of ADDED. Studies on stem cells18 and mesenchymal stem cells<sup c...

Lacrimal gland stem cells (LGSCs) maintain lacrimal gland (LG) cell renewal and are the source of acinar and ductal cells. Therefore, LGSC transplantation is considered an alternative approach for treating severe inflammatory damage and aqueous-deficient dry eye disease (ADDED)1,2,3. Several culture methods have been applied to enrich LGSCs. Tiwari et al. separated and cultured primary LG cells using collagen I and matrix gel supplemented with several growth factors; however, the LG cells could not be continuously cultured4. Using two-dimensional (2D) culture, mouse LG-derived stem cells were isolated by You et al.5 and Ackermann et al.6, found to express the stem/progenitor cell marker genes, Oct4, Sox2, Nanog, and nestin, and could be subcultured. However, there is no clear indication that these cells can differentiate into acinar or ductal cells, and there is no transplantation experiment to verify the differentiation potential in vivo.
Recently, c-kit+ dim/EpCAM+/Sca1-/CD34-/CD45- cells were isolated from mouse LGs by flow cytometry, found to express LG progenitor cell markers, such as Pax6 and Runx1, and differentiated into ducts and acini in vitro. In mice with ADDED, orthotopic injection with these cells could repair damaged LGs and restore the secretory function of LGs2. However, the number of stem cells isolated by this method was small, and there are no suitable culture conditions for expanding the isolated LGSCs. In summary, an appropriate culture system needs to be established to effectively isolate and culture adult LGSCs with stable and continuous expansion for the study of LGSCs in the treatment of ADDED.
Organoids derived from stem cells or pluripotent stem cells are a group of cells that are histologically similar to the related organs and can maintain their own renewal. After the mouse intestine organoid was successfully cultured by Sato et al. in 20097, organoids from other organs were cultured in succession, based on Sato&#39;s culture system, such as gallbladder8, liver9, pancreas10, stomach11, breast12, lung13, prostate14, and salivary gland15. Due to the high proportion of adult stem cells before cell differentiation in organoid culture, the three-dimensional (3D) organoid culture method is considered optimal for the isolation and culture of adult stem cells of LG.
An adult mouse LGSC culture system was established in the present study by optimizing the 3D, serum-free culture method. It is proven that the LGSCs cultured from both normal and ADDED mice showed a stable capacity of self-renewal and proliferation. After transplantation into the ADDED mouse LGs, LGSCs colonized the impaired LGs and improved tear production. In addition, red fluorescent LGSCs were isolated from ROSA26mT/mG mice and cultured. This work provides a reliable reference for LGSC enrichment in vitro and LGSC autograft in clinical application for ADDED therapy.

<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>Animal(Mouse)</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Bal B/C</td>
			<td>Model Animal Research Center of Nanjing University</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>C57 BL/6J</td>
			<td>Laboratory Animal Center of Sun Yat-sen University</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>NOD/ShiLtJ</td>
			<td>Model Animal Research Center of Nanjing University</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>ROSA26mT/mG</td>
			<td>Model Animal Research Center of Nanjing University</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Equipment</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Analytical balance</td>
			<td>Sartorius</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Automatic dehydrator</td>
			<td>Thermo</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Blood counting chamber</td>
			<td>BLAU</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Cell Counter</td>
			<td>CountStar</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>CO2 constant temperature incubator</td>
			<td>Thermo</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>ECL Gel imaging system</td>
			<td>GE healthcare</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Electric bath for water bath</td>
			<td>Yiheng Technology</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Electrophoresis apparatus</td>
			<td>BioRad</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Fluorescence quantitative PCR instrument</td>
			<td>Roche</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Frozen tissue slicer</td>
			<td>Lecia</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Horizontal centrifuge</td>
			<td>CENCE</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Inverted fluorescence microscope</td>
			<td>Nikon</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Inverted microscope</td>
			<td>Olympus</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Laser lamellar scanning micrograph</td>
			<td>Carl Zeiss</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Liquid nitrogen container</td>
			<td>Thermo</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Low temperature high speed centrifuge</td>
			<td>Eppendorf</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Micropipettor</td>
			<td>Gilson</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Microwave oven</td>
			<td>Panasonic</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Nanodrop ultraviolet spectrophotometer</td>
			<td>Thermo</td>
			<td>measure RNA concentration</td>
			<td></td>
		</tr>
		<tr>
			<td>Paraffin slicing machine</td>
			<td>Thermo</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>PCR Amplifier</td>
			<td>Eppendorf</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>pH value tester</td>
			<td>Sartorius</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>4 &#176;C Refrigerator</td>
			<td>Haier</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Thermostatic culture oscillator</td>
			<td>ZHICHENG</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Tissue paraffin embedding instrument</td>
			<td>Thermo</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>&#160;-80&#176;C Ultra-low temperature refrigerator</td>
			<td>Thermo</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>&#160;-20&#176;C Ultra-low temperature refrigerator</td>
			<td>Thermo</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Ultra pure water purification system</td>
			<td>ELGA</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Reagent</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Animal Experiment</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>HCG</td>
			<td>Sigma</td>
			<td>9002-61-3</td>
			<td></td>
		</tr>
		<tr>
			<td>PMSG</td>
			<td>Sigma</td>
			<td>14158-65-7</td>
			<td></td>
		</tr>
		<tr>
			<td>Pentobarbital Sodium</td>
			<td>Sigma</td>
			<td>57-33-0</td>
			<td></td>
		</tr>
		<tr>
			<td>Cell Culture</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>B27</td>
			<td>Gibco</td>
			<td>17504044</td>
			<td></td>
		</tr>
		<tr>
			<td>Collagenase I</td>
			<td>Gibco</td>
			<td>17018029</td>
			<td></td>
		</tr>
		<tr>
			<td>Dispase</td>
			<td>BD</td>
			<td>354235</td>
			<td></td>
		</tr>
		<tr>
			<td>DMEM</td>
			<td>Sigma</td>
			<td>D6429</td>
			<td></td>
		</tr>
		<tr>
			<td>DMEM/F12</td>
			<td>Sigma</td>
			<td>D0697</td>
			<td></td>
		</tr>
		<tr>
			<td>DMSO</td>
			<td>Sigma</td>
			<td>67-68-5</td>
			<td></td>
		</tr>
		<tr>
			<td>EDTA</td>
			<td>Sangon Biotech</td>
			<td>A500895</td>
			<td></td>
		</tr>
		<tr>
			<td>Foetal Bovine Serum</td>
			<td>Gibco</td>
			<td>04-001-1ACS</td>
			<td></td>
		</tr>
		<tr>
			<td>GlutaMax</td>
			<td>Gibco</td>
			<td>35050087</td>
			<td></td>
		</tr>
		<tr>
			<td>Human FGF10</td>
			<td>PeproTech</td>
			<td>100-26</td>
			<td></td>
		</tr>
		<tr>
			<td>Matrigel (Matrix gel)</td>
			<td>BD</td>
			<td>356231</td>
			<td></td>
		</tr>
		<tr>
			<td>Murine Noggin</td>
			<td>PeproTech</td>
			<td>250-38</td>
			<td></td>
		</tr>
		<tr>
			<td>Murine Wnt3A</td>
			<td>PeproTech</td>
			<td>315-20</td>
			<td></td>
		</tr>
		<tr>
			<td>Murine EGF</td>
			<td>PeproTech</td>
			<td>315-09</td>
			<td></td>
		</tr>
		<tr>
			<td>NEAA</td>
			<td>Gibco</td>
			<td>11140050</td>
			<td></td>
		</tr>
		<tr>
			<td>N2</td>
			<td>Gibco</td>
			<td>17502048</td>
			<td></td>
		</tr>
		<tr>
			<td>R-spondin 1</td>
			<td>PeproTech</td>
			<td>120-38</td>
			<td></td>
		</tr>
		<tr>
			<td>Trypsin Inhibitor (TI)</td>
			<td>Sigma</td>
			<td>T6522</td>
			<td>Derived from Glycine max; can inhibit trypsin, chymotrypsin, and plasminase to a lesser extent. One mg will inhibit 1.0-3.0 mg of trypsin.</td>
		</tr>
		<tr>
			<td>Trypsin</td>
			<td>Sigma</td>
			<td>&#160;T4799</td>
			<td></td>
		</tr>
		<tr>
			<td>Y-27632</td>
			<td>Selleck</td>
			<td>S1049</td>
			<td></td>
		</tr>
		<tr>
			<td>HE staining &#38; Immunostaining</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Alexa Fluor 488 donkey anti-Mouse IgG</td>
			<td>Thermo</td>
			<td>A-21202</td>
			<td>Used dilution: IHC) 2 &#956;g/mL, (IF) 0.2 &#956;g/mL</td>
		</tr>
		<tr>
			<td>Alexa Fluor 488 donkey anti-Rabbit IgG</td>
			<td>Thermo</td>
			<td>A-21206</td>
			<td>Used dilution: (IHC) 2 &#956;g/mL, (IF) 2 &#956;g/mL</td>
		</tr>
		<tr>
			<td>Alexa Fluor 568 donkey anti-Mouse IgG</td>
			<td>Thermo</td>
			<td>A-10037</td>
			<td>Used dilution: (IHC) 2 &#956;g/mL, (IF) 2 &#956;g/mL</td>
		</tr>
		<tr>
			<td>Alexa Fluor 568 donkey anti-Rabbit IgG</td>
			<td>Thermo</td>
			<td>A-10042</td>
			<td>Used dilution: (IHC) 2 &#956;g/mL, (IF) 4 &#956;g/mL</td>
		</tr>
		<tr>
			<td>Anti-AQP5 rabbit antibody</td>
			<td>Abcam</td>
			<td>ab104751</td>
			<td>Used dilution: (IHC) 1 &#956;g/mL, (IF) 0.1 &#956;g/mL</td>
		</tr>
		<tr>
			<td>Anti-E-cadherin Rat antibody</td>
			<td>Abcam</td>
			<td>ab11512</td>
			<td>Used dilution: (IF)&#160; 5 &#956;g/mL</td>
		</tr>
		<tr>
			<td>Anti-Keratin14 rabbit antibody</td>
			<td>Abcam</td>
			<td>ab181595</td>
			<td>Used dilution: (IHC) 1 &#956;g/mL, (IF) 2 &#956;g/mL</td>
		</tr>
		<tr>
			<td>Anti-Ki67 rabbit antibody</td>
			<td>Abcam</td>
			<td>ab15580</td>
			<td>Used dilution: (IHC) 1 &#956;g/mL, (IF) 1 &#956;g/mL</td>
		</tr>
		<tr>
			<td>Anti-mCherry mouse antibody</td>
			<td>Abcam</td>
			<td>ab125096</td>
			<td>Used dilution: (IHC) 2 &#956;g/mL, (IF) 2 &#956;g/mL</td>
		</tr>
		<tr>
			<td>Anti-mCherry rabbit antibody</td>
			<td>Abcam</td>
			<td>ab167453</td>
			<td>Used dilution: (IF)&#160; 2 &#956;g/mL</td>
		</tr>
		<tr>
			<td>C6H8O7</td>
			<td>Sangon Biotech</td>
			<td>A501702-0500</td>
			<td></td>
		</tr>
		<tr>
			<td>Citric Acid</td>
			<td>Sangon Biotech</td>
			<td>201-069-1</td>
			<td></td>
		</tr>
		<tr>
			<td>DAB Kit (20x)</td>
			<td>CWBIO</td>
			<td>CW0125</td>
			<td></td>
		</tr>
		<tr>
			<td>DAPI</td>
			<td>Thermo</td>
			<td>62248</td>
			<td></td>
		</tr>
		<tr>
			<td>Eosin</td>
			<td>BASO</td>
			<td>68115</td>
			<td></td>
		</tr>
		<tr>
			<td>Fluorescent Mounting Medium</td>
			<td>Dako</td>
			<td>S3023</td>
			<td></td>
		</tr>
		<tr>
			<td>Formalin</td>
			<td>Sangon Biotech</td>
			<td>A501912-0500</td>
			<td></td>
		</tr>
		<tr>
			<td>Goat anti-Mouse IgG antibody (HRP)</td>
			<td>Abcam</td>
			<td>ab6789</td>
			<td>Used dilution: 2 &#956;g/mL</td>
		</tr>
		<tr>
			<td>Goat anti-Rabbit IgG antibody(HRP)</td>
			<td>Abcam</td>
			<td>ab6721</td>
			<td>Used dilution: 2 &#956;g/mL</td>
		</tr>
		<tr>
			<td>Hematoxylin</td>
			<td>BASO</td>
			<td>517-28-2</td>
			<td></td>
		</tr>
		<tr>
			<td>Histogel (Embedding hydrogel)</td>
			<td>Thermo</td>
			<td>HG-400-012</td>
			<td></td>
		</tr>
		<tr>
			<td>30% H2O2</td>
			<td>Guangzhou Chemistry</td>
			<td>KD10</td>
			<td></td>
		</tr>
		<tr>
			<td>30% Hydrogen Peroxide Solution</td>
			<td>Guangzhou Chemistry</td>
			<td>7722-84-1</td>
			<td></td>
		</tr>
		<tr>
			<td>Methanol</td>
			<td>Guangzhou Chemistry</td>
			<td>67-56-1</td>
			<td></td>
		</tr>
		<tr>
			<td>Na3C6H5O7.2H2O</td>
			<td>Sangon Biotech</td>
			<td>A501293-0500</td>
			<td></td>
		</tr>
		<tr>
			<td>Neutral balsam</td>
			<td>SHANGHAI YIYANG</td>
			<td>YY-Neutral balsam</td>
			<td></td>
		</tr>
		<tr>
			<td>Non-immunized Goat Serum</td>
			<td>BOSTER</td>
			<td>AR0009</td>
			<td></td>
		</tr>
		<tr>
			<td>Paraffin</td>
			<td>Sangon Biotech</td>
			<td>A601891-0500</td>
			<td></td>
		</tr>
		<tr>
			<td>Paraformaldehyde</td>
			<td>DAMAO</td>
			<td>200-001-8</td>
			<td></td>
		</tr>
		<tr>
			<td>Saccharose</td>
			<td>Guangzhou Chemistry</td>
			<td>57-50-1</td>
			<td></td>
		</tr>
		<tr>
			<td>Sodium citrate tribasic dihydrate</td>
			<td>Sangon Biotech</td>
			<td>200-675-3</td>
			<td></td>
		</tr>
		<tr>
			<td>Sucrose</td>
			<td>Guangzhou Chemistry</td>
			<td>IB11-AR-500G</td>
			<td></td>
		</tr>
		<tr>
			<td>Tissue-Tek O.T.C. Compound</td>
			<td>SAKURA</td>
			<td>SAKURA.4583</td>
			<td></td>
		</tr>
		<tr>
			<td>Triton X-100</td>
			<td>DINGGUO</td>
			<td>9002-93-1</td>
			<td></td>
		</tr>
		<tr>
			<td>Xylene</td>
			<td>Guangzhou Chemistry</td>
			<td>128686-03-3</td>
			<td></td>
		</tr>
		<tr>
			<td>RT-PCR &#38; qRT-PCR</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Agarose</td>
			<td>Sigma</td>
			<td>9012-36-6</td>
			<td></td>
		</tr>
		<tr>
			<td>Alcohol</td>
			<td>Guangzhou Chemistry</td>
			<td>64-17-5</td>
			<td></td>
		</tr>
		<tr>
			<td>Chloroform</td>
			<td>Guangzhou Chemistry</td>
			<td>865-49-6</td>
			<td></td>
		</tr>
		<tr>
			<td>Ethidium Bromide</td>
			<td>Sangon Biotech</td>
			<td>214-984-6</td>
			<td></td>
		</tr>
		<tr>
			<td>Isopropyl Alcohol</td>
			<td>Guangzhou Chemistry</td>
			<td>67-63-0</td>
			<td></td>
		</tr>
		<tr>
			<td>LightCycler 480 SYBR Green I Master Mix</td>
			<td>Roche</td>
			<td>488735200H</td>
			<td></td>
		</tr>
		<tr>
			<td>ReverTra Ace qPCR RT Master Mix</td>
			<td>TOYOBO</td>
			<td>-</td>
			<td></td>
		</tr>
		<tr>
			<td>Taq DNA Polymerase</td>
			<td>TAKARA</td>
			<td>R10T1</td>
			<td></td>
		</tr>
		<tr>
			<td>Goldview (nucleic acid stain)</td>
			<td>BioSharp</td>
			<td>BS357A</td>
			<td></td>
		</tr>
		<tr>
			<td>TRIzol</td>
			<td>Magen</td>
			<td>R4801-02</td>
			<td></td>
		</tr>
		<tr>
			<td>Vector Construction &#38; Cell Transfection</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Agar</td>
			<td>OXID</td>
			<td>-</td>
			<td></td>
		</tr>
		<tr>
			<td>Ampicillin</td>
			<td>Sigma</td>
			<td>69-52-3</td>
			<td></td>
		</tr>
		<tr>
			<td>Chloramphenicol</td>
			<td>Sigma</td>
			<td>56-75-7</td>
			<td></td>
		</tr>
		<tr>
			<td>Endotoxin-free Plasmid Extraction Kit</td>
			<td>Thermo</td>
			<td>A36227</td>
			<td></td>
		</tr>
		<tr>
			<td>Kanamycin</td>
			<td>Sigma</td>
			<td>25389-94-0</td>
			<td></td>
		</tr>
		<tr>
			<td>Lipo3000 Plasmid Transfection Kit</td>
			<td>Thermo</td>
			<td>L3000015</td>
			<td></td>
		</tr>
		<tr>
			<td>LR Reaction Kit</td>
			<td>Thermo</td>
			<td>11791019</td>
			<td></td>
		</tr>
		<tr>
			<td>Plasmid Extraction Kit</td>
			<td>TIANGEN</td>
			<td>DP103</td>
			<td></td>
		</tr>
		<tr>
			<td>Trans5&#945; Chemically Competent Cell</td>
			<td>TRANSGEN</td>
			<td>CD201-01</td>
			<td></td>
		</tr>
		<tr>
			<td>Trytone</td>
			<td>OXID</td>
			<td>-</td>
			<td></td>
		</tr>
		<tr>
			<td>Yeast Extract</td>
			<td>OXID</td>
			<td>-</td>
			<td></td>
		</tr>
		<tr>
			<td>Primers and Sequence</td>
			<td>Company</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Primer: AQP5 
			Sequence: 
			F: CATGAACCCAGCCCGATCTT 
			R: CTTCTGCTCCCATCCCATCC</td>
			<td>Synbio Tech</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Primer: &#946;-actin 
			Sequence: 
			F: AGATCAAGATCATTGCTCCTCCT 
			R: AGATCAAGATCATTGCTCCTCCT</td>
			<td>Synbio Tech</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Primer: Epcam 
			Sequence: 
			F: CATTTGCTCCAAACTGGCGT 
			R: TGTCCTTGTCGGTTCTTCGG</td>
			<td>Synbio Tech</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Primer: Krt5 
			Sequence: 
			F: AGCAATGGCGTTCTGGAGG 
			R: GCTGAAGGTCAGGTAGAGCC</td>
			<td>Synbio Tech</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Primer: Krt14 
			Sequence: 
			F: CGGACCAAGTTTGAGACGGA 
			R: GCCACCTCCTCGTGGTTC</td>
			<td>Synbio Tech</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Primer: Krt19 
			Sequence: 
			F: TCTTTGAAAAACACTGAACCCTG 
			R: TGGCTCCTCAGGGCAGTAAT</td>
			<td>Synbio Tech</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Primer: Ltf 
			Sequence: 
			F: CACATGCTGTCGTATCCCGA 
			R: CGATGCCCTGATGGACGA</td>
			<td>Synbio Tech</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Primer: Nestin 
			Sequence: 
			F: GGGGCTACAGGAGTGGAAAC 
			R: GACCTCTAGGGTTCCCGTCT</td>
			<td>Synbio Tech</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Primer: P63 
			Sequence: 
			F: TCCTATCACGGGAAGGCAGA 
			R: GTACCATCGCCGTTCTTTGC</td>
			<td>Synbio Tech</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Vector</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>pLX302 lentivirus no-load vector</td>
			<td>Addgene</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>pENRTY-mCherry</td>
			<td>Xiaofeng Qin laboratory, Sun Yat-sen University</td>
			<td></td>
			<td></td>
		</tr>
	</tbody>
</table>

three-dimensional, serum-free culture system for lacrimal gland stem cells

Lacrimal gland (LG) stem cell-based therapy is a promising strategy for lacrimal gland diseases. However, the lack of a reliable, serum-free culture method to obtain a sufficient number of LG stem cells (LGSCs) is one obstacle for further research and application. The three-dimensional (3D), serum-free culture method for adult mouse LGSCs is well established and shown here. The LGSCs could be continuously passaged and induced to differentiate to acinar or ductal-like cells.
For the LGSC primary culture, the LGs from 6-8-week-old mice were digested with dispase, collagenase I, and trypsin-EDTA. A total of 1 &#215; 104 single cells were seeded into 80 &#181;L of matrix gel-lacrimal gland stem cell medium (LGSCM) matrix in each well of a 24-well plate, precoated with 20 &#181;L of matrix gel-LGSCM matrix. The mix was solidified after incubation for 20 min at 37 &#176;C, and 600 &#181;L of LGSCM added.
For LGSC maintenance, LGSCs cultured for 7 days were disaggregated into single cells by dispase and trypsin-EDTA. The single cells were implanted and cultured according to the method used in the LGSC primary culture. LGSCs could be passaged over 40 times and continuously express stem/progenitor cell markers Krt14, Krt5, P63, and nestin. LGSCs cultured in LGSCM have self-renewal capacity and can differentiate into acinar or ductal-like cells in vitro and in vivo.

Establish 3D, serum-free culture system 
In this study, LGSCM containing EGF, Wnt3A, FGF10, and Y-27632 for mouse LGSCs was developed, and LGSCs were successfully isolated and cultured by a 3D culture method (Figure 1A). A successful 3D, serum-free culture system of LGSCs from C57BL/6 mice, NOD/ShiLtJ mice, BALB/c mice, and ROSA26mT/mG mice has been established using this method16. For a male mouse, 1.5-2 &#215; 106 cells we...

Watch this Scientific Journal Video about Three-Dimensional, Serum-Free Culture System for Lacrimal Gland Stem Cells at JoVE.com

Three-Dimensional, Serum-Free Culture System for Lacrimal Gland Stem Cells

The three-dimensional, serum-free culture method for adult lacrimal gland (LG) stem cells is well established for the induction of LG organoid formation and differentiation into acinar or ductal-like cells.

Lacrimal gland (LG) stem cell-based therapy is a promising strategy for lacrimal gland diseases. However, the lack of a reliable, serum-free culture ...

This protocol provides an advantageous strategy for enriching lacrimal gland stem cells for the regeneration and reconstruction of lacrimal gland. Lacrimal gland stem cells show long-term expansion capacity and the potential of differentiation. The main advantage of this technique is that the culture medium for lacrimal gland stem cells is serum-free, which shows the enormous value for lacrimal gland repair Begin by obtaining a euthanized six-to eight-week-old BALB/c male mouse and cutting the skin behind the ear to expose the lacrimal gland and the connective tissue around it.Peel off the connective tissue by blunt dissection with the help of tweezers and remove the lacrimal gland. Immerse the lacrimal glands in a six-centimeter dish with four milliliters of 75%ethanol for 10 seconds and immediately rinse with 10-millimolar PBS solution twice. Cut the lacrimal glands into small fragments of about one millimeter cubed.Transfer them to a sterile 15-milliliter centrifuge tube and treat the tissues with 500 microliters of 25 units per milliliter dispase and 500 microliters of 0.1%collagenase I for one hour at 37 degrees Celsius. Treat the lacrimal gland fragments with one milliliter of 0.05%trypsin EDTA for 10 minutes at 37 degrees Celsius and dissociate the fragments into single cells by pipetting repeatedly. Filter the suspension through a 70-micrometer filter, collect the filter into a sterile 15-milliliter centrifuge tube, and centrifuge at 150 times G for five minutes.After centrifugation, remove the supernatant, add 10 milliliters of 10-millimolar PBS solution to wash the cell pellet, and centrifuge the suspension at 150 times G for five minutes. Repeat the washing of the cell pellet. Then, remove the supernatant and add one milliliter of a 1:1 ratio of Dulbecco's Modified Eagles Medium and Ham's F-12 to resuspend the cell pellets.Add 20 microliters of matrix gel lacrimal gland stem cell medium matrix at the center of the well of a 24-well plate. Use a pipette tip to expand it to a circle of about six-to eight-millimeter diameter and incubate the mixture for 20 minutes at 37 degrees Celsius to pre-coat the well. Use a cell counter to determine the number of cells and add 40 microliters of lacrimal gland stem cell medium, or LGSCM, with a total of 10, 000 cells into 40 microliters of the matrix gel.Mix them gently with a pipette. Use a pipette to carefully drop 80 microliters of the mixture over the pre-coated area in each well of the 24-well plate. Incubate the mixture for 20 minutes at 37 degrees Celsius and add 600 microliters of LGSCM.Change the culture medium in each well once every two days. After seven days of culture, look for LGSC spheres that are 100 to 300 micrometers in diameter under the inverted microscope. Use this protocol to isolate and culture primary lacrimal gland stem cells of Rosa26 and NOD mice.After seven days of culture, remove the culture medium from the sphere culture well. Disaggregate the LGSC spheres by incubation in 20 microliters of 10 units per milliliter dispase and 100 microliters of 10-millimolar PBS for 30 minutes at 37 degrees Celsius. Transfer the suspension to a 15-milliliter centrifuge tube and centrifuge at 150 times G for four minutes.Remove the supernatant. Treat the spheres with one milliliter of 0.05%trypsin EDTA for five minutes at 37 degrees Celsius Add one milliliter of 0.05%trypsin inhibitor and pipette repeatedly to neutralize the trypsin and dissociate the spheres into single cells. Centrifuge at 150 times G for five minutes and remove the supernatant to pellet the LGSCs.Add one milliliter of LGSCM to resuspend the lacrimal gland stem cell pellet and plate the cells as previously demonstrated. If performing procedure one, extend the culture time of the LGSCs from seven to 14 days with the lacrimal gland stem cell culture system for random differentiation. For procedure two, change the ratio of the matrix gel to LGSCM from 1:1 to 1:2 at the beginning of the lacrimal gland stem cells culture for the differentiation of ductal cells.Seed the lacrimal gland stem cells into the matrix for induction for 14 days. For procedure three, after passage, replace the LGSCM with LGSCM 10%FBS for differentiation of acinar cells. Induce differentiation for 14 days.After one week of culture, Kr14 and Ki67 were expressed in all spheres formed by lacrimal gland stem cells. The spheres reached a diameter of 100 micrometers. Hematoxylin and eosin staining showed cellularity at day seven.The enrichment factors of lacrimal gland stem cells obtained after seven days of primary culture and subculture indicated that the cells enriched by this method had a strong proliferative ability. In this system, lacrimal gland stem cells could be passaged over 40 times and still maintain stem cell characteristics. Lacrimal gland stem cells were induced to form more buds by fetal bovine serum and a low proportion of matrix gel.Hematoxylin and eosin staining indicated that fetal bovine serum could induce the spheres to produce more cavitating structures. After orthotopic injection of Rosa lacrimal gland stem cells in NOD mice, new lacrimal lobules were formed adjacent to the lacrimal glands. Most of the lobules were composed of mature acinar cells with high expression of AQP5 and there was intralobular duct formation with low AQP5 expression.The amount of tear secretion on the Rosa lacrimal gland stem cells injection side was higher than on the control side, but lower than in the wild-type mice The matrix gel and its related mixture must always be kept on ice before use and the microcentrifuge tube and tips in contact with matrix gel should be pre-cooled. The system provides an ideal model for further study of lacrimal gland stem cells, lacrimal gland repair, and drug screening for lacrimal gland diseases.

Research

JoVE Journal

Biology

Chip-based Three-dimensional Cell Culture in Perfused Micro-bioreactors

We have developed a chip-based cell culture system for the three-dimensional cultivation of cells. The chip is typically manufactured from ...

Microfabrication of Chip-sized Scaffolds for Three-dimensional Cell cultivation

Using microfabrication technologies is a prerequisite to create scaffolds of reproducible geometry and constant quality for three-dimensional cell ...

Preparation of Pooled Human Platelet Lysate (pHPL) as an Efficient Supplement for Animal Serum-Free Human Stem Cell Cultures

Preparation of Pooled Human Platelet Lysate pHPL as an Efficient Supplement for Animal Serum-Free Human Stem Cell Cultures

Platelet derived growth factors have been shown to stimulate cell proliferation efficiently in vivo1,2 and in vitro. This effect has been reported for ...

Isolation and Animal Serum Free Expansion of Human Umbilical Cord Derived Mesenchymal Stromal Cells (MSCs) and Endothelial Colony Forming Progenitor Cells (ECFCs)

Isolation and Animal Serum Free Expansion of Human Umbilical Cord Derived Mesenchymal Stromal Cells MSCs and Endothelial Colony Forming Progenitor Cells ECFCs

The umbilical cord is a rich source for progenitor cells with high proliferative potential including mesenchymal stromal cells (also termed mesenchymal ...

Isolation of Mouse Salivary Gland Stem Cells

Mature salivary glands of both human and mouse origin comprise a minimum of five cell types, each of which facilitates the production and excretion of ...

Isolation of Mammary Epithelial Cells from Three-dimensional Mixed-cell Spheroid Co-culture

While enormous efforts have gone into identifying signaling pathways and molecules involved in normal and malignant cell behaviors1-2, much of this work ...

Mouse Embryonic Development in a Serum-free Whole Embryo Culture System

Mid-gestation stage mouse embryos were cultured utilizing a serum-free culture medium prepared from commercially available stem cell media supplements in ...

Mouse Fetal Whole Intestine Culture System for Ex Vivo Manipulation of Signaling Pathways and Three-dimensional Live Imaging of Villus Development

Mouse Fetal Whole Intestine Culture System for Ex Vivo Manipulation of Signaling Pathways and Three-dimensional Live Imaging of Villus Development

Most morphogenetic processes in the fetal intestine have been inferred from thin sections of fixed tissues, providing snapshots of changes over ...

Non-enzymatic, Serum-free Tissue Culture of Pre-invasive Breast Lesions for Spontaneous Generation of Mammospheres

Breast ductal carcinoma in situ (DCIS), by definition, is proliferation of neoplastic epithelial cells within the confines of the breast duct, without ...

Manipulating the Murine Lacrimal Gland

The lacrimal gland (LG) secretes aqueous tears necessary for maintaining the structure and function of the cornea, a transparent tissue essential for ...