The authors would like to acknowledge the Utah Science Technology and Research fund for support of YML and the Korea National Research Foundation grants (2009-0069679 and 2010-0010154) for support of SIY. This research was supported by the Utah Agricultural Experiment Station, Utah State University, and approved as journal paper number UAES #8753. Also, the authors thank Dr. Deborah McClellan for editorial assistance.

The authors have declared that they have no competing financial interests.

Le protocole actuel a été utilisée avec succès pour générer de pleine longueur infectieux de clones d&#39;ADNc de deux souches différentes (CNU / LP2 et 27 SA 14 -14 à 2 28) de JEV, un flavivirus dont ADNc fonctionnel est révélée être par nature difficiles à construire et propager en raison de la toxicité de la cellule hôte et de l&#39;instabilité génétique de l&#39;ADNc clone 8,74-76 Ce protocole comporte trois composantes majeures:. premières, en maximisant la synthèse / amplification d&#39;une copie d&#39;ADNc fidèles de l&#39;ARN viral en utilisant inverse haute fidélité transcriptase / ADN polymérase; Deuxièmement, le clonage de la région virale prM-E de codage contenant des séquences toxiques (données non publiées) 74,77,78 dans un très faible nombre de copies vecteur BAC de l&#39;ADNc initial sous-clonage aux pleine longueur étapes finales d&#39;assemblage d&#39;ADNc; et la troisième, en utilisant un taux d&#39;alcoolémie de vecteur de clonage qui peut accueillir un ADN étranger avec une taille moyenne de 120 à 350 kb, 19-21 qui tolère apparemment plus grande ADN Inserts que les autres vecteurs de clonage. Cette approche de clonage sera généralement applicable à de nombreux autres virus à ARN à brin positif, en particulier ceux avec un grand génome ARN de ~ 10 à 32 kb. Génération d&#39;un clone d&#39;ADNc infectieux est une étape clé dans le développement d&#39;un système de génétique inverse pour les virus à ARN, en particulier pour les virus à ARN à brin positif, parce que son génome agit ARNm viral qui est traduit en protéines par les ribosomes de la cellule hôte. Ainsi, la replication virale peut être initiée par l&#39;introduction d&#39;un génome de longueur molécule d&#39;ARN dérivé de l&#39;ADNc dans une cellule hôte sensible. La disponibilité d&#39;un clone infectieux JEV ADNc, lorsqu&#39;il est combiné avec la technologie de l&#39;ADN recombinant, a permis de mieux comprendre les divers aspects du cycle de vie viral au niveau moléculaire, tel que l&#39;expression du gène 73,79 et la replication du génome. 63,64 De plus, un pleine longueur JEV clone d&#39;ADNc a prouvé être un outil précieux pour le développement de vaccins antiviraux 28 et des vecteurs de transfert de gènes. &lt;sup&gt; 80,81 Comme avec tous les virus à ARN à brin positif, il ya plusieurs étapes critiques dans la construction d&#39;un ADNc fonctionnelle fiable pour JEV dont ARN hautement infectieux peuvent être synthétisés in vitro. Dans l&#39;idéal, la séquence des ARN transcrits synthétiques partir d&#39;un clone de l&#39;ADNc pleine longueur doit être identique à celle de l&#39;ARN génomique viral, en particulier les 5 &#39;et 3&#39;-terminales des séquences qui sont nécessaires pour l&#39;initiation de la replication de l&#39;ARN viral . 60-62 Dans le protocole courant, la 5 &#39;et authentique extrémités 3&#39; ont été assurées en plaçant la séquence promoteur SP6 en amont du premier nucléotide d&#39;adénine du génome viral et le positionnement d&#39;un site unique artificiel de restriction Xba I en aval du dernier thymine nucléotidique du génome viral, respectivement. Plafonné ARNs de synthèse avec l&#39;authentique 5 &#39;et 3&#39; ont été produites par la transcription en run-off d&#39;un ADNc te Xba I-linéarisé et MBN-traitémplate en utilisant l&#39;ARN polymerase SP6 amorcée avec le G 7 m (5 &#39;) ppp (5&#39;) un analogue de la coiffe. Ce protocole peut être modifié de plusieurs façons. Pour la transcription in vitro, un autre ARN bactériophage polymérase (par exemple, T3 ou T7) peut être utilisé en conjonction avec sa séquence de promoteur bien défini. 27 Comme un site run-off, un site de restriction différente peut être utilisée si elle ne figure pas dans le génome viral et l&#39;ARN synthétique, si de l&#39;ADNc avec les extrémités linéarisé authentique extrémité 3 &#39;. L&#39;importance de la séquence nucléotidique de l&#39;extrémité 3 &#39;a été mise en évidence par une diminution de ~ 10 fois de l&#39;ARN infectieux quand un ARN synthétique contient trois ou quatre nucleotides des virus non lié à son extrémité 3&#39;. 27 Dans un vitro réaction de transcription, à la fois la m 7 G (5 &#39;) ppp (5&#39;) A et m 7 G (5 &#39;) ppp (5&#39;) G bouchon analogique peut être utilisé aussi bien, bien que les derniers endroits d&#39;un nucléotide G supplémentaire sans rapport amont de l&#39;virale 5 &quot;-end, mais queaddition ne modifie pas le pouvoir infectant ou de la réplication de l&#39;ARN de synthèse. 27 En outre, l&#39;enlèvement de la matrice d&#39;ADNc à partir des transcrits d&#39;ARN par la DNase I digestion est pas nécessaire pour les tests ARN infectieux, parce que la matrice d&#39;ADNc lui-même ne sont pas infectieux. 27 La technologie d&#39;alcoolémie a été appliquée à la construction de clones infectieux d&#39;ADNc pour une poignée de virus à ARN brin positif, à savoir, deux JEVs, CNU / LP2 27 et SA 14 -14 à 2 28 (taille du génome, ~ 11 ko); deux virus de la dengue, BR / 90 26 et NGC 29 (~ 11 ko); le virus de la diarrhée virale bovine, SD1 (~ 12 kb); 25 deux classiques virus de la peste porcine, C et Paderborn (~ 12 kb); 24 le virus de la maladie de la frontière, Gifhorn (~ 12 kb); 24 le virus du syndrome dysgénésique et respiratoire , PL97-1 / LP1 (~ 15 kb), 30 le virus de la gastroentérite transmissible, PUR46-MAD (~ 29 kb), 16 le virus de la péritonite infectieuse féline,DF-2 (~ 29 kb); 32 le coronavirus respiratoire aigu sévère de syndrome, Urbani (~ 30 kb); 9 du syndrome respiratoire coronavirus Moyen-Orient, EMC / 2012 (~ 30 kb); 17 et le coronavirus humain, OC43 (~ 31 kb) 31 Le principal avantage de l&#39;utilisation des taux d&#39;alcoolémie pour la construction d&#39;ADNc est la grande stabilité génétique des grands, 1- ou 2-copie plasmides BAC.; Cependant, la nature intrinsèque de son nombre extrêmement faible copie est également un grand désavantage, en raison des très faibles rendements d&#39;ADN BAC et la réduction conséquente de la pureté de l&#39;ADN BAC à l&#39;égard de l&#39;ADN chromosomique hôte. Dans le protocole actuel, le rendement de l&#39;ADN de BAC est maximisée par la croissance E. coli DH10B transformée avec le pBAC infectieuse BAC / SA 14 -14 à 2 dans un milieu riche en nutriments, 2xYT. Malgré cet effort, le rendement moyen est de seulement ~ 15 ug d&#39;ADN BAC à partir de 500 ml de bouillon 2xYT. En outre, la pureté de l&#39;ADN de BAC est mieux réalisée à l&#39;aide de CsCl-EtBr centrifugation en gradient de densité de purification, Plutôt que le plasmide d&#39;isolement utilisée en colonnes. Cependant, il est important de garder à l&#39;esprit que le E. de BAC-transformé coli ne devrait pas proliférer parce que cela pourrait mettre en péril la stabilité génétique de l&#39;ADNc clone, et la croissance plus élevé ne conduit pas nécessairement à des rendements plus élevés ou de l&#39;ADN de BAC plus pureté. Le protocole décrit ici est un optimisé, efficace et méthode simplifiée pour la construction et la propagation d&#39;une pleine longueur d&#39;ADNc clone infectieux génétiquement stable comme un taux d&#39;alcoolémie pour le JEV, une procédure que l&#39;on croyait pratiquement impossible. Cette même stratégie de clonage peut également être appliqué à de nombreux autres virus à ARN à brin positif. En général, les clones infectieux d&#39;ADNc permettent d&#39;introduire une variété de mutations (par exemple, des deletions, insertions et mutations ponctuelles) dans un génome d&#39;ARN viral à l&#39;étude de leurs fonctions biologiques dans la réplication virale et la pathogenèse. Ce système de génétique inverse à base d&#39;ADNc permet de développer et de TESt vaccin et candidats thérapeutiques ciblant un facteur (s) de virulence d&#39;un virus à ARN brin positif d&#39;intérêt particulier. En outre, cette technologie infectieux d&#39;ADNc peut également être utilisé comme un vecteur viral, capable d&#39;exprimer un gène étranger (s) d&#39;intérêt pour de nombreuses applications dans la recherche biomédicale.

Pour virologues d&#39;ARN, l&#39;avènement de la technologie de l&#39;ADN recombinant dans les années 1970 a permis de convertir des génomes d&#39;ARN viraux dans des clones d&#39;ADNc, qui pourrait ensuite être propagées sous forme de plasmides dans des bactéries pour la manipulation génétique des virus à ARN. 1 Le premier virus à ARN soit clonage moléculaire était bactériophage Qß, un virus à ARN brin positif qui infecte Escherichia coli. Un plasmide contenant une copie complète de l&#39;ADNc de l&#39;ARN génomique Qß a donné lieu à des phages infectieux Qß lorsqu&#39;il est introduit dans E. coli. 2 Peu de temps après, cette technique a été appliquée au poliovirus, un virus à ARN brin positif des humains et des animaux. Un plasmide portant un ADNc pleine longueur de l&#39;ARN génomique du poliovirus a été infectieuse quand transfecté dans des cellules de mammifères et capable de produire des virions infectieux 3 Dans cette approche &quot;de l&#39;ADN-lancé&quot;, les ADNc clones devraient être transcrites intracellulaire pour lancer la réplication de l&#39;ARN viral.cependant, il est difficile de savoir comment la transcription est initiée et la façon dont les transcriptions sont traitées à la séquence virale correcte. Cette préoccupation a conduit au développement d&#39;une variante &quot;ARN-lancé&quot; approche, grâce à quoi une copie d&#39;ADNc complète du génome de l&#39;ARN viral est clone sous un promoteur reconnu par une E. coli ou de l&#39;ARN polymérase du phage pour la production d&#39;ARN de synthèse in vitro avec défini 5 &#39;et 3&#39;, qui subissent le cycle complet de la réplication virale lorsqu&#39;il est introduit dans des cellules hôtes. 4,5 Le premier succès avec cette approche a été signalé pour Brome virus de la mosaïque , 6,7 un virus à ARN brin positif de plantes. Depuis lors, l&#39;approche de l&#39;ARN lancé a été développé pour une large gamme de virus à ARN positif, y compris les calicivirus, les alphavirus, flavivirus, arterivirus et les coronavirus. 1,4,5,8 Dans les deux ADN et ARN lancé systèmes de génétique inverse, la construction d&#39;un full-ADNc clone est la clé pour générer l&#39;ADN infectieux ou d&#39;ARN de virus à ARN à brin positif, mais il devient un véritable défi technique que la taille du génome viral augmente. 9-17 En particulier, un grand génome d&#39;ARN de ~ 10 -32 kb présente trois obstacles majeurs à le clonage d&#39;un ADNc fonctionnelle pleine longueur. 18 La première difficulté est la synthèse d&#39;un ADNc fidèles copier, puisque la fidélité de RT-PCR est inversement proportionnelle à la longueur de l&#39;ARN viral. Le second obstacle est la présence de séquences potentiellement toxiques, depuis de longues molécules d&#39;ARN sont plus susceptibles de contenir des séquences imprévues capables de faire le fragment d&#39;ADNc dans des plasmides instables dans E. coli. Le troisième et le plus important problème est la disponibilité d&#39;un vecteur approprié, car il est difficile de trouver un vecteur de clonage qui peut loger un insert d&#39;ADNc viral de&gt; 10 kb. Au cours des trois dernières décennies, ces obstacles ont été surmontés par plusieurs avancées en enzymologie, la méthodologie, und vectorologie. 1,4,5,8 Parmi ceux-ci, le développement le plus prometteur et innovant est le clonage de grands virus à ARN brin positif chromosomes bactériens artificiels comme infectieuses (BAC). Le vecteur BAC est un plasmide à faible copie clonage (1-2 copies / cellule) en fonction du E. coli facteur de fertilité, avec une taille d&#39;insert moyenne d&#39;ADN de ~ 120 à 350 kb de 19 à 21 Un fragment d&#39;ADN est inséré dans le vecteur BAC d&#39;une manière similaire à clonage dans des vecteurs de clonage généraux. les clones BAC résultant sont stables depuis de nombreuses générations dans E. coli. 22,23 À ce jour, la technologie de BAC a été utilisé pour créer des clones d&#39;ADNc infectieux pour&gt; 10 membres de trois familles de virus à ARN brin positif, à savoir, Flaviviridae, 24-29 Arteriviridae, 30 et Coronaviridae. 9,16,17 , 31,32 Utilisant le virus de l&#39;encéphalite japonaise (JEV) comme un exemple, le présent ouvrage présente les procédures détaillées qui peuvent êtreutilisé pour construire une pleine longueur BAC infectieuse génétiquement stable pour une variété de virus à ARN brin positif. JEV est un flavivirus zoonotique 33 qui est transmis dans la nature entre les oiseaux, les porcs, et d&#39;autres hôtes vertébrés par les moustiques vecteurs. 34,35 Chez l&#39;homme, l&#39;infection peut provoquer le JEV grave souvent mortelle maladie neurologique encéphalite japonaise (EJ), 36 qui se produit dans Asie et certaines parties du Pacifique occidental, 37,38 avec une incidence annuelle estimée de ~ 50,000-175,000 cas cliniques. Le génome de 39,40 JEV est un ~ 11 kb, simple brin, molécule d&#39;ARN de sens positif et se compose de un seul cadre de lecture ouvert (ORF) flanqué de deux régions non codantes (DND) aux extrémités 5 &#39;et 3&#39; se termine. 41,42 L&#39;ORF code pour une polyprotéine qui est clivée par des protéases virales et hôte pour générer des 10 protéines individuelles, désigné C, prM, E, NS1, NS2A, NS2B, NS3, NS4A, NS4B et NS5 dans la direction N- à C-terminale. De plus 34,43,44, eXtended forme de NS1 (NS1) est exprimée par -1 déphasage ribosomique au niveau des codons 8-9 de NS2A. 45,46 Sur ces 11 protéines, les trois protéines structurales (C, prM et E) sont indispensables pour la formation des maladies infectieuses 47,48 virions, et les huit autres protéines non structurales (NS1 à NS5, et NS1 &#39;) sont essentiels pour la replication virale de l&#39;ARN, l&#39;assemblage de particules de 49 à 51, 52 à 56 et l&#39;immunité innée évasion. 57-59 Les deux extrémités 5&#39; et 3 «DND contiennent conservées séquences primaires et les structures sous forme d&#39;ARN secondaire / tertiaire, 60-62 qui sont importants pour moduler la réplication de l&#39;ARN viral. 63,64 Ce protocole décrit les outils, les méthodes et les stratégies pour générer une pleine longueur BAC infectieuse de JEV SA 14 -14 à 2. 28 Ce clone BAC fonctionnel contient une copie complète de l&#39;ADNc de l&#39;ARN génomique JEV, 65 qui est entouré par un promoteur pour l&#39;ARN polymérase SP6 en amontde l&#39;extrémité 5 &#39;virale et un site de restriction Xba I unique, en aval de l&#39;extrémité 3&#39; virale pour la transcription in vitro de ruissellement. Cette technologie de BAC est applicable à la construction d&#39;un clone moléculaire d&#39;ADNc entièrement fonctionnelle pour un réseau de virus à ARN à brin positif.

<table border="0" cellpadding="0" cellspacing="0" width="1054">
	<tbody>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">1. Molecular Cloning</td>
			<td style="width:275px;"></td>
			<td style="width:243px;"></td>
			<td style="width:235px;"></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">2xYT Broth</td>
			<td style="width:275px;">Sigma-Aldrich</td>
			<td style="width:243px;">Y2377</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">[3H]UTP</td>
			<td style="width:275px;">PerkinElmer</td>
			<td style="width:243px;">NET380250UC</td>
			<td>Radioactive</td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">50-mL Tube</td>
			<td style="width:275px;">Thermo Scientific (Nalgene)</td>
			<td style="width:243px;">3114-0050</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">250-mL Bottle</td>
			<td style="width:275px;">Beckman Coulter</td>
			<td style="width:243px;">356011</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Agarose</td>
			<td style="width:275px;">Lonza</td>
			<td style="width:243px;">50004</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Agarose (Low Melting Point)</td>
			<td style="width:275px;">Life Technologies (Invitrogen)</td>
			<td style="width:243px;">16520-100</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">AvaI</td>
			<td style="width:275px;">New England BioLabs</td>
			<td style="width:243px;">R0152S</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">AvrII</td>
			<td style="width:275px;">New England BioLabs</td>
			<td style="width:243px;">R0174S</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">BamHI</td>
			<td style="width:275px;">New England BioLabs</td>
			<td style="width:243px;">R0136S</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">BsiWI</td>
			<td style="width:275px;">New England BioLabs</td>
			<td style="width:243px;">R0553S</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">BsrGI</td>
			<td style="width:275px;">New England BioLabs</td>
			<td style="width:243px;">R0575S</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Butanol</td>
			<td style="width:275px;">Fisher Scientific</td>
			<td style="width:243px;">A399-1&#160;</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Cap Analog [m7G(5&#697;)ppp(5&#697;)A]</td>
			<td style="width:275px;">New England BioLabs</td>
			<td style="width:243px;">S1405S</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Cesium Chloride</td>
			<td style="width:275px;">Fisher Scientific</td>
			<td style="width:243px;">BP1595-1</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Chloramphenicol</td>
			<td style="width:275px;">Sigma-Aldrich</td>
			<td style="width:243px;">C0378</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Chloroform</td>
			<td style="width:275px;">Sigma-Aldrich</td>
			<td style="width:243px;">C2432</td>
			<td>Carcinogenic</td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">DE-81 Filter Paper</td>
			<td style="width:275px;">GE Healthcare Life Sciences</td>
			<td style="width:243px;">3658-023</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">dNTP mix</td>
			<td style="width:275px;">Life Technologies (Invitrogen)</td>
			<td style="width:243px;">18427-088</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">E. coli DH10B&#160;</td>
			<td style="width:275px;">Life Technologies (Invitrogen)</td>
			<td style="width:243px;">18297-010</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">EDTA</td>
			<td style="width:275px;">Sigma-Aldrich</td>
			<td style="width:243px;">E5134</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Ethanol&#160;</td>
			<td style="width:275px;">Sigma-Aldrich</td>
			<td style="width:243px;">E7023</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Ethidium Bromide</td>
			<td style="width:275px;">Sigma-Aldrich</td>
			<td style="width:243px;">E7637</td>
			<td>Toxic and highly mutagenic</td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Filter Column (Plasmid Maxiprep Kit)</td>
			<td style="width:275px;">Life Technologies (Invitrogen)</td>
			<td style="width:243px;">K2100-26</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Glacial Acetic Acid</td>
			<td style="width:275px;">Sigma-Aldrich</td>
			<td style="width:243px;">A6283</td>
			<td>Irritating</td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Glucose</td>
			<td style="width:275px;">Sigma-Aldrich</td>
			<td style="width:243px;">G5400</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Glycogen&#160;</td>
			<td style="width:275px;">Roche</td>
			<td style="width:243px;">10901393001</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">High-Fidelity DNA Polymerase</td>
			<td style="width:275px;">New England BioLabs</td>
			<td style="width:243px;">M0491S</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Isoamyl Alcohol</td>
			<td style="width:275px;">Sigma-Aldrich</td>
			<td style="width:243px;">I9392</td>
			<td>Flammable</td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Isopropanol&#160;</td>
			<td style="width:275px;">Amresco</td>
			<td style="width:243px;">0918</td>
			<td>Flammable</td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">LB Broth</td>
			<td style="width:275px;">Life Technologies (Invitrogen)</td>
			<td style="width:243px;">12795-027</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Lithium Chloride</td>
			<td style="width:275px;">Sigma-Aldrich</td>
			<td style="width:243px;">L9650</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Lysozyme</td>
			<td style="width:275px;">Amresco</td>
			<td style="width:243px;">0663</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Magnesium Chloride</td>
			<td style="width:275px;">Sigma-Aldrich</td>
			<td style="width:243px;">M8266</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">M-MLV Reverse Transcriptase</td>
			<td style="width:275px;">Life Technologies (Invitrogen)</td>
			<td style="width:243px;">18080-044</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Mung Bean Nuclease</td>
			<td style="width:275px;">New England BioLabs</td>
			<td style="width:243px;">M0250S</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Needle (18G, 20G)</td>
			<td style="width:275px;">BD</td>
			<td style="width:243px;">305196, 305175</td>
			<td>Biohazardous (Sharps waste)</td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">NotI</td>
			<td style="width:275px;">New England BioLabs</td>
			<td style="width:243px;">R0189S</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Oligonucleotide</td>
			<td style="width:275px;">Integrated DNA Technologies</td>
			<td style="width:243px;">Custom Oligonucleotide Synthesis</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">PacI</td>
			<td style="width:275px;">New England BioLabs</td>
			<td style="width:243px;">R0547S</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">pBeloBAC11</td>
			<td style="width:275px;">New England BioLabs</td>
			<td style="width:243px;">ER2420S (E4154S)</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Phenol (Buffer-Saturated)</td>
			<td style="width:275px;">Life Technologies (Invitrogen)</td>
			<td style="width:243px;">15513-039</td>
			<td>Toxic and highly corrosive</td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Phenol:Chloroform:Isoamyl Alcohol</td>
			<td style="width:275px;">Life Technologies (Invitrogen)</td>
			<td style="width:243px;">15593-031</td>
			<td>Toxic and highly corrosive</td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Phenol:Guanidine Isothiocyanate</td>
			<td style="width:275px;">Life Technologies (Ambion)</td>
			<td style="width:243px;">10296-010</td>
			<td>Toxic, corrosive, and irritating</td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Pme I</td>
			<td style="width:275px;">New England BioLabs</td>
			<td style="width:243px;">R0560S</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Potassium Acetate</td>
			<td style="width:275px;">Amresco</td>
			<td style="width:243px;">0698</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">RNase Inhibitor</td>
			<td style="width:275px;">Life Technologies (Invitrogen)</td>
			<td style="width:243px;">10777-019</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">rNTP Set</td>
			<td style="width:275px;">GE Healthcare Life Sciences</td>
			<td style="width:243px;">27-2025-01</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Sealable Polypropylene Tube (16 &#215; 76 mm)&#160;</td>
			<td style="width:275px;">Beckman Coulter</td>
			<td style="width:243px;">342413</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">SfiI</td>
			<td style="width:275px;">New England BioLabs</td>
			<td style="width:243px;">R0123S</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Sma I</td>
			<td style="width:275px;">New England BioLabs</td>
			<td style="width:243px;">R0141S</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Sodium Acetate</td>
			<td style="width:275px;">Sigma-Aldrich</td>
			<td style="width:243px;">S2889</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Sodium Dodecyl Sulfate</td>
			<td style="width:275px;">Amresco</td>
			<td style="width:243px;">0227</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Sodium Hydroxide</td>
			<td style="width:275px;">Sigma-Aldrich</td>
			<td style="width:243px;">S5881</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">SP6 RNA Polymerase</td>
			<td style="width:275px;">New England BioLabs</td>
			<td style="width:243px;">M0207S</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Spin Column (Plasmid Miniprep Kit)</td>
			<td style="width:275px;">Life Technologies (Invitrogen)</td>
			<td style="width:243px;">K2100-11</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Syringe</td>
			<td style="width:275px;">HSW NORM-JECT</td>
			<td style="width:243px;">4200.000V0</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">T4 DNA Ligase</td>
			<td style="width:275px;">New England BioLabs</td>
			<td style="width:243px;">M0202S</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Tris</td>
			<td style="width:275px;">Amresco</td>
			<td style="width:243px;">0826</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">tRNA (yeast)</td>
			<td style="width:275px;">Life Technologies (Invitrogen)</td>
			<td style="width:243px;">15401-011</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">XbaI&#160;</td>
			<td style="width:275px;">New England BioLabs</td>
			<td style="width:243px;">R0145S</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Name</td>
			<td style="width:275px;">Company</td>
			<td style="width:243px;">Catalog Number</td>
			<td>Comments</td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">2. Cell Culture</td>
			<td style="width:275px;"></td>
			<td style="width:243px;"></td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Alpha Minimal Essential Medium</td>
			<td style="width:275px;">Life Technologies (Gibco)</td>
			<td style="width:243px;">12561-049</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Conical Tube (50 mL)</td>
			<td style="width:275px;">VWR</td>
			<td style="width:243px;">21008-242</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Crystal Violet&#160;</td>
			<td style="width:275px;">Sigma-Aldrich</td>
			<td style="width:243px;">C0775</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Culture Dish (150 mm)&#160;</td>
			<td style="width:275px;">TPP</td>
			<td style="width:243px;">93150&#160;</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Cuvette (2-mm Gap)</td>
			<td style="width:275px;">Harvard Apparatus</td>
			<td style="width:243px;">450125&#160;</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Fetal Bovine Serum&#160;</td>
			<td style="width:275px;">Life Technologies (Gibco)</td>
			<td style="width:243px;">16000-044</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Formaldehyde</td>
			<td style="width:275px;">Sigma-Aldrich</td>
			<td style="width:243px;">F1635</td>
			<td>Toxic and carcinogenic</td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Glutamine</td>
			<td style="width:275px;">Life Technologies (Gibco)</td>
			<td style="width:243px;">25030-081</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Minimal Essential Medium</td>
			<td style="width:275px;">Life Technologies (Gibco)</td>
			<td style="width:243px;">61100-061</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Penicillin/Streptomycin</td>
			<td style="width:275px;">Life Technologies (Gibco)</td>
			<td style="width:243px;">15070-063</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Potassium Chloride</td>
			<td style="width:275px;">Sigma-Aldrich</td>
			<td style="width:243px;">P3911</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Potassium Phosphate Monobasic</td>
			<td style="width:275px;">Sigma-Aldrich</td>
			<td style="width:243px;">P9791</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Six-Well Plate</td>
			<td style="width:275px;">TPP</td>
			<td style="width:243px;">92006</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Sodium Chloride</td>
			<td style="width:275px;">Sigma-Aldrich</td>
			<td style="width:243px;">S3014</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Sodium Phosphate Dibasic</td>
			<td style="width:275px;">Sigma-Aldrich</td>
			<td style="width:243px;">S3264</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Trypsin-EDTA (0.25%)</td>
			<td style="width:275px;">Life Technologies (Gibco)</td>
			<td style="width:243px;">25200-056</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Vitamins</td>
			<td style="width:275px;">Sigma-Aldrich</td>
			<td style="width:243px;">M6895</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Name</td>
			<td style="width:275px;">Company</td>
			<td style="width:243px;">Catalog Number</td>
			<td>Comments</td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">3. Equipment</td>
			<td style="width:275px;"></td>
			<td style="width:243px;"></td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Agarose Gel Electrophoresis System</td>
			<td style="width:275px;">Mupid</td>
			<td style="width:243px;">MPDEXU-01</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">CO2 Incubator</td>
			<td style="width:275px;">Thermo Scientific</td>
			<td style="width:243px;">Heracell 150i</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Desktop Centrifuge&#160;</td>
			<td style="width:275px;">Thermo Scientific</td>
			<td style="width:243px;">ST16R</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Electroporator</td>
			<td style="width:275px;">Harvard Apparatus</td>
			<td style="width:243px;">ECM 830</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Longwave Ultraviolet Lamps (Handheld)</td>
			<td style="width:275px;">UVP</td>
			<td style="width:243px;">UVGL-58</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Tabletop Centrifuge</td>
			<td style="width:275px;">Beckman Coulter</td>
			<td style="width:243px;">368826</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Thermocycler</td>
			<td style="width:275px;">Life Technologies (Applied Biosystems)</td>
			<td style="width:243px;">GeneAmp PCR System 9700</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Vortexer</td>
			<td style="width:275px;">Scientific Industries</td>
			<td style="width:243px;">G-560</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Water Bath</td>
			<td style="width:275px;">Jeio Tech</td>
			<td style="width:243px;">WB-10E</td>
			<td></td>
		</tr>
	</tbody>
</table>

bacterial artificial chromosomes: a functional genomics tool for the study of positive-strand rna viruses

Reverse genetics, an approach to rescue infectious virus entirely from a cloned cDNA, has revolutionized the field of positive-strand RNA viruses, whose genomes have the same polarity as cellular mRNA. The cDNA-based reverse genetics system is a seminal method that enables direct manipulation of the viral genomic RNA, thereby generating recombinant viruses for molecular and genetic studies of both viral RNA elements and gene products in viral replication and pathogenesis. It also provides a valuable platform that allows the development of genetically defined vaccines and viral vectors for the delivery of foreign genes. For many positive-strand RNA viruses such as Japanese encephalitis virus (JEV), however, the cloned cDNAs are unstable, posing a major obstacle to the construction and propagation of the functional cDNA. Here, the present report describes the strategic considerations in creating and amplifying a genetically stable full-length infectious JEV cDNA as a bacterial artificial chromosome (BAC) using the following general experimental procedures: viral RNA isolation, cDNA synthesis, cDNA subcloning and modification, assembly of a full-length cDNA, cDNA linearization, in vitro RNA synthesis, and virus recovery. This protocol provides a general methodology applicable to cloning full-length cDNA for a range of positive-strand RNA viruses, particularly those with a genome of &gt;10 kb in length, into a BAC vector, from which infectious RNAs can be transcribed in vitro with a bacteriophage RNA polymerase.

Pour tous les virus à ARN à brin positif, la fiabilité et l&#39;efficacité d&#39;un système de génétique inverse dépendent de la stabilité génétique d&#39;un ADNc de pleine longueur clone, dont la séquence est équivalent à la séquence consensus de l&#39;ARN génomique viral. 27 La figure 1 représente un cycle à cinq stratégie d&#39;étape pour la construction d&#39;un ADNc infectieux de pleine longueur comme un taux d&#39;alcoolémie pour JEV SA 14 -14 à 2 28: Etape 1, la purification de l&#39;ARN viral à partir du surnageant de culture de cellules de JEV infectés cellules BHK-21 (figure 1A); Etape 2, la synthèse de quatre amplicons d&#39;ADNc se chevauchant (F1 à F4) couvrant l&#39;ensemble du génome viral (figure 1B); Étape 3, le sous-clonage de chacun des quatre fragments d&#39;ADNc contiguës dans un vecteur BAC, créant pBAC / F1 à pBAC / F4 (figure 1C); Étape 4, la modification des ADNc clonés pour la transcription de l&#39;ARN polymerase SP6, soit in vitro ruissellement, plaçant une SP6séquence de promoteur immédiatement en amont de l&#39;viral extrémité 5 &#39;(pBAC / F1 SP6), ce qui élimine une préexistant site Xba I interne au niveau du nucleotide 9131 en introduisant une mutation ponctuelle silencieuse, A 9134 → T (pBAC / F3 KO), et l&#39;insertion, un site run-off nouvelle Xba I artificielle immédiatement en aval de l&#39;extrémité 3 &#39;virale (pBAC / F4 RO) (figure 1D); et l&#39;étape 5, l&#39;assemblage d&#39;une pleine longueur SA 14 -14 à 2 ADNc BAC, pBAC / SA 14 -14 à 2 (figure 1E). Le tableau 1 énumère les oligonucléotides utilisés dans cette procédure de clonage. 28 Pour la construction d&#39;une fonction JEV de l&#39;ADNc, la première étape importante est la synthèse de quatre fragments d&#39;ADNc se chevauchant en utilisant l&#39;ARN viral purifié comme matrice pour la RT-PCR. La figure 2 donne un résultat représentatif pour les quatre produits de RT-PCR qui étaient une électrophorèse sur un 0,8%gel d&#39;agarose. Ce gel démontre clairement que une pleine longueur JEV ADNc est amplifié en quatre fragments d&#39;ADNc se chevauchant. Occasionnellement, les réactions de RT-PCR peuvent produire un ou plusieurs produits spécifiques du virus ou non spécifiques qui sont la plupart du temps inférieure à celle du produit attendu, à cause du recuit des amorces non spécifiques de l&#39;ADNc au cours de la synthèse / amplification. D&#39;autre part, peu ou pas de produit attendu RT-PCR serait amplifié à cause de la contamination accidentelle RNase pendant l&#39;isolement de l&#39;ARN viral ou mauvaise exécution RT-PCR. La prochaine étape clé est le clonage et la modification d&#39;un partial- ou pleine longueur JEV ADNc dans BAC, qui est une procédure relativement simple qui utilise des techniques d&#39;ADN recombinant. 69 La figure 3 présente un résultat représentatif de la purification du clone BAC contenant un ADNc pleine longueur de JEV SA 14 -14 à 2 par bandes dans un gradient de CsCl-EtBr.Dans cette expérience, après centrifugation pendant 16 heures à 401 ​​700 × g, deux bandes distinctes, à savoir, le E. coli ADN chromosomique ci-dessus et le plasmide ADN BAC superenroulée ci-dessous, sont visibles dans le milieu du tube sous la lumière ultraviolette à ondes longues. Un volume minimal (~ 400 ul) de la bande d&#39;ADN de BAC a été soigneusement inférieur recueilli par piquer un trou avec une seringue sur le côté du tube. Par la suite, l&#39;EtBr a été extrait à partir de l&#39;ADN par extraction au BAC butanol, et l&#39;ADN libre de BAC-EtBr a été concentré par précipitation à l&#39;éthanol. La dernière étape est la détermination de l&#39;infectivité spécifique des ARN transcrits in vitro de synthèse de la pleine longueur SA 14 -14 à 2 BAC (pBAC / SA 14 -14 à 2) après transfection d&#39;ARN dans les cellules permissives (Figure 4). Cette étape comporte trois étapes successives: Etape 1, linéarisation de la pleine longueur SA 14 -14 à 2 ADNc à la 3 &#39;-fin du génome viral (figure 4A); Étape 2, la production d&#39;ARN de synthèse de l&#39;ADNc linéarisé par ruissellement transcription (figure 4B); et l&#39;étape 3, le sauvetage des virus recombinants dans les cellules BHK-21 transfectées avec les ARN de synthèse (Figure 4C). Expérimentalement, deux clones indépendants de pBAC / SA 14 -14 à 2 ont été linéarisés avec Xba I digestion et traités avec MBN pour enlever le débord 5 &#39;de quatre de base généré par la digestion Xbal. Les BAC ont été linéarisés nettoyés par extraction au phénol-chloroforme, suivie d&#39;une précipitation à l&#39;éthanol. La linéarisation des deux BACs a été démontrée purifiés sur un gel d&#39;agarose à 0,8% (figure 5A). L&#39;extraction phénol-chloroforme doit être effectuée avec soin pour veiller à ce que les taux d&#39;alcoolémie linéarisées sont RNase-free. Chacun de ces deux limites linéarisées a servi de matrice d&#39;ADNc pour la transcription de ruissellement en utilisant l&#39;ARN polymerase SP6 dans la présence de la m 7 G (5 &#39;) ppp (5&#39;) Un analogue de la PAC. L&#39;intégrité des ARNs synthétiques a été montré en exécutant des parties aliquotes des deux mélanges de réaction de transcription sur un gel d&#39;agarose à 0,6%, avec une référence 1 kb DNA ladder (figure 5B). Dans cet essai simple, la bande majeure d&#39;ARN proéminent toujours migré juste ci-dessous les 3 kb référencer bande d&#39;ADN et semblait être forte. Cependant, l&#39;ARN dégradé aurait un aspect maculé sur le même gel. Un dosage infectieuse de centre est l&#39;étalon-or pour déterminer l&#39;infectivité spécifique des ARN synthétiques. Cette analyse a été effectuée par électroporation cellules BHK-21 avec des échantillons d&#39;ARN, l&#39;ensemencement des aliquotes égales des 10 armoires cellules diluées en série électroporées dans des plaques à 6 puits contenant naïfs cellules BHK-21 (3 x 10 5 cellules / puits), et la superposition d&#39;agarose sur les monocouches de cellules. Après une incubation de 4 jours, les cellules survivantes ont été fixées avec du formaldehyde et colorées avec du cristal violet une solution de quantifier le nombre de centres infectieux (plaques), ce qui correspond au nombre de molécules d&#39;ARN infectieux fournis dans les cellules (Figure 6A). Etant donné que la matrice d&#39;ADNc utilisée pour la transcription in vitro a été démontrée pour être non-infectieux, 27 une portion aliquote du mélange de réaction de transcription a été directement utilisée pour l&#39;électroporation. L&#39;électroporation est la méthode préférée pour la transfection d&#39;ARN; en variante, les ARN peuvent être transfectées par d&#39;autres méthodes utilisant des liposomes DEAE-dextrane et cationiques. L&#39;électroporation d&#39;ARN est très efficace, mais &quot;arc&quot; de l&#39;impulsion électrique se produit rarement, sinon les sels sont présents dans la réaction d&#39;électroporation ou si la cuvette d&#39;électroporation est réutilisé. L&#39;expression des protéines virales dans les cellules transfectées par l&#39;ARN a été examinée par immunofluorescence en utilisant un antisérum de lapin anti-NS1 (figure 6B). La production de particules virales dans les surnageants accumulées de cellules transfectées par l&#39;ARN étaitalyzed par des dosages de plaques (Figure 6C). Les résultats de ces expériences montrent clairement que les ARN synthétiques sont dérivés d&#39;ADNc infectieux dans permissives cellules BHK-21, la génération d&#39;un titre élevé de virus recombinants. <table fo:keep-together.within-page="1"><tbody><tr><td> Oligonucléotide </td><td> Séquence bis (5 &#39;à 3&#39;) </td><td> Position b </td><td> Polarité </td></tr><tr><td> 1RT </td><td> TAGGGATCTGGGCGTTTCTG GCAAAT </td><td> 2578-2603 </td><td> Antisens </td></tr><tr><td> 1F </td><td> aatcccgggAGAAGTTTATC TGTGTGAACTT </td><td> 1-22 </td><td> Sens </td></tr><tr><td> 1R </td><td> attgcggccgcCCACGTCGT TGTGCACGAAGAT </td><td> 2532-2553 </td><td> Antisens </td></tr><tr><td> 2RT </td><td> TTCTGCCTACTCTGCCCCTC CGTTGA </td><td> 5975-6000 </td><td> Fourmije sens </td></tr><tr><td> 2F </td><td> aatcccgggTCAAGCTCAGT GATGTTAACAT </td><td> 1800-1821 </td><td> Sens </td></tr><tr><td> 2R </td><td> attgcggccgcGATGGGTTT CCGAGGATGACTC </td><td> 5929-5950 </td><td> Antisens </td></tr><tr><td> 3RT </td><td> ACGGTCTTTCCTTCTGCTGC AGGTCT </td><td> 9426-9451 </td><td> Antisens </td></tr><tr><td> 3F </td><td> aatcccgggGAGGATACATT GCTACCAAGGT </td><td> 5500-5521 </td><td> Sens </td></tr><tr><td> 3R </td><td> attgcggccgcGTAAGTCAG TTCAATTATGGCT </td><td> 9380-9401 </td><td> Antisens </td></tr><tr><td> 4RT </td><td> AGATCCTGTGTTCTTCCTCA CCACCA </td><td> 10952-10977 </td><td> Antisens </td></tr><tr><td> 4F </td><td> aatcccgggAGTGGAAGGCT CAGGCGTCCAA </td><td> 9200-9221 </td><td> Sens </td></tr><tr><td> 4R </td><td> attgcggccgcAGATCCTGT GTTCTTCCTCACC </td><td> De 10956 à 10977 </td><td> Antisens </td></tr><tr><td> SP6F </td><td> cataccccgcgtattcccac TA </td><td></td><td> Sens </td></tr><tr><td> SP6R </td><td> ACAGATAAACTTCTctatag tgtcccctaaa </td><td> 1-14 </td><td> Antisens </td></tr><tr><td> F1F </td><td> aggggacactatagAGAAGT TTATCTGTGTG </td><td> 1-17 </td><td> Sens </td></tr><tr><td> F1R </td><td> TGGATCATTGCCCATGGTAA GCTTA </td><td> 638-662 </td><td> Antisens </td></tr><tr><td> X1F </td><td> CGAATGGATCGCACAGTGTG GAGAG </td><td> 8403-8427 </td><td> Sens </td></tr><tr><td> X1R </td><td> AAAGCTTCAAACTCAAGATA CCGTGCTCC </td><td> 9120-9148 </td><td> Antisens </td></tr><tr><td> X2F </td><td> GGAGCACGGTATCTTGAGTT TGAAGCTTT </td><td> 9120-9148 </td><td> Sens </td></tr><tr><td> X2R </td><td> cacgtggacgagggcatgcc tgcag </td><td></td><td> Antisens </td></tr><tr><td> ROF </td><td> CCAGGAGGACTGGGTTACCA AAGCC </td><td> 10670-10694 </td><td> Sens </td></tr><tr><td> ROR </td><td> agggcggccgctctagAGAT CCTGTGTTCTTCCTCACCAC </td><td> 10954-10977 </td><td> Antisens </td></tr><tr><td colspan="4"> une des séquences de JEV sont affichés en majuscules, et des séquences BAC sont indiqués en lettres minuscules. position b de nucléotides se réfère à la séquence complète du génome de JEV SA 14 -14 à 2 (numéro d&#39;accession Genbank JN604986). </td></tr></tbody></table> Tableau 1: Oligonucleotides utilisés pour la synthèse d&#39;ADNc, l&#39;amplification par PCR et la mutagenèse BAC. <img alt="Figure 1" src="/files/ftp_upload/53164/53164fig1.jpg" /> Figure 1.0; Stratégie pour la construction d&#39;un ADNc de pleine longueur de JEV SA 14 -14 à 2 comme un taux d&#39;alcoolémie (A) Isolement de l&#39;ARN viral à partir de particules JEV.. Il est représenté un diagramme schématique de l&#39;ARN génomique de JEV SA 14 -14 à 2. (B) Synthèse de quatre fragments d&#39;ADNc se chevauchant (F1 à F4) couvrant l&#39;ensemble du génome viral. (C) Sous-clonage de quatre fragments d&#39;ADNc se chevauchant dans un vecteur BAC, créant pBAC / F1 à pBAC / F4. (D) la modification des ADNc clonés pour la transcription en run-off in vitro. pBAC / F1 SP6 est un dérivé de pBAC / F1 qui contient la séquence du promoteur SP6 en amont de l&#39;extrémité 5 &#39;virale. pBAC / F3 KO est un dérivé de pBAC / F3 qui contient une mutation silencieuse de point (A 9134 → T, astérisque). pBAC / F4 RO est un dérivé de pBAC / F4 qui contient un artificielle site Xba I run-off en aval de l&#39;extrémité 3 &#39;virale. (E </<html> strong&gt;) Assemblée d&#39;une pleine longueur SA 14 -14 à 2 BAC (pBAC / SA 14 -14 à 2). <a href="https://www.jove.com/files/ftp_upload/53164/53164fig1large.jpg" target="_blank">S&#39;il vous plaît cliquer ici pour voir une version plus grande de cette figure.</a> <img alt="Figure 2" src="/files/ftp_upload/53164/53164fig2.jpg" /> Figure 2. Synthèse des quatre fragments d&#39;ADNc se chevauchant (F1 à F4) couvrant l&#39;ARN génomique pleine longueur de JEV SA 14 -14 à 2. Les quatre produits de RT-PCR sont évalués par électrophorèse dans un gel d&#39;agarose à 0,8%. M, 1 ko échelle d&#39;ADN. Les tailles attendues des quatre fragments d&#39;ADNc sont indiqués au bas de l&#39;image du gel. <a href="https://www.jove.com/files/ftp_upload/53164/53164fig2large.jpg" target="_blank">S&#39;il vous plaît cliquez ici pour voir une version plus grande de cette figure.</a> /ftp_upload/53164/53164fig3.jpg &quot;/&gt; Figure 3. Purification de la BAC contenant un ADNc de pleine longueur de JEV SA 14 -14 à 2. Le plasmide d&#39;alcoolémie est isolé de E. coli DH10B par la méthode de la lyse alcaline et SDS-purifié davantage par bandes dans un gradient de CsCl-EtBr. Présenté est un exemple de gradient de CsCl-EtBr l&#39;aide d&#39;un tube en polypropylène refermable 16 × 76 mm. <a href="https://www.jove.com/files/ftp_upload/53164/53164fig3large.jpg" target="_blank">S&#39;il vous plaît cliquez ici pour voir une version plus grande de cette figure.</a> <img alt="Figure 4" src="/files/ftp_upload/53164/53164fig4.jpg" /> Figure 4. Vue d&#39;ensemble de la récupération de virus infectieux d&#39;une pleine longueur JEV SA 14 -14 à 2 ADNc assemblé en un taux d&#39;alcoolémie. (A) de linéarisation de la matrice d&#39;ADNc. La pleine longueur JEV BAC est coupé avecXba I et traité avec MBN. (B) Synthèse des transcrits d&#39;ARN. L&#39;ADNc linéarisé est transcrit par l&#39;ARN polymerase SP6 en présence de la m G 7 (5 &#39;) ppp (5&#39;) Un analogue de coiffe. (C) de récupération de l&#39;JEVs synthétique. Les tests in vitro des ARN transcrits sont transfectées dans des cellules BHK-21 par électroporation, qui génère un titre élevé du virus synthétique. <a href="https://www.jove.com/files/ftp_upload/53164/53164fig4large.jpg" target="_blank">S&#39;il vous plaît cliquer ici pour voir une version plus grande de cette figure.</a> <img alt="Figure 5" src="/files/ftp_upload/53164/53164fig5.jpg" /> Figure 5. Synthèse des ARN par transcription in vitro en utilisant un taux d&#39;alcoolémie JEV pleine longueur comme un modèle d&#39;ADNc. (A) Génération du linéarisé pleine longueur JEV BAC, pBAC / SA 14 -14 à 2. Deux clones indépendants de pBAC/ SA 14 -14 à 2 (Cl.1 et CL.2) sont linéarisés par digestion avec Xba I et le traitement ultérieur avec MBN. Les BAC linéarisées sont examinés par électrophorèse dans un gel d&#39;agarose à 0,8%. (B) la production des ARNs de synthèse par transcription de ruissellement. Chacun de ces deux limites brute est utilisé comme un modèle pour l&#39;ARN polymerase SP6 transcription de ruissellement. Des parties aliquotes des deux réactions de transcription sont passés sur un gel d&#39;agarose à 0,6%. M, 1 kb échelle d&#39;ADN. <a href="https://www.jove.com/files/ftp_upload/53164/53164fig5large.jpg" target="_blank">S&#39;il vous plaît cliquez ici pour voir une version plus grande de cette figure.</a> <img alt="Figure 6" src="/files/ftp_upload/53164/53164fig6.jpg" /> Figure 6. infectivité spécifique des ARN transcrits à partir d&#39;une synthèse JEV BAC pleine longueur et la récupération de virus synthétique. Cellules BHK-21 sont maquette électroporation (Mock) ou électroporation avec les transcrits d&#39;ARN dérivés from chacun des deux clones indépendants de la pleine longueur JEV BAC (Cl.1 et CL.2). (A) ARN infectieux. Les cellules sont recouvertes avec de l&#39;agarose et colorés avec du cristal violet à 4 jours après la transfection. ARN infectieux est déterminée par des essais infectieuses du centre d&#39;estimer la quantité d&#39;ARN infectieuse électroporation dans les cellules (panneau de gauche). En outre, des images représentatives de centres infectieuses sont présentés (panneau de droite). (B) L&#39;expression de protéine. Les cellules sont cultivées dans des glissières de la chambre 4 puits. L&#39;expression des protéines virales dans les cellules de l&#39;ARN par électroporation à 20 h post-transfection (HPT) est analysée par des dosages d&#39;immunofluorescence en utilisant un antisérum de lapin anti-NS1 primaire et un anti-IgG de lapin de chèvre conjugué à Cy3 secondaire (rouge). Les noyaux sont contre-colorées avec 4 &#39;, 6-diamidino-2-phénylindole (bleu). Les images d&#39;immunofluorescence sont superposées sur leurs différentiel correspondant des images à contraste d&#39;interférence. (C) Le rendement viral. Les cellules sont cultivées dans uneDes boîtes de culture de 50 mm. La production de virions infectieux accumulés dans les surnageants de culture de cellules d&#39;ARN-électroporation à 22 et 40 hpt est examiné par des dosages de la plaque. <a href="https://www.jove.com/files/ftp_upload/53164/53164fig6large.jpg" target="_blank">S&#39;il vous plaît cliquez ici pour voir une version plus grande de cette figure.</a>

Watch this Scientific Journal Video about Bacterial Artificial Chromosomes: A Functional Genomics Tool for the Study of Positive-strand RNA Viruses at JoVE.com

Bacterial Artificial Chromosomes: A Functional Genomics Tool for the Study of Positive-strand RNA Viruses

Here, a protocol is presented for creating an infectious bacterial artificial chromosome containing a full-length cDNA of the positive-strand genomic RNA of Japanese encephalitis virus. This protocol can be used to construct a functional cDNA of other positive-strand RNA viruses, making it a powerful genomic tool for studying virus biology.

Bactérienne Artificial Chromosomes: Un outil de génomique fonctionnelle pour l&#39;étude du brin positif de virus à ARN

Reverse genetics, an approach to rescue infectious virus entirely from a cloned cDNA, has revolutionized the field of positive-strand RNA viruses, whose ...

bacterial-artificial-chromosomes-functional-genomics-tool-for-study

Research

JoVE Journal

Immunology and Infection

21.2K vues.  Utah State University. Here, a protocol is presented for creating an infectious bacterial artificial chromosome containing a full-length cDNA of the positive-strand genomic RNA of Japanese encephalitis virus. This protocol can be used to construct a functional cDNA of other positive-strand RNA viruses, making it a powerful genomic tool for studying virus biology.

Vidéo: Bacterial Artificial Chromosomes: A Functional Genomics Tool for the Study of Positive-strand RNA Viruses

Isolation of Fidelity Variants of RNA Viruses and Characterization of Virus Mutation Frequency

RNA viruses use RNA dependent RNA polymerases to replicate their genomes. The intrinsically high error rate of these enzymes is a large contributor to the generation of extreme population diversity that facilitates virus adaptation and evolution. Increasing evidence shows that the intrinsic error rates, and the resulting mutation frequencies, of RNA viruses can be modulated by subtle amino acid changes to the viral polymerase. Although biochemical assays exist for some viral RNA polymerases that permit quantitative measure of incorporation fidelity, here we describe a simple method of measuring mutation frequencies of RNA viruses that has proven to be as accurate as biochemical approaches in identifying fidelity altering mutations. The approach uses conventional virological and sequencing techniques that can be performed in most biology laboratories. Based on our experience with a number of different viruses, we have identified the key steps that must be optimized to increase the likelihood of isolating fidelity variants and generating data of statistical significance. The isolation and characterization of fidelity altering mutations can provide new insights into polymerase structure and function1-3. Furthermore, these fidelity variants can be useful tools in characterizing mechanisms of virus adaptation and evolution4-7.

The present article describes the steps required to isolate and characterize RNA polymerase fidelity variants of RNA viruses and how to use mutation frequency data to confirm fidelity changes in tissue culture.

Isolement des variantes des virus à ARN de Fidelity et caractérisation de la fréquence de mutation de virus

RNA viruses use RNA dependent RNA polymerases to replicate their genomes. The intrinsically high error rate of these enzymes is a large contributor to the ...

Recherche

Immunologie et infection

Separation of Single-stranded DNA, Double-stranded DNA and RNA from an Environmental Viral Community Using Hydroxyapatite Chromatography

Viruses, particularly bacteriophages (phages), are the most numerous biological entities on Earth1,2. Viruses modulate host cell abundance and diversity, contribute to the cycling of nutrients, alter host cell phenotype, and influence the evolution of both host cell and viral communities through the lateral transfer of genes 3. Numerous studies have highlighted the staggering genetic diversity of viruses and their functional potential in a variety of natural environments. 
Metagenomic techniques have been used to study the taxonomic diversity and functional potential of complex viral assemblages whose members contain single-stranded DNA (ssDNA), double-stranded DNA (dsDNA) and RNA genotypes 4-9. Current library construction protocols used to study environmental DNA-containing or RNA-containing viruses require an initial nuclease treatment in order to remove nontargeted templates 10. However, a comprehensive understanding of the collective gene complement of the virus community and virus diversity requires knowledge of all members regardless of genome composition. Fractionation of purified nucleic acid subtypes provides an effective mechanism by which to study viral assemblages without sacrificing a subset of the community&#x2019;s genetic signature. 
Hydroxyapatite, a crystalline form of calcium phosphate, has been employed in the separation of nucleic acids, as well as proteins and microbes, since the 1960s11. By exploiting the charge interaction between the positively-charged Ca2+ ions of the hydroxyapatite and the negatively charged phosphate backbone of the nucleic acid subtypes, it is possible to preferentially elute each nucleic acid subtype independent of the others. We recently employed this strategy to independently fractionate the genomes of ssDNA, dsDNA and RNA-containing viruses in preparation of DNA sequencing 12. Here, we present a method for the fractionation and recovery of ssDNA, dsDNA and RNA viral nucleic acids from mixed viral assemblages using hydroxyapatite chromotography.

We describe an efficient method to separate single-stranded DNA, double-stranded DNA and RNA molecules from environmental viral communities. Nucleic acids are fractionated using hydroxyapatite chromatography with increasing concentrations of phosphate-containing buffers. This method permits the isolation of all viral nucleic acid types from environmental samples.

Séparation de l&#39;ADN simple brin, double brin de l&#39;ADN et l&#39;ARN à partir d&#39;un environnement communautaire viral en utilisant chromatographie d&#39;hydroxyapatite

Viruses, particularly bacteriophages (phages), are the most numerous biological entities on Earth1,2.  Viruses modulate host cell abundance and diversity, ...

Introducing Shear Stress in the Study of Bacterial Adhesion

During bacterial infections a sequence of interactions occur between the pathogen and its host. Bacterial adhesion to the host cell surface is often the initial and determining step of the pathogenesis. Although experimentally adhesion is mostly studied in static conditions adhesion actually takes place in the presence of flowing liquid. First encounters between bacteria and their host often occur at the mucosal level, mouth, lung, gut, eye, etc. where mucus flows along the surface of epithelial cells. Later in infection, pathogens occasionally access the blood circulation causing life-threatening illnesses such as septicemia, sepsis and meningitis. A defining feature of these infections is the ability of these pathogens to interact with endothelial cells in presence of circulating blood. The presence of flowing liquid, mucus or blood for instance, determines adhesion because it generates a mechanical force on the pathogen. To characterize the effect of flowing liquid one usually refers to the notion of shear stress, which is the tangential force exerted per unit area by a fluid moving near a stationary wall, expressed in dynes/cm2. Intensities of shear stress vary widely according to the different vessels type, size, organ, location etc. (0-100 dynes/cm2). Circulation in capillaries can reach very low shear stress values and even temporarily stop during periods ranging between a few seconds to several minutes 1. On the other end of the spectrum shear stress in arterioles can reach 100 dynes/cm2 2. The impact of shear stress on different biological processes has been clearly demonstrated as for instance during the interaction of leukocytes with the endothelium 3. To take into account this mechanical parameter in the process of bacterial adhesion we took advantage of an experimental procedure based on the use of a disposable flow chamber 4. Host cells are grown in the flow chamber and fluorescent bacteria are introduced in the flow controlled by a syringe pump. We initially focused our investigations on the bacterial pathogen Neisseria meningitidis, a Gram-negative bacterium responsible for septicemia and meningitis. The procedure described here allowed us to study the impact of shear stress on the ability of the bacteria to: adhere to cells 1, to proliferate on the cell surface 5and to detach to colonize new sites 6 (Figure 1). Complementary technical information can be found in reference 7. Shear stress values presented here were chosen based on our previous experience1 and to represent values found in the literature. The protocol should be applicable to a wide range of pathogens with specific adjustments depending on the objectives of the study.

During the infection process, a key step is the adhesion of pathogens with host cells. In most instances this adhesion step occurs in the presence of mechanical stress generated by flowing liquid. We describe a technique that introduces shear stress as an important parameter in the study of bacterial adhesion.

Présentation de contrainte de cisaillement dans l&#39;étude de l&#39;adhésion bactérienne

During bacterial infections a sequence of interactions occur between the pathogen and its host. Bacterial adhesion to the host cell surface is often the ...

Isolation and Genome Analysis of Single Virions using 'Single Virus Genomics'

Whole genome amplification and sequencing of single microbial cells enables genomic characterization without the need of cultivation 1-3. Viruses, which are ubiquitous and the most numerous entities on our planet 4 and important in all environments 5, have yet to be revealed via similar approaches. Here we describe an approach for isolating and characterizing the genomes of single virions called 'Single Virus Genomics' (SVG). SVG utilizes flow cytometry to isolate individual viruses and whole genome amplification to obtain high molecular weight genomic DNA (gDNA) that can be used in subsequent sequencing reactions.

Isolation and Genome Analysis of Single Virions using &#039;Single Virus Genomics&#039;

Single Virus Genomics (SVG) is a method to isolate and amplify the genomes of single virons. Viral suspensions of a mixed assemblage are sorted using flow cytometry onto a microscope slide with discrete wells containing agarose, thereby capturing the virion and reducing genome shearing during downstream processing. Whole genome amplification is achieved using multiple displacement amplification (MDA) resulting in genomic material that is suitable for sequencing.

L&#39;isolement et l&#39;analyse du génome des virions unique en utilisant la génomique du virus unique »

Whole genome amplification and sequencing of single microbial cells enables genomic characterization without the need of cultivation 1-3. Viruses, which ...

Establishing a Liquid-covered Culture of Polarized Human Airway Epithelial Calu-3 Cells to Study Host Cell Response to Respiratory Pathogens In vitro

The apical and basolateral surfaces of airway epithelial cells demonstrate directional responses to pathogen exposure in vivo. Thus, ideal in vitro models for examining cellular responses to respiratory pathogens polarize, forming apical and basolateral surfaces. One such model is differentiated normal human bronchial epithelial cells (NHBE). However, this system requires lung tissue samples, expertise isolating and culturing epithelial cells from tissue, and time to generate an air-liquid interface culture.
Calu-3 cells, derived from a human bronchial adenocarcinoma, are an alternative model for examining the response of proximal airway epithelial cells to respiratory insult1, pharmacological compounds2-6, and bacterial7-9 and viral pathogens, including influenza virus, rhinovirus and severe acute respiratory syndrome - associated coronavirus10-14. Recently, we demonstrated that Calu-3 cells are susceptible to respiratory syncytial virus (RSV) infection in a manner consistent with NHBE15,16 . Here, we detail the establishment of a polarized, liquid-covered culture (LCC) of Calu-3 cells, focusing on the technical details of growing and culturing Calu-3 cells, maintaining cells that have been cultured into LCC, and we present the method for performing respiratory virus infection of polarized Calu-3 cells.
To consistently obtain polarized Calu-3 LCC, Calu-3 cells must be carefully subcultured before culturing in Transwell inserts. Calu-3 monolayer cultures should remain below 90% confluence, should be subcultured fewer than 10 times from frozen stock, and should regularly be supplied with fresh medium. Once cultured in Transwells, Calu-3 LCC must be handled with care. Irregular media changes and mechanical or physical disruption of the cell layers or plates negatively impact polarization for several hours or days. Polarization is monitored by evaluating trans-epithelial electrical resistance (TEER) and is verified by evaluating the passive equilibration of sodium fluorescein between the apical and basolateral compartments17,18 . Once TEER plateaus at or above 1,000 &Omega;&times;cm2, Calu-3 LCC are ready to use to examine cellular responses to respiratory pathogens.

Establishing a Liquid-covered Culture of Polarized Human Airway Epithelial Calu-3 Cells to Study Host Cell Response to Respiratory Pathogens In vitro

The findings and conclusions in this report are those of the authors and do not necessarily represent the views of the Centers for Disease Control and Prevention.

L&#39;établissement d&#39;une culture liquide recouvert de Airway humaines épithéliales polarisées cellules Calu-3 pour étudier la réponse cellulaire aux agents pathogènes respiratoires hôte<em&gt; In vitro</em

The  apical and basolateral surfaces of airway epithelial cells demonstrate  directional responses to pathogen exposure in  vivo. Thus, ideal in vitro ...

Following in Real Time the Impact of Pneumococcal Virulence Factors in an Acute Mouse Pneumonia Model Using Bioluminescent Bacteria

Pneumonia is one of the major health care problems in developing and industrialized countries and is associated with considerable morbidity and mortality. Despite advances in knowledge of this illness, the availability of intensive care units (ICU), and the use of potent antimicrobial agents and effective vaccines, the mortality rates remain high1. Streptococcus pneumoniae is the leading pathogen of community-acquired pneumonia (CAP) and one of the most common causes of bacteremia in humans. This pathogen is equipped with an armamentarium of surface-exposed adhesins and virulence factors contributing to pneumonia and invasive pneumococcal disease (IPD). The assessment of the in vivo role of bacterial fitness or virulence factors is of utmost importance to unravel S. pneumoniae pathogenicity mechanisms. Murine models of pneumonia, bacteremia, and meningitis are being used to determine the impact of pneumococcal factors at different stages of the infection. Here we describe a protocol to monitor in real-time pneumococcal dissemination in mice after intranasal or intraperitoneal infections with bioluminescent bacteria. The results show the multiplication and dissemination of pneumococci in the lower respiratory tract and blood, which can be visualized and evaluated using an imaging system and the accompanying analysis software.

Streptococcus pneumoniae is the leading pathogen causing severe community-acquired pneumonia and responsible for over 2&#160;million deaths worldwide. The impact of bacterial factors implicated in fitness or virulence can be monitored in real-time in an acute mouse pneumonia or bacteremia model using bioluminescent bacteria.

Après en temps réel l&#39;impact des facteurs de virulence contre le pneumocoque dans une souris modèle pneumonie aiguë avec bactéries bioluminescentes

Pneumonia is one of the major health care problems in developing and industrialized countries and is associated with considerable morbidity and mortality. ...

High-throughput Screening for Broad-spectrum Chemical Inhibitors of RNA Viruses

RNA viruses are responsible for major human diseases such as flu, bronchitis, dengue, Hepatitis C or measles. They also represent an emerging threat because of increased worldwide exchanges and human populations penetrating more and more natural ecosystems. A good example of such an emerging situation is chikungunya virus epidemics of 2005-2006 in the Indian Ocean. Recent progresses in our understanding of cellular pathways controlling viral replication suggest that compounds targeting host cell functions, rather than the virus itself, could inhibit a large panel of RNA viruses. Some broad-spectrum antiviral compounds have been identified with host target-oriented assays. However, measuring the inhibition of viral replication in cell cultures using reduction of cytopathic effects as a readout still represents a paramount screening strategy. Such functional screens have been greatly improved by the development of recombinant viruses expressing reporter enzymes capable of bioluminescence such as luciferase. In the present report, we detail a high-throughput screening pipeline, which combines recombinant measles and chikungunya viruses with cellular viability assays, to identify compounds with a broad-spectrum antiviral profile.

In vitro assays to measure virus replication have been greatly improved by the development of recombinant RNA viruses expressing luciferase or other enzymes capable of bioluminescence. Here we detail a high-throughput screening pipeline that combines such recombinant strains of measles and chikungunya viruses to isolate broad-spectrum antivirals from chemical libraries.

Criblage à haut débit pour à large spectre inhibiteurs chimiques de l&#39;ARN virus

RNA viruses are responsible for major human diseases such as flu, bronchitis, dengue, Hepatitis C or measles. They also represent an emerging threat ...

Detecting Glycogen in Peripheral Blood Mononuclear Cells with Periodic Acid Schiff Staining

Periodic acid Schiff (PAS) staining is an immunohistochemical technique used on muscle biopsies and as a diagnostic tool for blood samples. Polysaccharides such as glycogen, glycoproteins, and glycolipids stain bright magenta making it easy to enumerate positive and negative cells within the tissue. In muscle cells PAS staining is used to determine the glycogen content in different types of muscle cells, while in blood cell samples PAS staining has been explored as a diagnostic tool for a variety of conditions. Blood contains a proportion of white blood cells that belong to the immune system. The notion that cells of the immune system possess glycogen and use it as an energy source has not been widely explored. Here, we describe an adapted version of the PAS staining protocol that can be applied on peripheral blood mononuclear immune cells from human venous blood. Small cells with PAS-positive granules and larger cells with diffuse PAS staining were observed. Treatment of samples with amylase abrogates these patterns confirming the specificity of the stain. An alternate technique based on enzymatic digestion confirmed the presence and amount of glycogen in the samples. This protocol is useful for hematologists or immunologists studying polysaccharide content in blood-derived lymphocytes.

Periodic acid Schiff staining is a technique that visualizes the polysaccharide content of tissues. This article demonstrates periodic acid Schiff staining protocol adapted for use on peripheral blood mononuclear cells purified from human venous blood. Such samples are enriched for lymphocytes and other white blood cells of the immune system.

Détection glycogène dans les cellules mononucléaires du sang périphérique avec l&#39;acide périodique Schiff coloration

Periodic acid Schiff (PAS) staining is an immunohistochemical technique used on muscle biopsies and as a diagnostic tool for blood samples. ...

Electroporation of Functional Bacterial Effectors into Mammalian Cells

The study of protein interactions in the context of living cells can generate critical information about localization, dynamics, and interacting partners. This information is particularly valuable in the context of host-pathogen interactions. Many pathogen proteins function within host cells in a variety of way such as, enabling evasion of the host immune system and survival within the intracellular environment. To study these pathogen-protein host-cell interactions, several approaches are commonly used, including: in vivo infection with a strain expressing a tagged or mutant protein, or introduction of pathogen genes via transfection or transduction. Each of these approaches has advantages and disadvantages. We sought a means to directly introduce exogenous proteins into cells. Electroporation is commonly used to introduce nucleic acids into cells, but has been more rarely applied to proteins although the biophysical basis is exactly the same. A standard electroporator was used to introduce affinity-tagged bacterial effectors into mammalian cells. Human epithelial and mouse macrophage cells were cultured by traditional methods, detached, and placed in 0.4 cm gap electroporation cuvettes with an exogenous bacterial pathogen protein of interest (e.g. Salmonella Typhimurium GtgE). After electroporation (0.3 kV) and a short (4 hr) recovery period, intracellular protein was verified by fluorescently labeling the protein via its affinity tag and examining spatial and temporal distribution by confocal microscopy. The electroporated protein was also shown to be functional inside the cell and capable of correct subcellular trafficking and protein-protein interaction. While the exogenous proteins tended to accumulate on the surface of the cells, the electroporated samples had large increases in intracellular effector concentration relative to incubation alone. The protocol is simple and fast enough to be done in a parallel fashion, allowing for high-throughput characterization of pathogen proteins in host cells including subcellular targeting and function of virulence proteins.

Electroporation was used to insert purified bacterial virulence effector proteins directly into living eukaryotic cells. Protein localization was monitored by confocal immunofluorescence microscopy. This method allows for studies on trafficking, function, and protein-protein interactions using active exogenous proteins, avoiding the need for heterologous expression in eukaryotic cells.

Électroporation d&#39;effecteurs bactériens fonctionnels dans des cellules mammifères

The study of protein interactions in the context of living cells can generate critical information about localization, dynamics, and interacting partners. ...

Intranasal Administration of Recombinant Influenza Vaccines in Chimeric Mouse Models to Study Mucosal Immunity

Vaccines are one of the greatest achievements of mankind, and have saved millions of lives over the last century. Paradoxically, little is known about the physiological mechanisms that mediate immune responses to vaccines perhaps due to the overall success of vaccination, which has reduced interest into the molecular and physiological mechanisms of vaccine immunity. However, several important human pathogens including influenza virus still pose a challenge for vaccination, and may benefit from immune-based strategies. 
Although influenza reverse genetics has been successfully applied to the generation of live-attenuated influenza vaccines (LAIVs), the addition of molecular tools in vaccine preparations such as tracer components to follow up the kinetics of vaccination in vivo, has not been addressed. In addition, the recent generation of mouse models that allow specific depletion of leukocytes during kinetic studies has opened a window of opportunity to understand the basic immune mechanisms underlying vaccine-elicited protection. Here, we describe how the combination of reverse genetics and chimeric mouse models may help to provide new insights into how vaccines work at physiological and molecular levels, using as example a recombinant, cold-adapted, live-attenuated influenza vaccine (LAIV). We utilized laboratory-generated LAIVs harboring cell tracers as well as competitive bone marrow chimeras (BMCs) to determine the early kinetics of vaccine immunity and the main physiological mechanisms responsible for the initiation of vaccine-specific adaptive immunity. In addition, we show how this technique may facilitate gene function studies in single animals during immune responses to vaccines. We propose that this technique can be applied to improve current prophylactic strategies against pathogens for which urgent medical countermeasures are needed, for example influenza, HIV, Plasmodium, and hemorrhagic fever viruses such as Ebola virus.

There is an overall lack of knowledge about how vaccines work. Here we propose the combined use of reverse genetics and bone marrow chimeric mice to gain insight into the early host immune responses to vaccines with a special focus on dendritic cells and T cell immunity.

Administration intranasale de vaccins contre la grippe recombinant chimérique dans les modèles de souris pour étudier l&#39;immunité muqueuse

Vaccines are one of the greatest achievements of mankind, and have saved millions of lives over the last century. Paradoxically, little is known about the ...