This work was supported by grants from CONACyT-SEP (SEP-2008-84582; CB-2011-01-168497) and Promep-SEP for R.A.G.; P.H. received a scholarship from CONACyT (447442).

1. HFF Culture cellulaire et Ad-infection <ol><li> Propager le virus wt Ad5 dans des monocouches de cellules HEK-293 et que les unités formant titre fluorescentes (FFU) sur les cellules HFF 8 comme décrit précédemment. </li><li> Cultiver des fibroblastes humains (HFF prépuce) dans 10 ml de DMEM / 10% de sérum bovin fœtal (FBS) dans des plats de culture de 100 mm stériles à 37 ° C et 5% de CO2 dans un incubateur humidifié. Déterminer le nombre de cellules en utilisant une chambre de Neubauer en comptant les cellules dans les quatre ensembles de 16 carrés. Le nombre de cellules par ml est obtenue en calculant le nombre moyen de cellules dans les quatre séries de 16 carrés et en multipliant ce nombre par 10 4. Pour chaque post-infection de temps inclus dans l&#39;étape 1.3, utilisez 1 x 10 7 cellules HFF. </li><li> Mock-infecter ou infecter les cellules HFF avec l&#39;adénovirus de type 5 (Ad5) de type sauvage (WT) (H5pg4100 8) dans des boîtes de culture de tissu de 100 mm en utilisant 1 ml de Ad5 dans DMEM par plat à une MOI de 30 focus Unité Formant ou FFU , par cellule. Incuber pendant 2 h en Ahumidified incubateur de culture cellulaire à 37 ° C et 5% de CO 2, à bascule avec soin les plats toutes les 15 minutes afin d&#39;assurer une répartition homogène de l&#39;inoculum de virus sur les cellules. Après ce temps, sortez le moyen et ajoutez DMEM frais complété avec 10% de FBS et incuber pendant 16, 24 ou 36 heures dans un incubateur humidifié de culture de cellules à 37 ° C et 5% de CO 2. Passez à l&#39;étape 2.1. </li></ol> 2. Préparation des fractions de sous-nucléaire Enrichi en adénovirus RC <ol><li> Récolte Ad5-infecté ou cellules HFF pseudo-infectées avec un racloir de cellules et de recueillir les cellules dans des tubes de centrifugeuse stériles. Déterminer le nombre de cellules comme dans l&#39;étape 1.2. Utilisez 1 x 10 7 cellules pour chaque post-infection de temps spécifiée dans l&#39;étape 1.3. </li><li> Centrifuger les cellules à 220 xg, 4 ° C pendant 5 min. </li><li> Remettre en suspension le culot cellulaire dans du PBS glacé (NaCl 137 mM, KCl 2,7 mM, 10 mM de Na 2 HPO 4 et 1,8 mM de KH 2 PO 4). Laver culot cellulaires 3 fois à l&#39;aide de 5 ml de PBS glacé par lavage. A cet effet, centrifuger les cellules à 220 xg, 4 ° C pendant 5 min, décanter et jeter le surnageant (SN), et remettre le culot cellulaire par pipetage doux. </li><li> Pour interrompre la membrane plasmique, remettre en suspension le culot cellulaire dans 700 ul de tampon hypotonique glacé (10 mM de HEPES pH 7,9, 10 mM de KCl, MgCl 1,5 mM de 2, 0,5 mM de DTT, 20 μ g / ml fluorure de phénylméthylsulfonyle (PMSF) un mélange de la cystéine, la sérine, les inhibiteurs de thréonine et aspartyl protéase comprenant 10 μ g / ml inhibiteur de trypsine pancréatique bovine, 10 μ g / ml de pepstatine A et 10 μ g / ml N-acétyl-L-leucyl-L-leucyl-L -argininal) et laisser les cellules gonflent sur la glace pendant 3 heures. </li><li> Lyse des cellules en utilisant un homogénéisateur avec une ample Un pilon type de téflon. Effectuez 80 dounce coups et des échantillons de surveiller chaque 20 coups par microscopie à champ clair pour assurer que toutes les cellules ont été lysées, mais que les noyaux ont not été endommagé ou rompu. </li><li> Centrifuger l&#39;homogénat de cellules à 300 g, 4 ° C pendant 5 min. Rangez la SN que la fraction cytoplasmique à -20 ºC dans un tube de centrifugeuse. </li><li> Pour éliminer les débris cellulaires à partir de noyaux, remettre en suspension le culot dans 750 μ l de solution 1 (S1) (0,25 M de saccharose, 10 mM de MgCl2 à 20 pg / ml PMSF, un mélange de cystéine, la sérine, les inhibiteurs de thréonine et aspartyl proteases, y compris 10 μ g inhibiteur / ml pancréatique bovine par la trypsine, 10 μ g / ml de pepstatine A et 10 μ g / ml N-acétyl-L-leucyl-L-leucyl-L-argininal) et la couche sur un volume égal de solution 2 (S2) (0,35 M de saccharose, mM MgCl 0,5 2, 20 μ g / ml de PMSF, un mélange de cystéine, la sérine, les inhibiteurs de thréonine et aspartyl proteases, y compris 10 μ g / ml inhibiteur de trypsine pancréatique bovine, 10 μ g / ml de pepstatine A et 10 μ g / ml N-acétyl-L-leucyl-L-leucyl-L-argininal). Centrifuge à 1400 xg, 4 ° C pendant 5 min. </li><li> Jeter le SN utilisant une micropipette. Éviter de perturber le culot. </li><li> Remettre en suspension le culot contenant des noyaux isolés dans 750 μ l de S2. </li><li> Pour isoler des fractions subnucléaires enrichis par l&#39;adénovirus RC (RCF), remises en suspension Soniquer noyaux avec un bain à ultrasons, utilisant deux impulsions 5 min, ou jusqu&#39;à ce que tous les noyaux sont lysées comme observé par microscopie à champ clair. Utilisez de la glace dans le bain à ultrasons que nécessaire pour conserver les échantillons à ou inférieure à 4 ° C. </li><li> Couche les noyaux traités aux ultrasons sur un volume égal de solution 3 (S3) (0,88 M de saccharose, 0,5 mM de MgCl2) et centrifuger à 3000 xg, 4 ° C pendant 10 min. Stocker le 1,5 ml surnageant comme la fraction nucléoplasmique (NPL) à -70 ºC. Reprendre le culot dans 700 μ l de S2 et magasin comme RCF à -70 ºC. </li></ol> 3. Les analyses Western Blot de RCF REMARQUE: Pour l&#39;analyse Western Blot de NPL et RCF fractions set côté 640 ul de NPL et 300 μ l pour RCF du volume total obtenu à l&#39;étape 2.11. <ol><li> Mélanger 15 μ l de chaque fraction dans subnucléaire 2x tampon de Laemmli (SDS 4%, 20% de glycerol, 10% 2-mercaptoethanol, 0,004% de bleu de bromophénol, 0,125 M de Tris HCl pH 6,8) et à 95 ° C bouillir pendant 5 min. Charger les échantillons dans une électrophorèse sur gel de dodécyl-sulfate-polyacrylamide de sodium à 10% (SDS-PAGE) et gel dénaturant les protéines séparées pendant 1,5 heure, à 20 milliampères (mA). </li><li> Transfert protéines par électrotransfert pendant 1,5 heure à 400 mA sur polyvinylidène (PVDF) membranes. </li><li> Bloquer membrane pendant 2 heures à la température ambiante en utilisant du lait en poudre écrémé 3% dans PBS. </li><li> Incuber O / N à 4 ° C avec un anticorps primaire contre ADN viral liaison aux protéines E2A (B6-8 9) à une dilution de 1: 500 dans le lait sec PBS / 0,3% sans matières grasses. </li><li> Membrane Laver 3 fois avec du PBS / 0,1% de Tween 20 pendant 10 minutes. </li><li> Incuber la membrane avec un anticorps de souris anti IgG secondairetibody couplé à la peroxydase de raifort (HRP) à une dilution de 1: 10000 dans du PBS pendant 2 heures à température ambiante. </li><li> Laver la membrane 3 fois avec du PBS / 0,1% de Tween 20 pendant 10 minutes. </li><li> Développer la membrane en utilisant chimioluminescence amplifiée et les films X-ray. </li></ol> 4. ADN viral Détection RCF REMARQUE: Pour l&#39;isolement de l&#39;ADN des deux fractions NPL et RCF, utiliser 210 μ l pour Npl et 100 μ l pour RCF du volume total obtenu à l&#39;étape 2.11. <ol><li> Incuber sous-fractions nucléaires pendant 1 heure à 55 ° C avec 1 mg / ml de protéinase K et 0,5% de Tween 20. </li><li> Inactiver la proteinase K en faisant incuber les échantillons pendant 10 min à 95 ° C. </li><li> Centrifuger les échantillons à 20 000 x g, à température ambiante pendant 2 min. </li><li> Recueillir le SN. Précipiter l&#39;ADN avec 1/10 de volume de 3M acétate de sodium et un volume d&#39;isopropanol, O / N à 4 ° C. </li><li> Centrifuger les échantillons à 20 000 x g, à température ambiante pendant 10 min. </li><li> Jeter le u SNchanter une micropipette. Laver le culot avec de l&#39;éthanol 70% et centrifuger à 20 000 xg, 4 ° C pendant 5 min. </li><li> Remettre en suspension l&#39;ADN dans 10 μ l de 10 mM Tris-HCl pH 7,4 </li><li> Quantifier l&#39;ADN en utilisant un spectrophotomètre en mesurant la densité optique (DO) à 260 nm. </li><li> Pour amplifier l&#39;ADN viral, en utilisant 100 ng d&#39;ADN de chaque fraction subnucléaire dans une réaction de PCR standard en utilisant l&#39;ADN polymerase Taq dans 25 μ l de volume de réaction avec des amorces qui permettent l&#39;amplification d&#39;une région à l&#39;intérieur de l&#39;unité de transcription tardif majeur, du nucléotide 7273 de nucléotide 7353 (81 pb) (Fw: GAGCGAGGTGTGGGTGAGC; Rv: GGATGCGACGACACTGACTTCA). Utiliser les conditions suivantes du cycle: la dénaturation initiale pendant 3 min à 95 ° C, suivi par 20 cycles d&#39;amplification (1 min à 95 ° C, recuit pendant 1 min à 62 ° C et l&#39;extension de 30 secondes à 72 ° C) et une étape d&#39;extension finale pour 3 min à 72 ° C. </li><li> Exécutez le produit de PCR dans 2% des gels d&#39;agarose, à 90 V. Stain avec éthidiumbromure à 0,5 μ g / ml concentration finale et visualiser l&#39;ADN pour corroborer l&#39;enrichissement de l&#39;ADN viral dans le RCF. Manipulez le bromure d&#39;éthidium avec une extrême prudence et assurez-vous toujours de porter des gants, que ce composé est un agent mutagène puissant. Eliminer le bromure d&#39;éthidium selon les directives institutionnelles. </li></ol> 5. tardifs viraux ARNm Détection RCF REMARQUE: Pour l&#39;isolement de l&#39;ARN à partir des deux fractions NPL et RCF, utiliser 640 μ l pour Npl et 300 μ l pour RCF du volume total obtenu à l&#39;étape 2.11. <ol><li> Isoler l&#39;ARN à partir des fractions en utilisant subnucléaires Trizol selon les instructions du fabricant. Reprendre l&#39;ARN dans 50 μ l de DEPC (diethilpyrocarbonate) imprégnées d&#39;eau. </li><li> Quantifier l&#39;ARN en utilisant un spectrophotomètre pour mesurer la DO à 260 nm (on obtient environ 3 μ g). Stocker l&#39;ARN dans 50 ng / ul aliquotes à -70 ºC. </li><li> Vérifiez ARN purifiél&#39;absence de contamination de l&#39;ADN en effectuant une réaction de PCR de contrôle en l&#39;absence de transcriptase inverse (RT), en utilisant 5 ng d&#39;ARN total et les conditions de cycle décrites à l&#39;étape 4.9. <ol><li> Si la contamination de l&#39;ADN est absent ne amplicon doit être produite. En cas de contamination de l&#39;ADN est présent, les échantillons incuber avec 10 U de DNase I, 10 U d&#39;inhibiteur de RNase, 0,1 M de Tris-HCl pH 8,3, 0,5 M de KCl et 15 mM de MgCl2 pendant 30 minutes à 37 ° C. Passez à ré-isoler l&#39;ARN comme dans l&#39;étape 5.1. </li></ol></li><li> Pour analyser l&#39;ARNm viral associé aux FCR, amplifier 100 ng d&#39;ARN à partir de chaque fraction subnucléaire par RT-PCR en utilisant des amorces conçues pour détecter l&#39;ARNm tardif adénoviral de différentes familles de gènes (tableau 1). <ol><li> Pour la transcription inverse (RT), en utilisant 100 ng d&#39;ARN, à partir de chaque fraction subnucléaire dans une réaction RT standard en utilisant M-MuLV RT enzyme dans 20 μ l de volume de réaction pendant 1 h à 42 ° C et 10 min à 70 ° C. </li><li> Pour l&#39;amplification, utilisez 1μ l de l&#39;ADNc dans des réactions de PCR, comme à l&#39;étape 4.9. Utiliser les conditions suivantes du cycle: la dénaturation initiale pendant 3 min à 95 ° C, suivi par 25 cycles d&#39;amplification (1 min à 95 ° C, recuit pendant 1 min à la température indiquée dans le tableau 1 et l&#39;extension de 30 secondes à 72 ° C) et une étape d&#39;extension finale pendant 3 min à 72 ° C. </li></ol></li><li> Exécutez les produits de RT-PCR dans 2% des gels d&#39;agarose, à 90 gels V. tache avec du bromure d&#39;éthidium à 0,5 μ g / ml concentration finale et de visualiser à corroborer association virale fin de l&#39;ARNm du RCF. Manipulez le bromure d&#39;éthidium comme indiqué dans l&#39;étape 4.10. </li></ol> 6. immunofluorescence Visualisation de RCF REMARQUE: Carry-out cette procédure sous une hotte à flux laminaire pour éviter la contamination des échantillons avec les particules de poussière, et de filtrer toutes les solutions avant utilisation. <ol><li> Spot 5 ul de la fraction RCF obtenu à l&#39;étape 2.10 désastreusecte sur une lame revêtue de silane. </li><li> Laissez la tache sécher pendant environ 5 min à température ambiante. </li><li> Réhydrater par lentement et indirectement pipetage 500 μ l de PBS dans une goutte à côté de la place RCF et laisser couler en inclinant la diapositive. Égoutter l&#39;excès de PBS sur le côté. </li><li> Bloc en recouvrant l&#39;échantillon avec 500 μ l de PBS / 5% de sérum albumine bovine (BSA) pendant 2 h à température ambiante. </li><li> Laver la lame 3 fois par doucement et indirectement pipetage 500 μ l de PBS sur l&#39;échantillon. Inclinez la glissière pour évacuer l&#39;excès de PBS. </li><li> Incuber l&#39;échantillon avec un anticorps primaire contre E2A liaison à l&#39;ADN viral de protéine (B6-8 9) à une dilution de 1: 500 dans du PBS pendant 2 heures à température ambiante. Couvrir l&#39;échantillon tacheté de 20 μ l de la solution d&#39;anticorps et incuber dans une chambre humide pour éviter le séchage. </li><li> Laver l&#39;échantillon 3 fois avec du PBS / 0,02% de Tween 20 et indirectement par doucement pipetant 500 μ l de PBS sur l&#39;échantillon. Inclinez la glissière pour évacuer l&#39;exsolution de lavage de processus. </li><li> Incuber les échantillons avec un anticorps secondaire anti- IgG de souris couplé à un fluorophore qui est excitée à 488 nm à une dilution de 1: 2000 dans du PBS, pendant 1 heure à 4 ° C. Couvrir l&#39;échantillon tacheté de 20 μ l de la solution d&#39;anticorps et incuber dans une chambre humide pour éviter le séchage. </li><li> Laver l&#39;échantillon 3 fois avec du PBS / 0,02% de Tween 20 et indirectement par doucement pipetant 500 μ l de PBS sur l&#39;échantillon. Inclinez la glissière pour évacuer la solution de lavage en excès. </li><li> Couvrir l&#39;échantillon repéré sur la diapositive avec une lamelle en utilisant 2 μ L PBS / 10% du glycérol comme milieu de montage. Sceller avec du vernis à ongles transparent et al magasin -20 ºC. </li><li> Analyser les échantillons en utilisant un microscope à fluorescence, avec un objectif 63x et un 1.4 Ouverture numérique (NA) à une longueur d&#39;onde de 488 nm. </li></ol>

<ol>
	<li>Doucas, V., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Adenovirus+replication+is+coupled+with+the+dynamic+properties+of+the+PML+nuclear+structure.">Adenovirus replication is coupled with the dynamic properties of the PML nuclear structure.</a> Genes &#38; Dev. 10, 196-207 (1996).</li><li>Schmid, M., Speiseder, T., Dobner, T., Gonzalez, R. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=DNA+virus+replication+compartments.">DNA virus replication compartments.</a> J. Virol. 88, 1404-1420 (2014).</li><li>Boon, J. A., Diaz, A., Ahlquist, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cytoplasmic+viral+replication+complexes.">Cytoplasmic viral replication complexes.</a> Cell host microbe. 8, 77-85 (2010).</li><li>Paul, D., Hoppe, S., Saher, G., Krijnse-Locker, J., Bartenschlager, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Morphological+and+biochemical+characterization+of+the+membranous+hepatitis+C+virus+replication+compartment.">Morphological and biochemical characterization of the membranous hepatitis C virus replication compartment.</a> J. Virol. 87, 10612-10627 (2013).</li><li>Busch, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Isolation+of+Nucleoli.">Isolation of Nucleoli.</a> Exp Cell Res. 24, 150-163 (1963).</li><li>Lam, Y. W., Lyon, C. E., Lamond, A. I. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Large-scale+isolation+of+Cajal+bodies+from+HeLa+cells.">Large-scale isolation of Cajal bodies from HeLa cells.</a> Mol. Biol. Cell. 13, 2461-2473 (2002).</li><li>Lam, Y. W., Trinkle-Mulcahy, L., Lamond, A. I. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+nucleolus.">The nucleolus.</a> J Cell Sci. 118, 1335-1337 (2005).</li><li>Groitl, P., Dobner, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Construction+of+adenovirus+type+5+early+region+1+and+4+virus+mutants.">Construction of adenovirus type 5 early region 1 and 4 virus mutants.</a> Methods Mol Med. 130, 29-39 (2007).</li><li>Reich, N. C., Sarnow, P., Duprey, E., Levine, A. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Monoclonal+antibodies+which+recognize+native+and+denatured+forms+of+the+adenovirus+DNA-binding+protein.">Monoclonal antibodies which recognize native and denatured forms of the adenovirus DNA-binding protein.</a> Virology. 128, 480-484 (1983).</li><li>Leppard, K. N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Selective+effects+on+adenovirus+late+gene+expression+of+deleting+the+E1b+55K+protein.">Selective effects on adenovirus late gene expression of deleting the E1b 55K protein.</a> J Gen Virol. 74 (Pt 4), 575-582 (1993).</li><li>Gonzalez, R., Huang, W., Finnen, R., Bragg, C., Flint, S. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Adenovirus+E1B+55-kilodalton+protein+is+required+for+both+regulation+of+mRNA+export+and+efficient+entry+into+the+late+phase+of+infection+in+normal+human+fibroblasts.">Adenovirus E1B 55-kilodalton protein is required for both regulation of mRNA export and efficient entry into the late phase of infection in normal human fibroblasts.</a> J. Virol. 80, 964-974 (2006).</li><li>Castillo-Villanueva, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+Mre11+Cellular+Protein+Is+Modified+by+Conjugation+of+Both+SUMO-1+and+SUMO-2/3+during+Adenovirus+Infection.">The Mre11 Cellular Protein Is Modified by Conjugation of Both SUMO-1 and SUMO-2/3 during Adenovirus Infection.</a> ISRN Virology. 2014, 14 (2014).</li><li>Morris, S. J., Scott, G. E., Leppard, K. N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Adenovirus+late-phase+infection+is+controlled+by+a+novel+L4+promoter.">Adenovirus late-phase infection is controlled by a novel L4 promoter.</a> J. Virol. 84, 7096-7104 (2010).</li><li>Wright, J., Leppard, K. N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+human+adenovirus+5+L4+promoter+is+activated+by+cellular+stress+response+protein+p53.">The human adenovirus 5 L4 promoter is activated by cellular stress response protein p53.</a> J. Virol. 87, 11617-11625 (2013).</li></ol>

The authors have nothing to disclose.

In order to elucidate the molecular mechanisms that govern regulation of cellular activities by viral infection understanding the composition and activities associated with RC would be instrumental. Therefore, to make a detailed analysis of RC, we established a cell-free system that takes advantage of the size and biochemical composition of these virus-induced structures, to isolate subnuclear fractions enriched with RC using a simple procedure that relies on velocity gradients with sucrose cushions. Critical steps of th...

Les adénovirus contiennent un génome d&#39;ADN double brin qui se réplique dans le noyau de la cellule infectée. Quand l&#39;ADN viral entre dans le noyau, il se localise à proximité de corps nucléaires PML 1. Après l&#39;expression du gène précoce virale, l&#39;architecture nucléaire est considérablement réorganisé, induire la formation de micro-environnements virales, appelées compartiments de la réplication virale (RC) 2. Depuis adénovirus (Ad) RC sont des sites où la réplication du génome viral et l&#39;expression des gènes tardifs viraux ont lieu, ils fournissent un environnement pour le recrutement de tous les facteurs viraux et cellulaires nécessaires qui participent à ces processus. Fait intéressant, une variété de protéines cellulaires responsables de la réponse antivirale cellulaire, tels que la réponse aux dommages de l&#39;ADN, la réponse immunitaire innée et la suppression tumorale sont co-voulu ces sites virales 2. Hubs réglementaires Ainsi, Ad RC peut être considérée comme favorisant la réplication virale efficace tout en régulant de façon concomitante de laréponse antivirale cellulaire, ce qui indique que ces structures jouent un rôle clé pour la compréhension des interactions cellulaires hôte-virus. Néanmoins, les mécanismes moléculaires de la formation RC, leur composition et les activités connexes sont mal comprises. Adénoviral RC, RC ainsi que d&#39;autres virus à ADN qui se répliquent dans le noyau ne sont pas associées à des membranes, par opposition à 3 RC cytoplasmique. De plus, ces structures induites par des virus sont susceptibles d&#39;être entièrement composée de protéines et d&#39;acides nucléiques. RC formé dans les cellules infectées par des virus à ARN (généralement appelé usines virales) ont été isolés, profitant de leur localisation cytoplasmique et le statut lié à la membrane, ce qui a facilité leur morphologique détaillée, la caractérisation fonctionnelle et biochimique 4. À notre connaissance, RC virale nucléaire n&#39;a pas été isolé, peut-être en raison de la complexité de l&#39;architecture nucléaire et l&#39;absence de m intranucléaireembranes qui faciliteraient leur isolement. Leur étude a misé plutôt sur la microscopie par immunofluorescence, FISH et microscopie électronique en transmission. Cependant, malgré les complications inhérentes à isoler les structures subnucléaires, d&#39;autres domaines nucléaires tels que nucléoles et corps de Cajal ont été isolés avant 5,6. Depuis nucléoles et RC sont toutes deux composées de protéines et acides nucléiques, et ont un diamètre compris entre 0,5 - 5 um, nous avons supposé que RC doit aussi se prêter à l&#39;isolement. Par conséquent, afin de caractériser plus précisément la composition moléculaire et les fonctions associées à RC, nous avons établi une nouvelle méthode pour isoler des fractions subnucléaires enrichis en RC. À cette fin, nous avons préparé des fractions de sous-nucléaire en utilisant des gradients de vitesse et des coussins de saccharose similaires aux procédures utilisées pour isoler nucléoles 7 ou d&#39;autres domaines nucléaires 6 et établi un système exempt de cellules qui permet l&#39;étude de la composition moléculaire et activités associésRC. Cette technique devrait donc progresser la compréhension des interactions cellulaires virus-hôte et représente un outil puissant qui devrait également faciliter l&#39;analyse détaillée du RC d&#39;autres virus qui se répliquent dans le noyau et induire la formation de compartiments de réplication de dimensions similaires à celles formées dans adénovirus -cellules infectées, comme les virus de l&#39;herpès, papillomavirus, ou polyomavirus.

<table border="0">
	<tbody>
		<tr>
			<td>DMEM</td>
			<td>Gibco</td>
			<td>12100-046</td>
			<td>Warm in 37 &#186;C water bath before use</td>
		</tr>
		<tr>
			<td>Fetal Bovine Serum</td>
			<td>Gibco</td>
			<td>12484-028</td>
			<td></td>
		</tr>
		<tr>
			<td>Sucrose, Ultra Pure</td>
			<td>Research Organics</td>
			<td>0928S</td>
			<td>Prepare a 2.55 M stock solution and store at 4 &#186;C</td>
		</tr>
		<tr>
			<td>Dounce homogenizer</td>
			<td>Kontess Glass Company</td>
			<td>884900-0000</td>
			<td></td>
		</tr>
		<tr>
			<td>Branson 1800 Ultrasonic Bath</td>
			<td>Branson</td>
			<td>Z769533&#160;SIGMA</td>
			<td>Turn on 15 min before use.</td>
		</tr>
		<tr>
			<td>Peroxidase AffiniPure F(ab&#39;)&#8322; Fragment Goat Anti-Mouse IgG (H+L)</td>
			<td>Jackson ImmunoResearch</td>
			<td>115-036-003</td>
			<td>Use at a 1:10,000 dilution in PBS/0.03% non-fat milk</td>
		</tr>
		<tr>
			<td>Goat anti-Mouse IgG1 Secondary Antibody, Alexa Fluor 488 conjugate</td>
			<td>Life Technologies</td>
			<td>A-21121</td>
			<td>Use at a 1:2,000 dilution in PBS</td>
		</tr>
		<tr>
			<td>Silane-Prep Slides</td>
			<td>Sigma</td>
			<td>S4651-72EA</td>
			<td>Open in a laminar flow cabinet</td>
		</tr>
		<tr>
			<td>SuperSignal West Pico Chemiluminescent Substrate</td>
			<td>Pierce ThermoScientific</td>
			<td>34080</td>
			<td></td>
		</tr>
	</tbody>
</table>

isolation of viral replication compartment-enriched sub-nuclear fractions from adenovirus-infected normal human cells

During infection of human cells by adenovirus (Ad), the host cell nucleus is dramatically reorganized, leading to formation of nuclear microenvironments through the recruitment of viral and cellular proteins to sites occupied by the viral genome. These sites, called replication compartments (RC), can be considered viral-induced nuclear domains where the viral genome is localized and viral and cellular proteins that participate in replication, transcription and post-transcriptional processing are recruited. Moreover, cellular proteins involved in the antiviral response, such as tumor suppressor proteins, DNA damage response (DDR) components and innate immune response factors are also co-opted to RC. Although RC seem to play a crucial role to promote an efficient and productive replication cycle, a detailed analysis of their composition and associated activities has not been made. To facilitate the study of adenoviral RC and potentially those from other DNA viruses that replicate in the cell nucleus, we adapted a simple procedure based on velocity gradients to isolate Ad RC and established a cell-free system amenable to conduct morphological, functional and compositional studies of these virus-induced subnuclear structures, as well as to study their impact on host-cell interactions.

Étant donné que les compartiments de replication virale (RC) sont des structures virales induites subnucléaires composées de protéines et acides nucléiques, similaire à d&#39;autres domaines nucléaires, ils se sont avérés être prête à l&#39;isolement par des gradients de vitesse sur la base des caractéristiques biochimiques. Les étapes critiques dans le protocole de fractionnement sont illustrés dans la Figure 1. A chaque étape les échantillons doivent être surveillé...

Watch this Scientific Journal Video about Isolation of Viral Replication Compartment-enriched Sub-nuclear Fractions from Adenovirus-infected Normal Human Cells at JoVE.com

Isolation of Viral Replication Compartment-enriched Sub-nuclear Fractions from Adenovirus-infected Normal Human Cells

We provide a novel strategy to isolate viral replication compartments (RC) from adenovirus (Ad)-infected human cells. This approach represents a cell-free system that can help to elucidate the molecular mechanisms regulating viral genome replication and expression as well as regulation of viral-host interactions established at the RC.

Isolation des fractions de sous-nucléaire réplication virale Compartiment enrichies d&#39;adénovirus-infectés cellules humaines normales

During infection of human cells by adenovirus (Ad), the host cell nucleus is dramatically reorganized, leading to formation of nuclear microenvironments ...

isolation-viral-replication-compartment-enriched-sub-nuclear

Research

JoVE Journal

Immunology and Infection

8.7K vues.  Universidad Autónoma del Estado de Morelos. We provide a novel strategy to isolate viral replication compartments (RC) from adenovirus (Ad)-infected human cells. This approach represents a cell-free system that can help to elucidate the molecular mechanisms regulating viral genome replication and expression as well as regulation of viral-host interactions established at the RC. 

Vidéo: Isolation of Viral Replication Compartment-enriched Sub-nuclear Fractions from Adenovirus-infected Normal Human Cells

Isolation of Fidelity Variants of RNA Viruses and Characterization of Virus Mutation Frequency

RNA viruses use RNA dependent RNA polymerases to replicate their genomes. The intrinsically high error rate of these enzymes is a large contributor to the generation of extreme population diversity that facilitates virus adaptation and evolution. Increasing evidence shows that the intrinsic error rates, and the resulting mutation frequencies, of RNA viruses can be modulated by subtle amino acid changes to the viral polymerase. Although biochemical assays exist for some viral RNA polymerases that permit quantitative measure of incorporation fidelity, here we describe a simple method of measuring mutation frequencies of RNA viruses that has proven to be as accurate as biochemical approaches in identifying fidelity altering mutations. The approach uses conventional virological and sequencing techniques that can be performed in most biology laboratories. Based on our experience with a number of different viruses, we have identified the key steps that must be optimized to increase the likelihood of isolating fidelity variants and generating data of statistical significance. The isolation and characterization of fidelity altering mutations can provide new insights into polymerase structure and function1-3. Furthermore, these fidelity variants can be useful tools in characterizing mechanisms of virus adaptation and evolution4-7.

The present article describes the steps required to isolate and characterize RNA polymerase fidelity variants of RNA viruses and how to use mutation frequency data to confirm fidelity changes in tissue culture.

Isolement des variantes des virus à ARN de Fidelity et caractérisation de la fréquence de mutation de virus

RNA viruses use RNA dependent RNA polymerases to replicate their genomes. The intrinsically high error rate of these enzymes is a large contributor to the ...

Recherche

Immunologie et infection

Preparation of Viral DNA from Nucleocapsids

Viruses are obligate cellular parasites, and thus the study of their DNA requires isolating viral material away from host cell contaminants and DNA. Several downstream applications require large quantities of pure viral DNA, which is provided by this protocol. These applications include viral genome sequencing, where the removal of host DNA is crucial to optimize data output for viral sequences, and the production of new viral recombinant strains, where co-transfection of purified plasmid and linear viral DNA facilitates recombination.1,2,3 
This procedure utilizes a combination of extractions and density-based centrifugation to isolate purified linear herpesvirus nucleocapsid DNA from infected cells.4,5 The initial purification steps aim to isolate purified viral capsids, which contain and protect the viral DNA during the extractions and centrifugation steps that remove cellular proteins and DNA. Lysis of nucleocapsids then releases viral DNA, and two final phenol-chloroform steps remove remaining proteins. The final DNA captured from solution is highly concentrated and pure, with an average OD260/280 of 1.90. Depending on the quantity of infected cells used, yields of viral DNA range from 150-800 &mu;g or more. The purity of this DNA makes it stable during long-term storage at 4C. This DNA is thus ideally suited for high-throughput sequencing, high fidelity PCR reactions, and transfections. 
Prior to beginning the protocol, it is important to know the average number of cells per dish (e.g. an average of 8 x 106 PK-15 cells in a confluent 15 cm dish), and the titer of the viral stock to be used (e.g. 1 x 108 plaque-forming units per ml). These are necessary to calculate the appropriate multiplicity of infection (MOI) for the protocol.6 For instance, to infect one 15 cm dish of PK-15 cells with the above viral stock, at an MOI of 5, you would use 400 &mu;l of viral stock and dilute it with 3.6 ml of medium (total inoculation volume of 4 ml for one 15 cm plate).
Multiple viral DNA preparations can be prepared at the same time. The number of simultaneous preparations is limited only by the number of tubes held by the ultracentrifuge rotor (one per virus; see step 3.9 below). Here we describe the procedure as though being done for one virus.

We describe the process of isolating high purity herpesvirus nucleocapsid DNA from infected cells. The final DNA captured from solution is of high concentration and purity, making it ideally suited for high-throughput sequencing, high fidelity PCR reactions, and transfections to produce new viral recombinants.

Préparation de l&#39;ADN viral à partir des nucléocapsides

Viruses are obligate cellular parasites, and thus the study of their DNA requires isolating viral material away from host cell contaminants and DNA. ...

Establishing a Liquid-covered Culture of Polarized Human Airway Epithelial Calu-3 Cells to Study Host Cell Response to Respiratory Pathogens In vitro

The apical and basolateral surfaces of airway epithelial cells demonstrate directional responses to pathogen exposure in vivo. Thus, ideal in vitro models for examining cellular responses to respiratory pathogens polarize, forming apical and basolateral surfaces. One such model is differentiated normal human bronchial epithelial cells (NHBE). However, this system requires lung tissue samples, expertise isolating and culturing epithelial cells from tissue, and time to generate an air-liquid interface culture.
Calu-3 cells, derived from a human bronchial adenocarcinoma, are an alternative model for examining the response of proximal airway epithelial cells to respiratory insult1, pharmacological compounds2-6, and bacterial7-9 and viral pathogens, including influenza virus, rhinovirus and severe acute respiratory syndrome - associated coronavirus10-14. Recently, we demonstrated that Calu-3 cells are susceptible to respiratory syncytial virus (RSV) infection in a manner consistent with NHBE15,16 . Here, we detail the establishment of a polarized, liquid-covered culture (LCC) of Calu-3 cells, focusing on the technical details of growing and culturing Calu-3 cells, maintaining cells that have been cultured into LCC, and we present the method for performing respiratory virus infection of polarized Calu-3 cells.
To consistently obtain polarized Calu-3 LCC, Calu-3 cells must be carefully subcultured before culturing in Transwell inserts. Calu-3 monolayer cultures should remain below 90% confluence, should be subcultured fewer than 10 times from frozen stock, and should regularly be supplied with fresh medium. Once cultured in Transwells, Calu-3 LCC must be handled with care. Irregular media changes and mechanical or physical disruption of the cell layers or plates negatively impact polarization for several hours or days. Polarization is monitored by evaluating trans-epithelial electrical resistance (TEER) and is verified by evaluating the passive equilibration of sodium fluorescein between the apical and basolateral compartments17,18 . Once TEER plateaus at or above 1,000 &Omega;&times;cm2, Calu-3 LCC are ready to use to examine cellular responses to respiratory pathogens.

Establishing a Liquid-covered Culture of Polarized Human Airway Epithelial Calu-3 Cells to Study Host Cell Response to Respiratory Pathogens In vitro

The findings and conclusions in this report are those of the authors and do not necessarily represent the views of the Centers for Disease Control and Prevention.

L&#39;établissement d&#39;une culture liquide recouvert de Airway humaines épithéliales polarisées cellules Calu-3 pour étudier la réponse cellulaire aux agents pathogènes respiratoires hôte<em&gt; In vitro</em

The  apical and basolateral surfaces of airway epithelial cells demonstrate  directional responses to pathogen exposure in  vivo. Thus, ideal in vitro ...

Isolation of Myeloid Dendritic Cells and Epithelial Cells from Human Thymus

In this protocol we provide a method to isolate dendritic cells (DC) and epithelial cells (TEC) from the human thymus. DC and TEC are the major antigen presenting cell (APC) types found in a normal thymus and it is well established that they play distinct roles during thymic selection. These cells are localized in distinct microenvironments in the thymus and each APC type makes up only a minor population of cells. To further understand the biology of these cell types, characterization of these cell populations is highly desirable but due to their low frequency, isolation of any of these cell types requires an efficient and reproducible procedure. This protocol details a method to obtain cells suitable for characterization of diverse cellular properties. Thymic tissue is mechanically disrupted and after different steps of enzymatic digestion, the resulting cell suspension is enriched using a Percoll density centrifugation step. For isolation of myeloid DC (CD11c+), cells from the low-density fraction (LDF) are immunoselected by magnetic cell sorting. Enrichment of TEC populations (mTEC, cTEC) is achieved by depletion of hematopoietic (CD45hi) cells from the low-density Percoll cell fraction allowing their subsequent isolation via fluorescence activated cell sorting (FACS) using specific cell markers. The isolated cells can be used for different downstream applications.

This protocol details a method to isolate antigen presenting cells from human thymus via different steps of enzymatic digestion of the tissue followed by density centrifugation of the single cell suspension and finally magnetic and/or FACS sorting of the cell populations of interest.

Isolement des cellules dendritiques myéloïdes et les cellules épithéliales du thymus humain

In this protocol we provide a method to isolate dendritic cells (DC) and epithelial cells (TEC) from the human thymus. DC and TEC are the major antigen ...

Averaging of Viral Envelope Glycoprotein Spikes from Electron Cryotomography Reconstructions using Jsubtomo

Enveloped viruses utilize membrane glycoproteins on their surface to mediate entry into host cells. Three-dimensional structural analysis of these glycoprotein &#8216;spikes&#8217; is often technically challenging but important for understanding viral pathogenesis and in drug design. Here, a protocol is presented for viral spike structure determination through computational averaging of electron cryo-tomography data. Electron cryo-tomography is a technique in electron microscopy used to derive three-dimensional tomographic volume reconstructions, or tomograms, of pleomorphic biological specimens such as membrane viruses in a near-native, frozen-hydrated state. These tomograms reveal structures of interest in three dimensions, albeit at low resolution. Computational averaging of sub-volumes, or sub-tomograms, is necessary to obtain higher resolution detail of repeating structural motifs, such as viral glycoprotein spikes. A detailed computational approach for aligning and averaging sub-tomograms using the Jsubtomo software package is outlined. This approach enables visualization of the structure of viral glycoprotein spikes to a resolution in the range of 20-40 &#197; and study of the study of higher order spike-to-spike interactions on the virion membrane. Typical results are presented for Bunyamwera virus, an enveloped virus from the family Bunyaviridae. This family is a structurally diverse group of pathogens posing a threat to human and animal health.

An approach is presented for determining structures of viral membrane glycoprotein complexes using a combination of electron cryo-tomography and sub-tomogram averaging with the computational package Jsubtomo.

Moyenne de la glycoprotéine d&#39;enveloppe virale Pointes de Electron Cryotomography reconstructions utilisant Jsubtomo

Enveloped viruses utilize membrane glycoproteins on their surface to mediate entry into host cells. Three-dimensional structural analysis of these ...

Isolation of Leukocytes from the Human Maternal-fetal Interface

Pregnancy is characterized by the infiltration of leukocytes in the reproductive tissues and at the maternal-fetal interface (decidua basalis and decidua parietalis). This interface is the anatomical site of contact between maternal and fetal tissues; therefore, it is an immunological site of action during pregnancy. Infiltrating leukocytes at the maternal-fetal interface play a central role in implantation, pregnancy maintenance, and timing of delivery. Therefore, phenotypic and functional characterizations of these leukocytes will provide insight into the mechanisms that lead to&#160;pregnancy disorders. Several protocols have been described in order to isolate infiltrating leukocytes from the decidua basalis and decidua parietalis; however, the lack of consistency in the reagents, enzymes, and times of incubation makes it difficult to compare these results. Described herein is&#160;a novel approach that combines the use of gentle mechanical and enzymatic dissociation techniques to preserve the viability and integrity of extracellular and intracellular markers in leukocytes isolated from the human tissues at the maternal-fetal interface. Aside from immunophenotyping, cell culture, and cell sorting, the future applications of this protocol are numerous and varied. Following this protocol, the isolated leukocytes can be used to determine DNA methylation, expression of target genes, in vitro leukocyte functionality (i.e., phagocytosis, cytotoxicity, T-cell proliferation, and plasticity, etc.), and the production of reactive oxygen species at the maternal-fetal interface. Additionally, using the described protocol, this laboratory has been able to describe new and rare leukocytes at the maternal-fetal interface.

Described herein is a protocol to isolate and further study the infiltrating leukocytes of the decidua basalis and decidua parietalis - the human maternal-fetal interface. This protocol maintains the integrity of cell surface markers and yields enough viable cells for downstream applications as proven by flow cytometry analysis.

Isolement des leucocytes à partir de l&#39;interface humaine materno-fœtale

Pregnancy is characterized by the infiltration of leukocytes in the reproductive tissues and at the maternal-fetal interface (decidua basalis and decidua ...

Isolation of Sertoli Cells and Peritubular Cells from Rat Testes

The testis, and in particular the male gamete, challenges the immune system in a unique way because differentiated sperm first appear at the time of puberty - more than ten years after the establishment of systemic immune tolerance. Spermatogenic cells express a number of proteins that may be seen as non-self by the immune system. The testis must then be able to establish tolerance to these neo-antigens on the one hand but still be able to protect itself from infections and tumor development on the other hand. Therefore the testis is one of a few immune privileged sites in the body that tolerate foreign antigens without evoking a detrimental inflammatory immune response. Sertoli cells play a key role for the maintenance of this immune privileged environment of the testis and also prolong survival of cotransplanted cells in a foreign environment. Therefore primary Sertoli cells are an important tool for studying the immune privilege of the testis that cannot be easily replaced by established cell lines or other cellular models. Here we present a detailed and comprehensive protocol for the isolation of Sertoli cells - and peritubular cells if desired - from rat testes within a single day.

Primary Sertoli cells are required for studying testis-immune privilege, signal transduction during inflammation or infection, and utilization of their immunoprotective properties. Here we describe an enzyme-based protocol for the isolation of highly purified primary Sertoli cells and peritubular cells from rat testes.

Isolement des cellules de Sertoli et péritubulaire cellules de rat Testicules

The testis, and in particular the male gamete, challenges the immune system in a unique way because differentiated sperm first appear at the time of ...

Swab Sampling Method for the Detection of Human Norovirus on Surfaces

Human noroviruses are a leading cause of epidemic and sporadic gastroenteritis worldwide. Because most infections are either spread directly via the person-to-person route or indirectly through environmental surfaces or food, contaminated fomites and inanimate surfaces are important vehicles for the spread of the virus during norovirus outbreaks.
We developed and evaluated a protocol using macrofoam swabs for the detection and typing of human noroviruses from hard surfaces. Compared with fiber-tipped swabs or antistatic wipes, macrofoam swabs allow virus recovery (range 1.2-33.6%) from toilet seat surfaces of up to 700 cm2. The protocol includes steps for the extraction of the virus from the swabs and further concentration of the viral RNA using spin columns. In total, 127 (58.5%) of 217 swab samples that had been collected from surfaces in cruise ships and long-term care facilities where norovirus gastroenteritis had been reported tested positive for GII norovirus by RT-qPCR. Of these 29 (22.8%) could be successfully genotyped. In conclusion, detection of norovirus on environmental surfaces using the protocol we developed may assist in determining the level of environmental contamination during outbreaks as well as detection of virus when clinical samples are not available; it may also facilitate monitoring of effectiveness of remediation strategies.

A macrofoam based sampling methodology was developed and evaluated for the detection and quantification of norovirus on environmental hard surfaces.

Swab Méthode d&#39;échantillonnage pour la détection des norovirus humains sur les surfaces

Human noroviruses are a leading cause of epidemic and sporadic gastroenteritis worldwide. Because most infections are either spread directly via the ...

Isolation of Dendritic Cells from the Human Female Reproductive Tract for Phenotypical and Functional Studies

The characterization of the human dendritic cells (DCs) resident in mucosal tissues is challenging due to the difficulty in obtaining samples, and the low numbers of DCs present per tissue. Yet, as the phenotype and function of DCs is modified by the tissue environment, it is necessary to analyze tissue resident DC populations, since blood derived DCs incompletely reflect the complexities of DCs in tissues. Here we present a protocol to isolate DCs from the human female reproductive tract (FRT) using hysterectomy specimens that allows both phenotypical and functional analyses. The protocol consists of tissue digestion to generate a single cell mixed cell suspension, followed by positive magnetic bead selection. Our tissue digestion protocol does not cleave surface markers, which allows phenotypical and functional analysis of DCs in the steady state, without overnight incubation or cell activation. This protocol can be adapted for the isolation of other immune cell types or isolation of DCs from other tissues.

We describe here a method to isolate and purify dendritic cells from different anatomical compartments in the human female reproductive tract for the evaluation of their phenotypical and functional characteristics. This method can be adapted to isolate other immune cells or dendritic cells from other mucosal tissues.

Isolement de cellules dendritiques de l’appareil reproducteur féminin humain pour des études phénotypiques et fonctionnelles

The characterization of the human dendritic cells (DCs) resident in mucosal tissues is challenging due to the difficulty in obtaining samples, and the low ...

Isolation, Expansion, and Adipogenic Induction of CD34+CD31+ Endothelial Cells from Human Omental and Subcutaneous Adipose Tissue

Obesity is accompanied by an extensive remodeling of adipose tissue primarily via adipocyte hypertrophy. Extreme adipocyte growth results in a poor response to insulin, local hypoxia, and inflammation. By stimulating the differentiation of functional white adipocytes from progenitors, radical hypertrophy of the adipocyte population can be prevented and, consequently, the metabolic health of adipose tissue can be improved along with a reduction of inflammation. Also, by stimulating a differentiation of beige/brown adipocytes, the total body energy expenditure can be increased, resulting in weight loss. This approach could prevent the development of obesity co-morbidities such as type 2 diabetes and cardiovascular disease.
This paper describes the isolation, expansion, and differentiation of white and beige adipocytes from a subset of human adipose tissue endothelial cells that co-express the CD31 and CD34 markers. The method is relatively cheap and is not labor-intensive. It requires access to human adipose tissue and the subcutaneous depot is suitable for sampling. For this protocol, fresh adipose tissue samples from morbidly obese subjects [body mass index (BMI) &#62;35] are collected during bariatric surgery procedures. Using a sequential immunoseparation from the stromal vascular fraction, enough cells are produced from as little as 2&#8211;3 g of fat. These cells can be expanded in culture over 10&#8211;14 days, can be cryopreserved, and retain their adipogenic properties with passaging up to passage 5&#8211;6. The cells are treated for 14 days with an adipogenic cocktail using a combination of human insulin and the PPAR&#947; agonist-rosiglitazone.
This methodology can be used for obtaining proof of concept experiments on molecular mechanisms that drive adipogenic responses in adipose endothelial cells, or for screening new drugs that can enhance the adipogenic response directed either towards white or beige/brown adipocyte differentiation. Using small subcutaneous biopsies, this methodology can be used to screen out non-responder subjects for clinical trials aimed to stimulate beige/brown and white adipocytes for the treatment of obesity and co-morbidities.

The differentiation of white and beige adipocytes from adipose tissue vascular progenitors bears potential for metabolic improvement in obesity. We describe protocols for a CD34+CD31+ endothelial cell isolation from human fat and for a subsequent in vitro expansion and differentiation into white and beige adipocytes. Several downstream applications are discussed.

Isolement, Expansion et adipocytaire Induction de CD34 + CD31 + des cellules endothéliales du tissu adipeux humain épiploïques et sous-cutanée

Obesity is accompanied by an extensive remodeling of adipose tissue primarily via adipocyte hypertrophy. Extreme adipocyte growth results in a poor ...