Serene Samyesudhas and Dr. Lynn Roy assisted in preparing samples for filming.

1. Culture cellulaire et Marquage fluorescent de lignées cellulaires de cancer de l&#39;ovaire <ol><li> Préparer SKOV3 médias: médias McCoy complété avec 10% de sérum de veau fœtal (FBS), 0,1 mM de L-glutamine, 50 U / ml de pénicilline, et 50 pg / ml de streptomycine. Maintenir OVCA429 cellules dans un milieu minimal essentiel (MEM) supplémenté avec 10% de FBS, du pyruvate de sodium 1 mM, 0,1 mM de L-glutamine, 50 U / ml de pénicilline et 50 pg / ml de streptomycine. </li><li> Propager des lignées de cellules SKOV3 et OVCA429 dans un incubateur humidifié à 37 ° C avec 5% de CO 2. Cultiver des cellules à 40-50% de confluence. </li><li> Génération des cellules exprimant la protéine fluorescente rouge (RFP) dans le but de surveiller la viabilité in vitro et in vivo. <ol><li> Pour générer des cellules exprimant RFP SKOV3, ajouter des particules lentiviraux exprimant RFP et 10 ug / ml de polybrène à SKOV3 support en l&#39;absence de pénicilline et de streptomycine pendant 72 heures. </li><li> Après 72 heures, sélectionnez pour DP cellules positives par cellulaire activé par fluorescence Sorting (FACS) comme suit: Trypsiniser DP et non des cellules exprimant RFP, centrifuger à 125 g pendant 5 min, remettre les cellules à 10 7 cellules / ml dans du PBS contenant 0,1% de BSA. Sur un trieur de cellules, en utilisant des cellules non-DP pour déterminer les paramètres de tri. Puis prélever des cellules qui expriment haut DP en utilisant un laser 561 nm. </li><li> Par ailleurs, si le plasmide lentiviral exprime une cassette de résistance aux antibiotiques, sélectionner les cellules de la DP exprimant par culture dans l&#39;antibiotique approprié (par exemple 10 mg / ml blasticidine). REMARQUE: La quantité de particules lentiviraux qui doit être utilisée peut varier en fonction du lot et selon le type de cellule. Lentiviral titre correct doit être déterminée pour chaque type de cellule. </li></ol></li></ol> 2. enrichissement des cellules souches du cancer <ol><li> Traiter SKOV3, SKOV3-DP, ou OVCA429 lignées cellulaires avec 20 uM de cisplatine pendant 72 heures. ATTENTION: Le cisplatine est toxique. Utilisez des gants de protection / des vêtements et éviter tout contact avec peau et des membranes muqueuses. Ne jetez pas de cisplatine in eaux usées. </li><li> Préparer SCC médias: sans sérum milieu DMEM / F12 supplémenté avec 5 pg d&#39;insuline / ml, 10 ng / ml de facteur de croissance épidermique humain recombinant (EGF), 10 ng / base ml de facteur de croissance des fibroblastes (bFGF), 12 ng / ml de facteur inhibiteur de leucémie , et 0,4% d&#39;albumine de sérum bovin (BSA). </li><li> Cellules Trypsiniser. Culture des cellules survivant au SCC médias. NOTE: Après 2 jours de culture sphéroïdes non adhérentes se forment. </li><li> Changer de support tous les 2 jours en recueillant les médias contenant des cellules et centrifugation à 125 g pendant 5 min. Puis remettre le culot dans les médias SCC frais. Vérifiez cellules pour la viabilité tous les 2 jours en comptant les cellules et effectuer exclusion au bleu trypan. </li><li> Puis CCF pour recueillir d&#39;autres expériences par centrifugation 129 x g pendant 5 minutes et remise en suspension du culot dans du phénol contenant du thiocyanate de guanidine (ARN), solution saline tamponnée au phosphate (PBS: NaCl 137 mM, KCl 2,7 mM, et 11,9 mM de tampon phosphate, pH 7,4) avec 0,1% de BSA (pour la cytométrie de flux), ou SCC médias continuentla culture des cellules. </li><li> Surveiller SCC morphologie des cellules à l&#39;aide d&#39;un microscope optique à 20X et 40X grossissement. </li></ol> 3 Caractérisation SCC par l&#39;analyse de l&#39;expression génique de marqueurs de cellules souches <ol><li> Récupérer des trois préparations de CCF en recueillant des milieux contenant des cellules, une centrifugation à 129 g pendant 5 min, et la remise en suspension du culot dans une solution de phénol contenant du thiocyanate de guanidine (d&#39;autres méthodes d&#39;extraction de l&#39;ARN peuvent être utilisés). </li><li> Préparation de l&#39;ARN total en utilisant TRIzol selon le protocole du fabricant. Synthétiser de l&#39;ADN complémentaire (ADNc) de 0,1 à 1 ug d&#39;ARN en utilisant un kit de transcription inverse d&#39;ADNc disponible dans le commerce. </li><li> Effectuer une transcription inverse quantitative réaction en chaîne de la polymérase (QRT-PCR). <ol><li> Maquillage master mix pour chaque ensemble d&#39;amorces contenant mélange QRT-PCR, les amorces, et de l&#39;eau pour un total de 8 pi par échantillon (amorces avec différents fluorophores peuvent être amplifiés dans le même puits). Par exemple, générerun mélange maître pour Oct4-FAM, Nanog-Hex, et GAPDH-CY5. Générer master mix distincts pour Nestin et PROM1. Ajouter 2 ul de matrice d&#39;ADNc par échantillon. NOTE: Pour cette étude, QRT-PCR a été réalisée en utilisant les amorces énumérées dans le tableau 1. </li><li> Effectuer toutes QRT-PCR en double pour chaque échantillon en utilisant un thermocycleur PCR en temps réel capable de détecter de multiples fluorophores. Inclure les contrôles sans matrice. </li><li> Normaliser tige expression génique des cellules à l&#39;expression de GAPDH pour chaque échantillon en utilisant la méthode ΔΔC T. </li></ol></li></ol><table border="0" cellpadding="0" cellspacing="0" width="746"><colgroup><col /><col /></colgroup><tbody><tr height="21"><td height="63" rowspan="3" style="height:62px;width:111px;"> Oct-4-FAM </td><td style="width:636px;"> L&#39;amorce 1: 5&#39;-CCCAAGGAATAGTCTGTAGAAGTG-3 &#39; </td></tr><tr height="21"><td height="21" style="height:21px;"> Amorce 2: 5&#39;-TGCATGAGTCAGTGAACAGG-3 &#39;</td></tr><tr height="21"><td height="21" style="height:21px;"> sonde FAM: 5&#39;-CTTCCAAGC / ZEN / TGCCCACCTAACTTCT / 3IABkFQ -3 &#39; </td></tr><tr height="21"><td height="63" rowspan="3" style="height:62px;"> Nanog-HEX </td><td> L&#39;amorce 1: 5&#39;-CCTTCTGCGTCACACCATT-3 &#39; </td></tr><tr height="21"><td height="21" style="height:21px;"> Amorce 2: 5&#39;-AACTCTCCAACATCCTGAACC-3 &#39; </td></tr><tr height="21"><td height="21" style="height:21px;"> sonde HEX: 5&#39;-CTGCCACCT / ZEN.CTTAGATTTCATTCTCTGGT / 3IABkFQ-3 &#39; </td></tr><tr height="21"><td height="63" rowspan="3" style="height:62px;"> GAPDH-CY5 </td><td> L&#39;amorce 1: 5&#39;-TGTAGTTGAGGTCAATGAAGGG-3 &#39; </td></tr><tr height="21"><td height="21" style="height:21px;"> Amorce 2: 5&#39;-ACATCGCTCAGACACCATG-3 &#39; </td></tr><tr height="21"><td height="21" style="height:21px;"> sonde CY5: 5&#39;-AAGGTCGGAGTCAACGGATTTGGTC / 3IABRQSP-3 &#39; </td><html></tr><tr height="21"><td height="63" rowspan="3" style="height:62px;"> Nestine-FAM </td><td> L&#39;amorce 1: 5&#39;-AGGACCTGAGCGATCTGG-3 &#39; </td></tr><tr height="21"><td height="21" style="height:21px;"> Amorce 2: 5&#39;-CGTTGGAACAGAGGTTGGAG-3 &#39; </td></tr><tr height="21"><td height="21" style="height:21px;"> sonde FAM: 5&#39;-AACTTTTCA / ZEN / GTAGCCCGCAGCC / 3IABkFQ -3 &#39; </td></tr><tr height="21"><td height="63" rowspan="3" style="height:62px;"> CD133-HEX </td><td> L&#39;amorce 1: 5&#39;-ACTCTCTCCAACAATCCATTCC-3 &#39; </td></tr><tr height="21"><td height="21" style="height:21px;"> Amorce 2: 5&#39;-AAACAATTCACCAGCAACGAG-3 &#39; </td></tr><tr height="21"><td height="21" style="height:21px;"> sonde HEX: 5&#39;-ACAATCACT / ZEN / GAGCACTCTATACCAAAGCG / 3IABkFQ-3 </td></tr></tbody></table> Tableau 1: Amorces utilisées pour le SCC caractérisation par QRT-PCR. e_title &quot;&gt; 4. Des CSC Analyse de surface cellulaire marqueurs CD117 et CD133 <ol><li> CSC récolte en recueillant les médias contenant des cellules et centrifugation à 125 g pendant 5 min. Ajouter 500 ul d&#39;une solution non-protéolytique détachement des cellules de la débâcle des cellules. Centrifuger les cellules à 125 g pendant 5 min pour éliminer la solution de détachement cellulaire. Ensuite, laver les cellules deux fois avec du PBS froid. </li><li> Incuber dans un milieu de croissance normale pendant 1 heure avant de cellules d&#39;étiquetage. Isoler les cellules pendant 5 min à 129 x g. Remettre en suspension les cellules dans du PBS avec 0,1% de BSA avec un anti-CD133-PE et anti-CD117-FITC. </li><li> Fixer les cellules pendant la nuit dans 1% de paraformaldéhyde. Attention: Paraformaldéhyde est toxique (cancérogène suspecté). Faire dans une hotte et d&#39;utiliser moins d&#39;une semaine. </li><li> Effectuer la cytométrie en flux pour analyser le CD117 (avec un anticorps anti-CD117 conjugué à FITC) et CD133 (avec anti-CD133 conjugué à PE) l&#39;expression de surface cellulaire sur un cytomètre de flux. Recueillir des données sur les cellules de la FL1 (pour FITC) et FL3 (PE) pour les canaux. Générer portes pour les cellules exprimant à la foisFITC et PE. Générer un tracé de points avec 4 quadrants (FITC et PE, FITC + PE, PE FITC +, et + FITC et PE +) et de déterminer le nombre de cellules dans chaque quadrant. </li></ol> 5 Analyse CSC pour les interventions thérapeutiques <ol><li> Plaque de 5000 cellules par puits (SKOV3, SKOV3-DP, SKOV3 SCC et SKOV3-DP CCM) sur des plaques à 96 puits pendant la nuit. </li><li> Traiter avec le cisplatine (0, 1, 10, 100 et 1000 pM) ou le paclitaxel (0, 0,01, 0,1, 1, 10 et 100 uM) pendant 96 heures. </li><li> Effectuer MTT (3-(4,5-diméthylthiazol-2-yl) -2,5-diphényltétrazolium) dosage de la viabilité cellulaire. <ol><li> Plate 5.000 cellules par 100 ul par puits sur une plaque de 96 puits (cellules de la plaque en double et comprennent les médias ne contrôlent puits). </li><li> Après 24 h, ajouter 10 ul de 10 mg / ml de MTT. Incuber à 37 ° C pendant 2-4 heures (jusqu&#39;à ce que les formes précipité). </li><li> Ajouter 100 ul de HCl mM MTT solvant 4, 0,1% de NP-40 dans l&#39;isopropanol. Incuber pendant 15 min dans l&#39;obscurité. </li><li> Lire les plaques à 570 nm sur une plaque reader. </li></ol></li></ol>

<ol>
	<li>Pennington, K., Pulaski, H., Pennington, M., Liu, J. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Too+Much+of+a+Good+Thing:+Suicide+Prevention+Promotes+Chemoresistance+in+Ovarian+Carcinoma.">Too Much of a Good Thing: Suicide Prevention Promotes Chemoresistance in Ovarian Carcinoma.</a> Curr Cancer Drug Targets. 10, 575-583 (2010).</li><li>Thigpen, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+rational+approach+to+the+management+of+recurrent+or+persistent+ovarian+carcinoma.">A rational approach to the management of recurrent or persistent ovarian carcinoma.</a> Clin Obstet Gynecol. 55, 114-130 (2012).</li><li>Burgos-Ojeda, D., Rueda, B. R., Buckanovich, R. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Ovarian+cancer+stem+cell+markers:+prognostic+and+therapeutic+implications.">Ovarian cancer stem cell markers: prognostic and therapeutic implications.</a> Cancer letters. 322, 1-7 (2012).</li><li>Ma, L., Lai, D., Liu, T., Cheng, W., Guo, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cancer+stem-like+cells+can+be+isolated+with+drug+selection+in+human+ovarian+cancer+cell+line+SKOV3.">Cancer stem-like cells can be isolated with drug selection in human ovarian cancer cell line SKOV3.</a> Acta Biochim Biophys Sin (Shanghai). 42, 593-602 (2010).</li><li>Bonnet, D., Dick, J. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Human+acute+myeloid+leukemia+is+organized+as+a+hierarchy+that+originates+from+a+primitive+hematopoietic+cell.">Human acute myeloid leukemia is organized as a hierarchy that originates from a primitive hematopoietic cell.</a> Nature Medicine. 3, 730-737 (1997).</li><li>Alison, M. R., Lim, S. M., Nicholson, L. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cancer+stem+cells:+problems+for+therapy.">Cancer stem cells: problems for therapy.</a> The Journal of pathology. 223, 147-161 (2011).</li><li>Luo, X., Dong, Z., Chen, Y., Yang, L., Lai, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Enrichment+of+ovarian+cancer+stem-like+cells+is+associated+with+epithelial+to+mesenchymal+transition+through+an+miRNA-activated+AKT+pathway.">Enrichment of ovarian cancer stem-like cells is associated with epithelial to mesenchymal transition through an miRNA-activated AKT pathway.</a> Cell proliferation. 46, 436-446 (2013).</li><li>Wang, L., Mezencev, R., Bowen, N. J., Matyunina, L. V., McDonald, J. F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Isolation+and+characterization+of+stem-like+cells+from+a+human+ovarian+cancer+cell+line.">Isolation and characterization of stem-like cells from a human ovarian cancer cell line.</a> Molecular and cellular biochemistry. 363, 257-268 (2012).</li><li>Abubaker, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Short-term+single+treatment+of+chemotherapy+results+in+the+enrichment+of+ovarian+cancer+stem+cell-like+cells+leading+to+an+increased+tumor+burden.">Short-term single treatment of chemotherapy results in the enrichment of ovarian cancer stem cell-like cells leading to an increased tumor burden.</a> Molecular cancer. 12, 24 (2013).</li><li>Conic, I., Dimov, I., Tasic-Dimov, D., Djordjevic, B., Stefanovic, V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Ovarian+epithelial+cancer+stem+cells.">Ovarian epithelial cancer stem cells.</a> ScientificWorldJournal. 11, 1243-1269 (2011).</li><li>Liu, K. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Ovarian+cancer+stem-like+cells+show+induced+translineage-differentiation+capacity+and+are+suppressed+by+alkaline+phosphatase+inhibitor.">Ovarian cancer stem-like cells show induced translineage-differentiation capacity and are suppressed by alkaline phosphatase inhibitor.</a> Oncotarget. 4 (12), 2366-2382 (2013).</li><li>Liu, T., Cheng, W., Lai, D., Huang, Y., Guo, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Characterization+of+primary+ovarian+cancer+cells+in+different+culture+systems.">Characterization of primary ovarian cancer cells in different culture systems.</a> Oncology reports. 23, 1277-1284 (2010).</li></ol>

The authors declare they have no competing financial interest.

CSC qui sont résistantes à la thérapie peuvent être tenus responsables de rechute après le traitement de la tumeur primitive. Caractérisation des CSC peut conduire à l&#39;amélioration des thérapies pour le cancer de l&#39;ovaire. Les paramètres critiques dans la mise en place de CCF chimiorésistantes utilisant le protocole ci-dessus sont des chronogrammes de la durée du traitement avec la chimiothérapie et la concentration de la chimiothérapie. Lorsque vous utilisez le protocole de Ma et al. il a...

Resistance to chemotherapy is a major impediment to the treatment and cure of cancer. Ovarian cancer is the 5th leading cause of cancer-related deaths among women in the United States (American Cancer Society Facts and Figures 2013). Patients initially respond well to chemotherapy, but most patients relapse1. After relapse patients are treated with a variety of additional chemotherapy agents with very little benefit2. General properties of CSCs include unlimited proliferative capabilities, retention of an undifferentiated state, resistance to drug treatment, efficient DNA repair, and ability to generate malignant tumor cells with different phenotypes3. CSCs frequently exhibit expression of stem cell genes such as Nanog, Oct4, Sox2, Nestin, CD133, and CD117. CSCs often express elevated levels of ABCG2, and ALDH genes that may contribute to drug efflux and metabolism3,4. 
The first definitive evidence for CSCs was demonstrated by isolating acute myeloid leukemia-initiating cells that were capable of self-renewal and tumor generation5. These leukemic stem cells expressed surface CD34 and generated leukemia in NOD/SCID (immunocompromised) mice5. Since then CSCs have been identified in many cancer types including leukemias/lymphomas, breast, bladder, colorectal, endometrial, sarcomas, hepatocellular carcinoma, melanomas, gliomas, ovarian, pancreatic, prostate, squamous cell carcinoma, and lung6. Therefore, being able to study this subtype of cancer cell is advantageous.
The goal of this study is to create a protocol for the selection and isolation of chemoresistant CSCs. Several methods have been reported for the isolation of CSCs from ovarian cancer cell lines. Non-adherent spheroids isolated from OVCAR-3, SKOV3, or HO8910 cultures demonstrate stem-like properties7,8. Isolation of CD133+ cells from OVCAR-3 cultures also yields CSCs. CSCs have also been selected in culture by treatment with chemotherapeutic agents. Treating tumor cell lines (OVCA433, Hey, and SKOV3 cells) with cisplatin and paclitaxel allows for the expansion and isolation of CSCs4,9. While culture of some cell types in CSC media leads to isolation of CSCs, SKOV3 cells did not survive culture in serum-free media or form sphere cells4. Therefore, treatment of cells with cisplatin and paclitaxel aided the expansion or isolation of this population4.
Using a modification of the procedure presented by Ma and colleagues4 we developed a method to isolate CSCs from the ovarian cancer cell lines. Our protocol is advantageous as it yields more viable cells while using less toxic chemotherapeutic agents. Cells are treated with cisplatin and subsequently grown in serum-free media supplemented with growth factors (stem cell media). We isolate the resulting non-adherent sphere cells and assay them for their expression of stem cell markers. This model enables the study of CSC properties and response to drug therapy.

<table border="0" cellpadding="0" cellspacing="0" width="573">
	<tbody>
		<tr height="43">
			<td height="43" style="height:43px;width:216px;">Name of Reagent/ Equipment</td>
			<td style="width:71px;">Company</td>
			<td style="width:119px;">Catalog Number</td>
			<td style="width:167px;">Comments/Description</td>
		</tr>
		<tr height="61">
			<td height="61" style="height:61px;width:216px;">McCoy</td>
			<td style="width:71px;">Life Technologies</td>
			<td style="width:119px;">16600-108</td>
			<td style="width:167px;">Warm to 37C prior to use</td>
		</tr>
		<tr height="61">
			<td height="61" style="height:61px;width:216px;">DMEM / F12 serum free</td>
			<td style="width:71px;">Life Technologies&#160;</td>
			<td style="width:119px;">11320-033</td>
			<td style="width:167px;">Warm to 37C prior to use</td>
		</tr>
		<tr height="61">
			<td height="61" style="height:61px;width:216px;">Minimal Essential Media</td>
			<td style="width:71px;">Life Technologies&#160;</td>
			<td>42360032</td>
			<td style="width:167px;">Warm to 37C prior to use</td>
		</tr>
		<tr height="61">
			<td height="61" style="height:61px;width:216px;">Sodium Pyruvate</td>
			<td style="width:71px;">Life Technologies&#160;</td>
			<td><a href="http://www.lifetechnologies.com/order/catalog/product/11360070">11360070</a></td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="22">
			<td height="22" style="height:22px;width:216px;">Polybrene</td>
			<td style="width:71px;">Millipore</td>
			<td>TR-1003-G</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="61">
			<td height="61" style="height:61px;width:216px;">Blasticidin</td>
			<td style="width:71px;">Life Technologies&#160;</td>
			<td><a href="http://www.lifetechnologies.com/order/catalog/product/R21001">R21001</a></td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="61">
			<td height="61" style="height:61px;width:216px;">Fetal Bovine Serum&#160;</td>
			<td style="width:71px;">Atlas Biologicals</td>
			<td style="width:119px;">F-0500-A</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="61">
			<td height="61" style="height:61px;width:216px;">Penicillin-streptomycin&#160;</td>
			<td style="width:71px;">Life Technologies</td>
			<td style="width:119px;">15070-063</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="41">
			<td height="41" style="height:41px;width:216px;">Cisplatin</td>
			<td style="width:71px;">Sigma-Aldrich</td>
			<td style="width:119px;">T7402-5MG</td>
			<td style="width:167px;">Caution: Toxic Use precautions</td>
		</tr>
		<tr height="41">
			<td height="41" style="height:41px;width:216px;">pLenti-suCMV-Rsv</td>
			<td style="width:71px;">Gentarget</td>
			<td style="width:119px;">LVP023</td>
			<td style="width:167px;">BSL2 approval needed</td>
		</tr>
		<tr height="41">
			<td height="41" style="height:41px;width:216px;">Insulin</td>
			<td style="width:71px;">Sigma-Aldrich</td>
			<td style="width:119px;">I-1882</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="101">
			<td height="101" style="height:101px;width:216px;">Human Recombinant EGF&#160;</td>
			<td style="width:71px;">Cell Signaling Technology</td>
			<td style="width:119px;">8916LC</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="61">
			<td height="61" style="height:61px;width:216px;">bFGF</td>
			<td style="width:71px;">BD biosciences</td>
			<td style="width:119px;">354060</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="20">
			<td height="41" rowspan="2" style="height:41px;width:216px;">LIF</td>
			<td rowspan="2" style="width:71px;">Santa Cruz</td>
			<td rowspan="2" style="width:119px;">sc-4988A</td>
			<td rowspan="2" style="width:167px;"></td>
		</tr>
		<tr height="21">
		</tr>
		<tr height="41">
			<td height="41" style="height:41px;width:216px;">Bovine Serum Albumin</td>
			<td style="width:71px;">Roche</td>
			<td style="width:119px;">03 116 956 001</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="61">
			<td height="61" style="height:61px;width:216px;">TRIzol</td>
			<td style="width:71px;">Life Technologies</td>
			<td style="width:119px;">15596-018</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="61">
			<td height="61" style="height:61px;width:216px;">High Capacity cDNA Reverse Transcription Kit&#160;&#160;</td>
			<td style="width:71px;">Applied Biosystems</td>
			<td style="width:119px;">4368813</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">IQ Multiplex Powermix</td>
			<td style="width:71px;">BioRad</td>
			<td style="width:119px;">1725849</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Accumax</td>
			<td style="width:71px;">Millipore</td>
			<td style="width:119px;"></td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="101">
			<td height="101" style="height:101px;width:216px;">Primers</td>
			<td style="width:71px;">Integrated DNA Technology</td>
			<td style="width:119px;">individually designed and ordered (see protocol for sequnces)</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="41">
			<td height="41" style="height:41px;width:216px;">Anti-CD133 PE</td>
			<td style="width:71px;">Milenyl</td>
			<td>130-098-826</td>
			<td style="width:167px;">Primer/probe sets are light sensitive</td>
		</tr>
		<tr height="22">
			<td height="22" style="height:22px;width:216px;">CD117-Biotin</td>
			<td style="width:71px;">Miltenly</td>
			<td>130-098-570</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="22">
			<td height="22" style="height:22px;width:216px;">AntiBiotin-FITC</td>
			<td style="width:71px;">Miltenly</td>
			<td>130-098-796</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="61">
			<td height="61" style="height:61px;width:216px;">Paraformaldehyde</td>
			<td style="width:71px;">Sigma-Aldrich</td>
			<td>P6148-1KG</td>
			<td style="width:167px;">Caution: Toxic always prepare in hood and make fresh.</td>
		</tr>
		<tr height="61">
			<td height="61" style="height:61px;width:216px;">Trypsin</td>
			<td style="width:71px;">Life Technologies</td>
			<td><a href="http://www.lifetechnologies.com/order/catalog/product/25300062">25300062</a></td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="41">
			<td height="41" style="height:41px;">MTT (3-(4, 5-Dimethylthiazol-2-yl)-2, 5-diphenyltetrazolium bromide)&#160;</td>
			<td style="width:71px;">Sigma-Aldrich</td>
			<td style="width:119px;">25200-072</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="22">
			<td height="22" style="height:22px;">EVOS Fl Epifluorescence and Transmitted Light Microscope</td>
			<td>Advanced Microscopy Group</td>
			<td style="width:119px;"></td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="22">
			<td height="22" style="height:22px;">Biorad CFX96 C1000 System</td>
			<td style="width:71px;">Biorad</td>
			<td style="width:119px;"></td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="41">
			<td height="41" style="height:41px;">Beckman Coulter FC500 Flow Cytometer&#160;</td>
			<td style="width:71px;">Beckman Coulter</td>
			<td style="width:119px;"></td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="61">
			<td height="61" style="height:61px;width:216px;">Spectramax 340PC384&#160;</td>
			<td style="width:71px;">Molecular Devices</td>
			<td style="width:119px;"></td>
			<td style="width:167px;"></td>
		</tr>
	</tbody>
</table>

enrichment for chemoresistant ovarian cancer stem cells from human cell lines

cellules souches du cancer (CCM) sont définies comme un sous-ensemble du cyclisme lente et cellules indifférenciées qui se divisent de façon asymétrique pour générer hautement proliférante, envahissante, et les cellules tumorales chimiorésistantes. Par conséquent, les CSC sont une population intéressante de cellules à cibler thérapeutique. CCM sont prédits pour contribuer à un certain nombre de types de tumeurs malignes, y compris celles dans le sang, le cerveau, les poumons, le tractus gastro-intestinal, de la prostate et de l&#39;ovaire. Isoler et enrichir une population de cellules tumorales pour les CSC permettra aux chercheurs d&#39;étudier les propriétés, la génétique, et la réponse thérapeutique des CSC. Nous avons généré un protocole qui enrichit de manière reproductible pour CCM de cancer ovarien de lignées cellulaires de cancer de l&#39;ovaire (SKOV3 et OVCA429). Les lignées cellulaires sont traitées avec 20 uM de cisplatine pendant 3 jours. Les cellules survivantes sont isolées et mises en culture dans un milieu de cellules souches sans sérum contenant des cytokines et des facteurs de croissance. Nous démontrons un enrichissement de ces CSC purifiés par l&#39;analyse des cellules isolées pour known marqueurs de cellules souches Oct4, Nanog, et PROM1 (CD133) et de l&#39;expression de surface cellulaire de CD177 et CD133. L&#39;exposition CSC a augmenté chimiorésistance. Cette méthode pour l&#39;isolement des CSC est un outil utile pour étudier le rôle des CSC dans la chimiorésistance et la tumeur récidive.

Pour démontrer que nous avons isolé CCF de lignées cellulaires de cancer ovarien épithélial en utilisant un traitement à la cisplatine, nous avons fait l&#39;acquisition des images des lignées de cellules avant le traitement et après la sélection. Nous avons utilisé la microscopie optique pour capturer des images de adhérent (non traité) SKOV3 et OVCA429 cellules et SKOV3 et OVCA429 CSC (Figure 1). CCM apparaissent tour et qui n&#39;est pas attaché à des plaques de culture tissulaire <stro...

Watch this Scientific Journal Video about Enrichment for Chemoresistant Ovarian Cancer Stem Cells from Human Cell Lines at JoVE.com

Enrichment for Chemoresistant Ovarian Cancer Stem Cells from Human Cell Lines

cellules souches du cancer (CCM) sont impliqués dans la rechute de la tumeur en raison de la chimiorésistance. Nous avons optimisé un protocole pour la sélection et l&#39;expansion de la CCF de lignées cellulaires de cancer de l&#39;ovaire. En traitant les cellules avec le cisplatine chimiothérapeutique et la mise en culture d&#39;une cellule souche promotion de médias nous enrichir en cultures SCC non adhérentes.

Enrichissement pour chimiorésistantes cancer de l&#39;ovaire des cellules souches à partir de lignées cellulaires humaines

Cancer stem cells (CSCs) are defined as a subset of slow cycling and undifferentiated cells that divide asymmetrically to generate highly proliferative, ...

enrichment-for-chemoresistant-ovarian-cancer-stem-cells-from-human

Research

JoVE Journal

Medicine

13.4K vues.  Indiana University School of Medicine.  cellules souches du cancer (CCM) sont impliqués dans la rechute de la tumeur en raison de la chimiorésistance. Nous avons optimisé un protocole pour la sélection et l'expansion de la CCF de lignées cellulaires de cancer de l'ovaire. En traitant les cellules avec le cisplatine chimiothérapeutique et la mise en culture d'une cellule souche promotion de médias nous enrichir en cultures SCC non adhérentes. 

Vidéo: Enrichment for Chemoresistant Ovarian Cancer Stem Cells from Human Cell Lines

Isolation of Cardiomyocyte Nuclei from Post-mortem Tissue

Identification of cardiomyocyte nuclei has been challenging in tissue sections as most strategies rely only on cytoplasmic marker proteins1. Rare events in cardiac myocytes such as proliferation and apoptosis require an accurate identification of cardiac myocyte nuclei to analyze cellular renewal in homeostasis and in pathological conditions2. Here, we provide a method to isolate cardiomyocyte nuclei from post mortem tissue by density sedimentation and immunolabeling with antibodies against pericentriolar material 1 (PCM-1) and subsequent flow cytometry sorting. This strategy allows a high throughput analysis and isolation with the advantage of working equally well on fresh tissue and frozen archival material. This makes it possible to study material already collected in biobanks. This technique is applicable and tested in a wide range of species and suitable for multiple downstream applications such as carbon-14 dating3, cell-cycle analysis4, visualization of thymidine analogues (e.g. BrdU and IdU)4, transcriptome and epigenetic analysis.

Cardiac nuclei are isolated via density sedimentation and immunolabeled with antibodies against pericentriolar material 1 (PCM-1) to identify and sort cardiomyocyte nuclei by flow cytometry.

Isolement des noyaux de cardiomyocytes post-mortem des tissus

Identification of cardiomyocyte nuclei has been challenging in tissue sections as most strategies rely only on cytoplasmic marker proteins1. Rare events ...

Recherche

Médecine

Human Neuroendocrine Tumor Cell Lines as a Three-Dimensional Model for the Study of Human Neuroendocrine Tumor Therapy

Neuroendocrine tumors (NETs) are rare tumors, with an incidence of two per 100,&#x200A;000 individuals per year, and they account for 0.5% of all human malignancies.1 Other than surgery for the minority of patients who present with localized disease, there is little or no survival benefit of systemic therapy. Therefore, there is a great need to better understand the biology of NETs, and in particular define new therapeutic targets for patients with nonresectable or metastatic neuroendocrine tumors. 3D cell culture is becoming a popular method for drug screening due to its relevance in modeling the in vivo tumor tissue organization and microenvironment.2,3 The 3D multicellular spheroids could provide valuable information in a more timely and less expensive manner than directly proceeding from 2D cell culture experiments to animal (murine) models.
To facilitate the discovery of new therapeutics for NET patients, we have developed an in vitro 3D multicellular spheroids model using the human NET cell lines. The NET cells are plated in a non-adhesive agarose-coated 24-well plate and incubated under physiological conditions (5% CO2, 37 &deg;C) with a very slow agitation for 16-24 hr after plating. The cells form multicellular spheroids starting on the 3rd or 4th day. The spheroids become more spherical by the 6th day, at which point the drug treatments are initiated. The efficacy of the drug treatments on the NET spheroids is monitored based on the morphology, shape and size of the spheroids with a phase-contrast light microscope. The size of the spheroids is estimated automatically using a custom-developed MATLAB program based on an active contour algorithm. Further, we demonstrate a simple method to process the HistoGel embedding on these 3D spheroids, allowing the use of standard histological and immunohistochemical techniques. 
This is the first report on generating 3D spheroids using NET cell lines to examine the effect of therapeutic drugs. We have also performed histology on these 3D spheroids, and displayed an example of a single drug's effect on growth and proliferation of the NET spheroids. Our results support that the NET spheroids are valuable for further studies of NET biology and drug development.

We present a simple agarose overlay platform to grow 3D multicellular spheroids using neuroendocrine cancer cell lines. This method provides a very convenient way to examine the effect of therapeutic drugs on the neuroendocrine tumor cells. It could also help us establish human neuroendocrine tumor spheroids for cancer therapy.

L&#39;homme neuroendocriniennes lignées cellulaires tumorales comme un modèle tridimensionnel pour l&#39;étude de la thérapie des tumeurs neuro-endocrines humaines

Neuroendocrine tumors (NETs) are rare tumors, with an incidence of two per 100,&#x200A;000 individuals per year, and they account for 0.5% of all human ...

Isolation, Characterization and Comparative Differentiation of Human Dental Pulp Stem Cells Derived from Permanent Teeth by Using Two Different Methods

Developing wisdom teeth are easy-accessible source of stem cells during the adulthood which could be obtained by routine orthodontic treatments. Human pulp-derived stem cells (hDPSCs) possess high proliferation potential with multi-lineage differentiation capacity compare to the ordinary source of adult stem cells1-8; therefore, hDPSCs could be the good candidates for autologous transplantation in tissue engineering and regenerative medicine. Along with these benefits, possessing the mesenchymal stem cells (MSC) features, such as immunolodulatory effect, make hDPSCs more valuable, even in the case of allograft transplantation6,9,10. Therefore, the primary step for using this source of stem cells is to select the best protocol for isolating hDPSCs from pulp tissue. In order to achieve this goal, it is crucial to investigate the effect of various isolation conditions on different cellular behaviors, such as their common surface markers &amp; also their differentiation capacity.
Thus, here we separate human pulp tissue from impacted third molar teeth, and then used both existing protocols based on literature, for isolating hDPSCs,11-13 i.e. enzymatic dissociation of pulp tissue (DPSC-ED) or outgrowth from tissue explants (DPSC-OG). In this regards, we tried to facilitate the isolation methods by using dental diamond disk. Then, these cells characterized in terms of stromal-associated Markers (CD73, CD90, CD105 &amp; CD44), hematopoietic/endothelial Markers (CD34, CD45 &amp; CD11b), perivascular marker, like CD146 and also STRO-1. Afterwards, these two protocols were compared based on the differentiation potency into odontoblasts by both quantitative polymerase chain reaction (QPCR) &amp; Alizarin Red Staining. QPCR were used for the assessment of the expression of the mineralization-related genes (alkaline phosphatase; ALP, matrix extracellular phosphoglycoprotein; MEPE &amp; dentin sialophosphoprotein; DSPP).14

The method described isolation and characterization of human Dental Pulp Stem Cells (hDPSCs) by using either enzymatic dissociation of pulp (DPSC-ED) or direct outgrowth of stem cells from pulp tissue explants (DPSC-OG). Then followed by in vitro comparative differentiation of both types of hDPSCs into odontoblasts.

Différenciation isolement, caractérisation et comparative de l&#39;homme dentaires cellules souches de pulpe Dérivé de dents permanentes à l&#39;aide de deux méthodes différentes

Developing wisdom teeth are easy-accessible source of stem cells during the adulthood which could be obtained by routine orthodontic treatments. Human ...

Time-lapse Imaging of Primary Preneoplastic Mammary Epithelial Cells Derived from Genetically Engineered Mouse Models of Breast Cancer

Time-lapse imaging can be used to compare behavior of cultured primary preneoplastic mammary epithelial cells derived from different genetically engineered mouse models of breast cancer. For example, time between cell divisions (cell lifetimes), apoptotic cell numbers, evolution of morphological changes, and mechanism of colony formation can be quantified and compared in cells carrying specific genetic lesions. Primary mammary epithelial cell cultures are generated from mammary glands without palpable tumor. Glands are carefully resected with clear separation from adjacent muscle, lymph nodes are removed, and single-cell suspensions of enriched mammary epithelial cells are generated by mincing mammary tissue followed by enzymatic dissociation and filtration. Single-cell suspensions are plated and placed directly under a microscope within an incubator chamber for live-cell imaging. Sixteen 650 &mu;m x 700 &mu;m fields in a 4x4 configuration from each well of a 6-well plate are imaged every 15 min for 5 days. Time-lapse images are examined directly to measure cellular behaviors that can include mechanism and frequency of cell colony formation within the first 24 hr of plating the cells (aggregation versus cell proliferation), incidence of apoptosis, and phasing of morphological changes. Single-cell tracking is used to generate cell fate maps for measurement of individual cell lifetimes and investigation of cell division patterns. Quantitative data are statistically analyzed to assess for significant differences in behavior correlated with specific genetic lesions.

Time-lapse imaging is used to assess behavior of primary preneoplastic mammary epithelial cells derived from genetically engineered mouse models of breast cancer risk to determine if there are correlations between specific behavioral parameters and distinct genetic lesions.

Imagerie time-lapse de primaires prénéoplasiques cellules épithéliales mammaires issues de modèles de souris génétiquement modifiées de cancer du sein

Time-lapse  imaging can be used to compare behavior of cultured primary preneoplastic  mammary epithelial cells derived from different genetically ...

Patient Derived Cell Culture and Isolation of CD133+ Putative Cancer Stem Cells from Melanoma

Despite improved treatments options for melanoma available today, patients with advanced malignant melanoma still have a poor prognosis for progression-free and overall survival. Therefore, translational research needs to provide further molecular evidence to improve targeted therapies for malignant melanomas. In the past, oncogenic mechanisms related to melanoma were extensively studied in established cell lines. On the way to more personalized treatment regimens based on individual genetic profiles, we propose to use patient-derived cell lines instead of generic cell lines. Together with high quality clinical data, especially on patient follow-up, these cells will be instrumental to better understand the molecular mechanisms behind melanoma progression.
Here, we report the establishment of primary melanoma cultures from dissected fresh tumor tissue. This procedure includes mincing and dissociation of the tissue into single cells, removal of contaminations with erythrocytes and fibroblasts as well as primary culture and reliable verification of the cells' melanoma origin.
Recent reports revealed that melanomas, like the majority of tumors, harbor a small subpopulation of cancer stem cells (CSCs), which seem to exclusively fuel tumor initiation and progression towards the metastatic state. One of the key markers for CSC identification and isolation in melanoma is CD133. To isolate CD133+ CSCs from primary melanoma cultures, we have modified and optimized the Magnetic-Activated Cell Sorting (MACS) procedure from Miltenyi resulting in high sorting purity and viability of CD133+ CSCs and CD133- bulk, which can be cultivated and functionally analyzed thereafter.

Patient Derived Cell Culture and Isolation of CD133+ Putative Cancer Stem Cells from Melanoma

This article describes the preparation of freshly obtained melanoma tissue into primary cell cultures, and how to remove contaminations of erythrocytes and fibroblasts from the tumor cells. Finally, we describe how CD133+ putative melanoma stem cells are sorted from the CD133- bulk using Magnetic Activated Cell Sorting (MACS).

Patient Culture cellulaire dérivée et isolement de CD133<sup&gt; +</sup&gt; Putatifs cellules souches du cancer du mélanome

Despite improved treatments options for melanoma available today, patients with advanced malignant melanoma still have a poor prognosis for ...

Isolation of Cancer Stem Cells From Human Prostate Cancer Samples

The cancer stem cell (CSC) model has been considerably revisited over the last two decades. During this time CSCs have been identified and directly isolated from human tissues and serially propagated in immunodeficient mice, typically through antibody labeling of subpopulations of cells and fractionation by flow cytometry. However, the unique clinical features of prostate cancer have considerably limited the study of prostate CSCs from fresh human tumor samples. We recently reported the isolation of prostate CSCs directly from human tissues by virtue of their HLA class I (HLAI)-negative phenotype. Prostate cancer cells are harvested from surgical specimens and mechanically dissociated. A cell suspension is generated and labeled with fluorescently conjugated HLAI and stromal antibodies. Subpopulations of HLAI-negative cells are finally isolated using a flow cytometer. The principal limitation of this protocol is the frequently microscopic and multifocal nature of primary cancer in prostatectomy specimens. Nonetheless, isolated live prostate CSCs are suitable for molecular characterization and functional validation by transplantation in immunodeficient mice.

The isolation of cancer stem cells (CSCs) directly from human tissues is requisite for their biological characterization. This manuscript describes a methodology for the isolation of prostate CSCs from human tissues, while also providing tips on troubleshooting difficult steps.

Isolement de cellules souches du cancer à partir d&#39;échantillons cancer de la prostate humaine

The cancer stem cell (CSC) model has been considerably revisited over the last two decades. During this time CSCs have been identified and directly ...

Method for Obtaining Primary Ovarian Cancer Cells From Solid Specimens

Reliable tools for investigating ovarian cancer initiation and progression are urgently needed. While the use of ovarian cancer cell lines remains a valuable tool for understanding ovarian cancer, their use has many limitations. These include the lack of heterogeneity and the plethora of genetic alterations associated with extended in vitro passaging.&#160;Here we describe a method that allows for rapid establishment of primary ovarian cancer cells form solid clinical specimens collected at the time of surgery. The method consists of subjecting clinical specimens to enzymatic digestion for 30 min. The isolated cell suspension is allowed to grow and can be used for downstream application including drug screening. The advantage of primary ovarian cancer cell lines over established ovarian cancer cell lines is that they are representative of the original specific clinical specimens they are derived from and can be derived from different sites whether primary or metastatic ovarian cancer.

This study describes a detailed method for isolation and characterization of primary ovarian cancer cells from solid clinical specimens. Ovarian cancer clinical specimens are subjected to enzymatic digestion to obtain viable, fibroblast-free epithelial ovarian cancer (EOC) cells highly suitable for downstream applications.

Méthode pour l&#39;obtention de cellules cancéreuses ovariennes primaires à partir d&#39;échantillons solides

Reliable tools for investigating ovarian cancer initiation and progression are urgently needed. While the use of ovarian cancer cell lines remains a ...

Evaluation of Stem Cell Properties in Human Ovarian Carcinoma Cells Using Multi and Single Cell-based Spheres Assays

Years of research indicates that ovarian cancers harbor a heterogeneous mixture of cells including a subpopulation of so-called &#8220;cancer stem cells&#8221; (CSCs) responsible for tumor initiation, maintenance and relapse following conventional chemotherapies. Identification of ovarian CSCs is therefore an important goal. A commonly used method to assess CSC potential in vitro is the spheres assay in which cells are plated under non-adherent culture conditions in serum-free medium supplemented with growth factors and sphere formation is scored after a few days. Here, we review currently available protocols for human ovarian cancer spheres assays and perform a side-by-side analysis between commonly used multi cell-based assays and a more accurate system based on single cell plating. Our results indicate that both multi cell-based as well as single cell-based spheres assays can be used to investigate sphere formation in vitro. The more laborious and expensive single cell-based assays are more suitable for functional assessment of individual cells and lead to overall more accurate results while multi cell-based assays can be strongly influenced by the density of plated cells and require titration experiments upfront. Methylcellulose supplementation to multi cell-based assays can be effectively used to reduce mechanical artifacts.

In vitro spheres assays are commonly used to identify cancer stem cells. Here we compare single with multi cell-based spheres assays. The more laborious single cell-based assays or methylcellulose supplementation give more accurate results while multi cell-based assays performed in liquid medium can be highly influenced by cell density.

Evaluation des propriétés de cellules souches en cellules humaines de l&#39;ovaire Carcinome utilisant MULTI et simples à base de cellules Sphères dosages

Years of research indicates that ovarian cancers harbor a heterogeneous mixture of cells including a subpopulation of so-called &#8220;cancer stem ...

In vitro Enrichment of Ovarian Cancer Tumor-initiating Cells

Evidence suggests that small subpopulations of tumor cells maintain a unique self-renewing and differentiation capacity and may be responsible for tumor initiation and/or relapse. Clarifying the mechanisms by which these tumor-initiating cells (TICs) support tumor formation and progression could lead to the development of clinically favorable therapies. Ovarian cancer is a heterogeneous and highly recurrent disease. Recent studies suggest TICs may play an important role in disease biology. We have identified culture conditions that enrich for TICs from ovarian cancer cell lines. Growing either adherent cells or non-adherent &#8216;floater&#8217; cells in a low attachment plate with serum free media in the presence of growth factors supports the propagation of ovarian cancer TICs with stem cell markers (CD133 and ALDH activity) and increased tumorigenicity without the need to physically separate the TICs from other cell types within the culture. Although the presence of floater cells is not common for all cell lines, this population of cells with innate low adherence may have high tumorigenic potential.Compared to adherent cells grown in the presence of serum, TICs readily form spheres, are significantly more tumorigenic in mice, and express putative stem cell markers. The conditions are easy to establish in a timely manner and can be used to study signaling pathways important for maintaining stem characteristics, and to identify drugs or combinations of drugs targeting TICs. The culture conditions described herein are applicable for a variety of ovarian cancer cells of epithelial origin and will be critical in providing new information about the role of TICs in tumor initiation, progression, and relapse.

In vitro Enrichment of Ovarian Cancer Tumor-initiating Cells

Tumor-initiating cells (TICs) may represent a viable therapeutic target for the treatment of ovarian cancer, a highly recurrent and fatal disease. We present a protocol for culture conditions that enrich for this highly tumorigenic population of cells.

Dans l&#39;Enrichissement vitro du cancer des ovaires cellules initiatrices de tumeurs

Evidence suggests that small subpopulations of tumor cells maintain a unique self-renewing and differentiation capacity and may be responsible for tumor ...

Mammosphere Formation Assay from Human Breast Cancer Tissues and Cell Lines

Similar to healthy tissues, many blood and solid malignancies are now thought to be organised hierarchically, with a subset of stem-like cancer cells that self-renew while giving rise to more differentiated progeny. Understanding and targeting these cancer stem cells in breast cancer, which may possess enhanced chemo- and radio-resistance compared to the non-stem tumor bulk, has become an important research area. Markers including CD44, CD24, and ALDH activity can be assessed using fluorescence activated cell sorting (FACS) to prospectively isolate cells that display enhanced tumorigenicity when implanted into immunocompromised mice: the mammosphere assay has also become widely used for its ability to retrospectively identify sphere-forming cells that develop from single stem cell-like clones. Here we outline approaches for the appropriate culturing of mammospheres from cell lines or primary patient samples, their passaging, and calculations to estimate sphere forming efficiency (SFE). First we discuss key considerations and pitfalls in the appropriate planning and interpretation of mammosphere experiments.

Floating mammosphere assays can investigate the subset of stem-like breast cancer cells that survive in suspension conditions and show enhanced tumorigenesis when implanted into mice. This protocol provides a convenient in vitro measure of sphere-forming ability, a proxy for in vivo tumorigenesis, while facilitating analysis of the stem-associated transcriptional landscape.

Mammosphere Formation dosage du sein humain cancer des tissus et des lignées cellulaires

Similar to healthy tissues, many blood and solid malignancies are now thought to be organised hierarchically, with a subset of stem-like cancer cells that ...