A subscription to JoVE is required to view this content. Sign in or start your free trial.
Method Article
כאן אנו מציגים עבור בידוד תאי גזע זולה שיניים האנושי והתפשטות פרוטוקול על מנת להעריך את הביטוי חלבון פריאון בתהליך בידול עצביים.
Bioethical נושאים הקשורים המניפולציה של תאי גזע עובריים יש הפריע ההתקדמות בתחום המחקר הרפואי. מסיבה זו, חשוב מאוד לקבל בתאי גזע בוגרים רקמות שונות כמו שומן, חבל הטבור, מח עצם ודם. בין מקורות אפשריים, עיסת שיניים הוא מעניין במיוחד כי זה קל להשיג בגין שיקולים bioethical. אכן, שיניים זולה תאי גזע אנושי (hDPSCs) הם סוג של תאי גזע בוגרים מסוגלים להבדיל תאים עצביים כמו, ניתן להשיג את השן הטוחנת השלישית של מטופלים בריאים (גילאי 13-19). בפרט, הציפה שיניים היה להסיר עם החופר, וחותכים לפרוסות, שטופלו collagenase הרביעי ותרבותית בבקבוקון. כדי לעודד את הבידול עצביים, hDPSCs היו מגורה עם EGF/bFGF 2 שבועות. בעבר, הראו כי במהלך תהליך התמיינות התוכן של פריון הסלולר חלבון (PrPC) hDPSCs מוגבר. הניתוח cytofluorimetric הראה ביטוי מוקדם PrPC זה גדל לאחר תהליך התמיינות עצביים. אבלציה של PrPC על ידי siRNA PrP מנעו בידול עצביים שנגזרות EGF/bFGF. בנייר זה, אנו ממחישים כי כפי שאנחנו משופרת של בידוד, ההפרדה ושיטות במבחנה הטיפוח של hDPSCs עם מספר הליכים קל, יעיל יותר תא שיבוטים היו הרחבת שהושג, בקנה מידה גדול גזע mesenchymal (MSCs) נצפתה. אנו גם מראים hDPSCs, שהושג עם שיטות מפורטות בפרוטוקול, מה שלומך. מדגם ניסיוני מצוינת ללמוד את תהליך התמיינות עצביים של MSCs ותהליכים תאית ומולקולרית עוקבות.
גזע mesenchymal היה מבודד מספר רקמות, כולל מח עצם, דם טבורי, אנושית זולה שיניים, רקמת שומן, דם1,2,3,4,5 , 6. כפי שדווח על ידי מספר סופרים, hDPSCs להראות הדבקות מפלסטיק, מורפולוגיה פיברובלסט דמוי טיפוסי. אלה מייצגים אוכלוסיה הטרוגנית מאוד עם שיבוטים נפרדות וההבדלים המקדימות, המבדילים קיבולת7,8. hDPSCs אקספרס סמנים ספציפי עבור גזע mesenchymal (קרי CD44, CD90, CD73, CD105, כלי קשת-1), הם שליליים עבור כמה סמנים hematopoietic (כגון CD14 ו- CD19), מסוגלים במבחנה בידול multilineage9, 10,11.
מספר סופרים הראו כי תאים אלה הם מסוגלים להבדיל לתוך נוירון כמו תאים באמצעות פרוטוקולים שונים, כולל התוספת של גורם הגדילה העצבי, bFGF, EGF בשילוב עם ספציפי מדיה ותוספי7,12. בנוסף, חלבונים רבים מעורבים בתהליך בידול עצביים ולהראות, בקרב אלו, בכמה עיתונים תפקידים רלוונטיים ושניהם ביטוי משמעותי של חלבון פריאון הסלולר (PrPC), תאי גזע עובריים והוא בוגר13, 14. PrPC מייצג מולקולה pleiotropic המסוגלים לבצע פונקציות שונות בתוך תאים כמו מטבוליזם נחושת, אפופטוזיס, ואת התנגדות חימצוני מתח15,16,17 , 18 , 19 , 20 , 21 , 22.
שלנו הקודם נייר23, חקרנו את התפקיד של PrPC בתהליך בידול עצביים hDPSCs. למעשה, hDPSCs אקספרס precociously PrPC וזה, אחרי בידול עצביים, היה ניתן לצפות להגדלה נוספת. מחברים אחרים שיערו תפקיד אפשרי של PrPC בתהליכים עצביים התמיינות של תאי גזע. אכן, PrPC מניע את הבידול של תאי גזע עובריים לתוך הנוירונים oligodendrocytes להפוך, האסטרוציטים24. מטרתו של מחקר זה היה כדי להדגיש את המתודולוגיה להשגת בתאי גזע של שיניים זולה, תהליך הבידול שלו ואת התפקיד של PrPC במהלך התמיינות עצביים.
השן הטוחנת השלישית השתמשו במחקר היו טוחנות מחולים (בן 13-19 שנים) ללא היסטוריה קודמת של סמים או צריכת אלכוהול, עישון כל ועם היגיינת הפה המתאים. ביום של הסבר, מחלקת המדע לרפואת שיניים, Maxillofacial של "ספיאנצה"-אוניברסיטת רומא, הסכמה מדעת הושג המטופלים או ההורים. הסכמה מדעת הושג בהתבסס על שיקולים אתיים ואישור של ועדת האתיקה.
1. השן והפקת זולה שיניים
2. עיבוד של עיסת שיניים ושחרור תאי גזע
3. תאי גזע התרבות והתפשטות
4. Silencing PrPC ארעי על-ידי siRNA
5. העצבית תהליך אינדוקציה של hDPSCs
6. אפיון של hDPSCs מאת Flow Cytometry
7. הערכת ביטוי PrPC hDPSCs על ידי ניתוח Cytometry זרימה
ההליכים בידוד והפרדה של hDPSCs מ שיניים זולה, המתקבל טוחנת שלישית, הם תהליכים מורכבים בהם שינויים קטנים יכולים להוביל תוצאה הרסניות. בנייר זה, אנו משתמשים בפרוטוקול של ארתור et al. 12 עם מספר שיפורים. ערכה הנציג של נהלים מוצג באיור1.
בעבודה זאת, התמקדנו מתודולוגיה בידוד ובידול עצביים של hDPSCs; יתר על כן, הערכנו את התפקיד של PrPC בתהליך זה. ישנן מספר שיטות כדי לבודד, להבדיל hDPSCs תאים דמויי נוירון, שלבים קריטיים בתהליך. hDPSCs מסוגלים להבדיל ב מספר שושלות כגון chondroblasts, adipocytes, תאי העצם נוירונים. בעיתון שלנו, חקרנו את המנגנונים ...
המחברים אין לחשוף.
עבודה זו נתמכה על ידי "דל'אנג'לו Varrone" ומרכז אוניברסיטה שעונה "סבינה Universitas" כדי וינצ'נצו מאטיי.
איור 5 (A, B) התפרסם בכתב מאת רשות של המפרסם טיילור & פרנסיס בע מ מ: תפקיד של פריון חלבון-EGFR מתחם multimolecular במהלך התמיינות עצביים של שיניים זולה-derived תאי גזע אנושי. Martellucci, ס., Manganelli ו', ג סנטקרוצ'ה, יצור פ, ל' פיקולי, Sorice מ, מאטיי ו' פריון. 2018 Mar 4. טיילור & פרנסיס בע מ
Name | Company | Catalog Number | Comments |
Amphotericin B solution | Sigma-Aldrich | A2942 | It is use to supplement cell culture media, it is a polyene antifungal antibiotic from Streptomyce |
Anti-B3tubulin | Cell Signaling Technology | #4466 | One of six B-tubulin isoform, it is expressed highly during fetal and postnatal development, remaining high in the peripheral nervous system |
Anti-CD105 | BD Biosciences | 611314 | Endoglin (CD105), a major glycoprotein of human vascular endothelium, is a type I integral membrane protein with a large extracellular region, a hydrophobic transmembrane region, and a short cytoplasmic tail |
Anti-CD44 | Millipore | CBL154-20ul | Positive cell markers antibodies directed against mesenchymal stem cells |
Anti-CD73 | Cell Signaling Technology | 13160 | CD73 is a 70 kDa glycosyl phosphatidylinositol-anchored, membrane-bound glycoprotein that catalyzes the hydrolysis of extracellular nucleoside monophosphates into bioactive nucleosides |
Anti-CD90 | Millipore | CBL415-20ul | Positive cell markers antibodies directed against mesenchymal stem cells |
Anti-GAP43 | Cell Signaling Technology | #8945 | Is a nervous system specific, growth-associated protein in growth cones and areas of high plasticity |
Anti-mouse PE | Abcam | ab7003 | Is an antibody used in in flow cytometry or FACS analysis |
Anti-NFH | Cell Signaling Technology | #2836 | Is an antibody that detects endogenous levels of total Neurofilament-H protein |
Anti-PrP mAb EP1802Y | Abcam | ab52604 | Rabbit monoclonal [EP 1802Y] to Prion protein PrP |
Anti-rabbit CY5 | Abcam | ab6564 | Is an antibody used in in flow cytometry or FACS analysis |
Anti-STRO 1 | Millipore | MAB4315-20ul | Positive cell markers antibodies directed against mesenchymal stem cells |
B27 Supp XF CTS | Gibco by life technologies | A14867-01 | B-27 can be used to support induction of human neural stem cells (hNSCs) from pluripotent stem cells (PSCs), expansion of hNSCs, differentiation of hNSCs, and maintenance of mature differentiated neurons in culture |
BD Accuri C6 flow cytometer | BD Biosciences | AC6531180187 | Flow cytometer equipped with a blue laser (488 nm) and a red laser (640 nm) |
BD Accuri C6 Software | BD Biosciences | Controls the BD Accuri C6 flow cytometer system in order to acquire data, generate statistics, and analyze results | |
bFGF | PeproThec, DBA | 100-18B | basic Fibroblast Growth Factor |
Centrifuge CL30R | Termo fisher Scientific | 11210908 | it is a device that is used for the separation of fluids,gas or liquid, based on density |
CO2 Incubator 3541 | Termo fisher Scientific | 317527-185 | it ensures optimal and reproducible growth conditions for cell cultures |
Collagenase, type IV | Life Technologies | 17104019 | Collagenase is a protease that cleaves the bond between a neutral amino acid (X) and glycine in the sequence Pro-X-Glyc-Pro, which is found with high frequency in collagen |
Disposable scalpel | Swann-Morton | 501 | It is use to cut tissues |
DMEM-L | Euroclone | ECM0060L | Dulbecco's Modified Eagle's Medium Low Glucose with L-Glutamine with Sodium Pyruvate |
EGF | PeproThec, DBA | AF-100-15 | Epidermal Growth Factor |
Fetal Bovine Serum | Gibco by life technologies | 10270-106 | FBS is a popular media supplement because it provides a wide array of functions in cell culture. FBS delivers nutrients, growth and attachment factors and protects cells from oxidative damage and apoptosis by mechanisms that are difficult to reproduce in serum-free media (SFM) systems |
Filtropur BT50 0.2,500 mL Bottle top filter | Sarstedt | 831,823,101 | it is a device that is used for filtration of solutions |
Flexitube GeneSolution for PRNP | Qiagen | GS5621 | 4 siRNAs for Entrez gene 5621. Target sequence N.1 TAGAGATTTCATAGCTATTTA N.2 CAGCAAATAACCATTGGTTAA N.3. CTGAATCGTTTCATGTAAGAA N.4 CAGTGACTATGAGGACCGTTA |
Hank's solution 1x | Gibco by life technologies | 240200083 | The essential function of Hanks′ Balanced Salt solution is to maintain pH as well as osmotic balance. It also provides water and essential inorganic ions to cells |
HiPerFect Transfection Reagent | Qiagen | 301705 | HiPerFect Transfection Reagent is a unique blend of cationic and neutral lipids that enables effective siRNA uptake and efficient release of siRNA inside cells, resulting in high gene knockdown even when using low siRNA concentrations |
Neurobasal A | Gibco by life technologies | 10888022 | Neurobasal-A Medium is a basal medium designed for long-term maintenance and maturation of pure post-natal and adult brain neurons |
Paraformaldehyde | Sigma-Aldrich | 30525-89-4 | Paraformaldehyde has been used for fixing of cells and tissue sections during staining procedures |
penicillin/streptomycin | Euroclone | ECB3001D | It is use to supplement cell culture media to control bacterial contamination |
Phosphate buffered saline (PBS) | Euroclone | ECB4004LX10 | PBS is a balanced salt solution used for the handling and culturing of mammalian cells. PBS is used to to irrigate, wash, and dilute mammalian cells. Phosphate buffering maintains the pH in the physiological range |
TC-Platte 6 well, Cell+,F | Sarstedt | 833,920,300 | It is a growth surface for adherent cells |
Tissue culture flask T-25,Cell+,Vented Cap | Sarstedt | 833,910,302 | Tissue culture flask T-25, polystyrene, Cell+ growth surface for sensitive adherent cells, e.g. primary cells, canted neck, ventilation cap, yellow, sterile, Pyrogen-free, non-cytotoxic, 10 pcs./bag |
Triton X-100 | Sigma-Aldrich | 9002-93-1 | Widely used non-ionic surfactant for recovery of membrane components under mild non-denaturing conditions |
Trypsin-EDTA | Euroclone | ECB3052D | Trypsin will cleave peptides on the C-terminal side of lysine and arginine amino acid residues. Trypsin is used to remove adherent cells from a culture surface |
Tube | Sarstedt | 62,554,502 | Tube 15 mL, 120 mm x17 mm, PP |
VBH 36 C2 Compact | Steril | ST-003009000 | Offers totally protection for the enviroment and worker |
ZEISS Axio Vert.A1 – Inverted Microscope | Zeiss | 3849000962 | ZEISS Axio Vert.A1 provides a unique entry level price and can provide all contrasting techniques, including brightfield, phase contrast, PlasDIC, VAREL, improved Hoffman Modulation Contrast (iHMC), DIC and fluorescence. Incorporate LED illumination for gentle imaging for fluorescently-labeled cells. Axio Vert.A1 is ergonomically designed for routine work and compact enough to sit inside tissue culture hoods. |
Request permission to reuse the text or figures of this JoVE article
Request PermissionThis article has been published
Video Coming Soon
Copyright © 2025 MyJoVE Corporation. All rights reserved