Isolation, Propagation, and Prion Protein Expression During Neuronal Differentiation of Human Dental Pulp Stem Cells

Podsumowanie

Here we present a protocol for human Dental Pulp Stem Cells isolation and propagation in order to evaluate the prion protein expression during neuronal differentiation process.

Streszczenie

Bioethical issues related to the manipulation of embryonic stem cells have hindered advances in the field of medical research. For this reason, it is very important to obtain adult stem cells from different tissues such as adipose, umbilical cord, bone marrow and blood. Among the possible sources, dental pulp is particularly interesting because it is easy to obtain in respect of bioethical considerations. Indeed, human Dental Pulp Stem Cells (hDPSCs) are a type of adult stem cells able to differentiate in neuronal-like cells and can be obtained from the third molar of healthy patients (13-19 ages). In particular, the dental pulp was removed with an excavator, cut into small slices, treated with collagenase IV and cultured in a flask. To induce the neuronal differentiation, hDPSCs were stimulated with EGF/bFGF for 2 weeks. Previously, we have demonstrated that during the differentiation process the content of cellular prion Protein (PrP^C) in hDPSCs increased. The cytofluorimetric analysis showed an early expression of PrP^C that increased after neuronal differentiation process. Ablation of PrP^C by siRNA PrP prevented neuronal differentiation induced by EGF/bFGF. In this paper, we illustrate that as we enhanced the isolation, separation and in vitro cultivation methods of hDPSCs with several easy procedures, more efficient cell clones were obtained and large-scale expansion of the mesenchymal stem cells (MSCs) was observed. We also show how the hDPSCs, obtained with methods detailed in the protocol, are an excellent experimental model to study the neuronal differentiation process of MSCs and subsequent cellular and molecular processes.

Wprowadzenie

Mesenchymal stem cells have been isolated from several tissues, including bone marrow, umbilical cord blood, human dental pulp, adipose tissue, and blood^1,2,3,4,5,6. As reported by several authors, hDPSCs show plastic adherence, a typical fibroblast-like morphology. These represent a highly heterogeneous population with distinct clones and differences in proliferative and differentiating capacity^7,8. hDPSCs express specific markers for mesenchymal stem cells (i.e. CD44, CD90, CD73, CD105, STRO-1), they are negative for some hematopoietic markers (such as CD14 and CD19) and are capable of in vitro multilineage differentiation^9,10,11.

Several authors have shown that these cells are able to differentiate into neuron-like cells using different protocols, that include the addition of NGF, bFGF, EGF in combination with the specific media and supplements^7,12. Also, many proteins are involved during neuronal differentiation process and, among these, several papers show a relevant role and significant expression of cellular prion protein (PrP^C), both in embryonic and adult stem cells^13,14. PrP^C represents a pleiotropic molecule capable of performing different functions inside cells as copper metabolism, apoptosis, and resistance to oxidative stress^{15,16,17,18,19,20,21,22}.

In our previous paper²³, we investigated the role of PrP^C in the hDPSCs neuronal differentiation process. In fact, hDPSCs express precociously PrP^C and, after neuronal differentiation, it was possible to observe an additional increase. Other authors hypothesized a possible role of PrP^C in neuronal differentiation processes of stem cells. Indeed, PrP^C drives the differentiation of human embryonic stem cells into neurons, oligodendrocytes, and astrocytes²⁴. The purpose of this study was to emphasize the methodology for obtaining stem cells from dental pulp, its differentiation process and the role of PrP^C during neuronal differentiation.

Access restricted. Please log in or start a trial to view this content.

Protokół

Third molars used in the study were excised from patients (13-19 years old) with no prior history of drug or alcohol consumption, all non-smoking and with appropriate oral hygiene. On the day of explanation, at the Department of Science Dentistry and Maxillofacial of "Sapienza" University of Rome, informed consent was obtained from the patients or the parents. Informed consent was obtained based on ethical considerations and approval of the ethics committee.

1. Tooth and Dental Pulp Extraction

1. Preparation of appropriate medium for the conservation or transportation.
   1. Prepare Dulbecco's Modified Eagle's medium low concentration of glucose (DMEM-L) with L-glutamine (494.5 mL).
   2. Add 5 mL of penicillin/streptomycin (1%) and 0.5 mL of amphotericin (0.1%).
2. Extract the third molar from the patient, quickly rinse it with PBS, put in a 15 mL test tube with the medium and transfer it to the laboratory in less than 2 h.
3. Under a biohazard hood, open the tooth with a cutter by coronal cutting pass parallel and tangent through the roof of the pulp chamber.
4. Gently remove the pulp with a small excavator and place it in a test tube.
5. Wash with PBS three times and centrifuge at 2,500 x g for 10 min at RT.

2. Processing of the Dental Pulp and Stem Cell Release

1. Remove the supernatant, resuspend the pellet in Hank's solution and place it in a Petri dish. Incubate for 2 h at 37 °C in 5% CO₂.
2. Type IV collagenase solution preparation.
   1. Prepare 0.8 mL of DMEM-L.
   2. Melt 1 mg of type IV collagenase in 0.8 mL of DMEM-L and vortex for several min.
   3. Add DMEM-L up to 1 mL to have a final concentration 1 mg/mL.
   4. Filter the solution with a 0.22 µM filter.
3. Remove Hank's solution by centrifugation at 2,500 x g for 10 min at RT and divide the pulp into small slices approximatively 1 mm each one with a disposable scalpel.
4. Place the pulp slices in a petri dish and incubate with 1 mL of type IV collagenase for 15 min at 37 °C in 5% CO₂.
5. Medium culture preparation (500 mL).
   1. To 445 mL of DMEM-L with L-glutamine.
   2. Add 50 mL of Fetal Bovine Serum (FBS) (10%).
   3. Add 5 mL of penicillin/streptomycin (1%).
6. Centrifuge the sample at 2,500 x g for 10 min at RT, remove the supernatant, resuspend the pellet in the medium (step 2.5) and culture in T25 flask specific for stem cell at 37 °C in 5% CO₂.

3. Stem Cell Culture and Propagation

1. Every day check the culture and, after 3 days of growth, observe different clones of adherent cells within the flask.
2. Every 3 days change the culture medium.
3. Between 7 and 12 days, once the adherent cells have reach confluence, detach them by treating the cells with 1 mL of trypsin-EDTA for 3 min at 37 °C or gently using a cell scraper.
4. Add 4 ml (ratio 1:5) of the culture medium (step 2.5) to stop trypsin action.
5. Centrifuge the cell suspension for 6 min at 259 x g, remove the supernatant and place the cells in a T25 flask to propagate.
   NOTE: Every 3 days the cells reach confluence.
6. Propagate the cells up to 21 or 28 days (approximately 6-8 passages) to avoid the presence of non-stem like cells in the culture.
7. Detach the cells with 1 mL of trypsin-EDTA for 3 min at 37 °C or gently scraping. Centrifuge the cell suspension for 6 min at 259 x g.
8. Remove the supernatant and test the cells for cytofluorimetric analysis (step 6).

4. Transient PrP^C Silencing by siRNA

1. Culture the hDPSCsin 6-well plates (2 x 10⁵ cell/mL) with 2 mL of culture medium (step 2.5) for 24 h.
2. The day after, prepare siRNA PrP medium (400 µL).
   1. To a sterile test tube, add 384 µL DMEM-L.
   2. Add 1 µL for each type of siRNA PrP to DMEM-L to have a final concentration of 5 nM (4 siRNA PrP were used and verified by the supplier to guarantee a knockdown efficiency ≥70%).
   3. Add 12 µL of transfectionreagent to DMEM-L.
   4. Vortex the mixture and incubate for 10 min at RT to allow the formation of transfection complexes.
3. Add 400 μL of siRNA PrP medium to each sample and incubate for 6 h at 37 °C.
4. Without discarding siRNA PrP medium, add 1.6 mL (ratio of 1 to 5) of culture medium (step 2.5).
5. Leave the cells for 72 h at 37 °C.
6. Remove the supernatant and wash 3 times with 2 mL of PBS at RT.
7. Add 2 mL of neuronal culture medium for 7 and/or 14 days (step 5.1).
8. Change the neuronal culture medium every 3 days.
   NOTE: Replace the siRNA PrP solution each time replace the neuronal culture medium.
9. At end of the time, wash 3 times with 2 mL of PBS at RT and test for neuronal surface antigens by Western Blot analysis.

5. Neuronal Induction Process of hDPSCs

1. Neuronal culture medium preparation (500 mL).
   1. Prepare 444.7 mL of basal media formulated to neuronal cells.
   2. To the medium add 50 mL of serum-free supplement used for supporting the long-term viability of embryonic and adult neuronal stem cells (10%).
   3. Add 200 µL of basic Fibroblast Growth Factor (bFGF) (final concentration 40 ng/mL) and 100 µL of Epidermal Growth Factor (EGF) to the medium (final concentration 20 ng/mL).
   4. Add 5 mL of penicillin/streptomycin (1%) to the medium.
2. Culture hDPSCs in 6-well plates (2 x 10⁵ cell/mL) up to 28 days from the pulp separation and stimulate them with 2 mL of neuronal culture medium.
3. Every 3 days discard the supernatant, wash 3 times with 2 mL of PBS at RT and replace 2 mL of the neuronal culture medium.
4. After 7 and/or 14 days, detach the cells with 1 mL of trypsin-EDTA for 3 min at 37 °C or gently with a scraper.
5. Add 4 mL (ratio 1:5) of culture medium (step 2.5) to stop trypsin action.
6. Test for the presence of neuronal surface antigens (step 6) or prion protein expression (step 7) by flow cytometry analysis.

6. Characterization of hDPSCs by Flow Cytometry

1. Select mesenchymal stromal (MSC)-specific or neuronal surface antigens.
2. Culture the hDPSCs in 6-well plates (2 x 10⁵ cell/mL) with 2 mL of culture medium (step 2.5).
3. Detach hDPSCs at 28 days from dental pulp separation or after 14 days of neuronal culture medium (step 5.1) with 1 mL of trypsin-EDTA for 3 min at 37 °C or gently scraper.
4. add 4 ml (ratio 1:5) of culture medium (step 2.5) to stop trypsin action and centrifugate at 259 x g for 6 min at RT. Wash another 2 times with 2 mL of PBS at RT.
5. Fix the untreated or treated hDPSCs with 4% paraformaldehyde in PBS for 10 min at 4 °C.
6. Permeabilize hDPSCS with 0.1% (v/v) non-ionic surfactant in PBS for additional 10 min at RT.
7. Perform the blocking with 5% nonfat dried milk in 1 mL of PBS for 1 h at RT.
8. Wash 3 times with 1 mL of PBS and incubate the cells with anti-CD105 (1:100/5 x 10⁵ cells), anti-CD44 (1:100/5 x 10⁵ cells), anti-STRO-1 (1:100/5 x 10⁵ cells), anti-CD90 (1:100/5 x 10⁵ cells), anti-CD73 (1:100/5 x 10⁵ cells), anti β3-Tubulin (1:100/5 x 10⁵ cells), anti-NFH (1:100/5 x 10⁵ cells) and anti-GAP43 (1:100/5 x 10⁵ cells) mAb for 1 h at RT.
9. Wash the cells 3 times with 1 mL of PBS and incubate with anti-mouse PE (1:50/5 x 10⁵ cells) or anti-rabbit CY5 (1:50/5 x 10⁵ cells) mAb for additional 1 h at RT.
10. Use the secondary antibodies for gating the immunopositive cells (anti-mouse PE or anti-rabbit CY5 mAb) and analyze all samples with a Flow cytometer and acquire at least 20,000 events.

7. Evaluation of PrP^C Expression in hDPSCs by Flow Cytometry Analysis

1. Culture the hDPSCsin 6-well plates (2 x 10⁵ cell/mL) with 2 mL of culture medium (step 2.5).
2. Detach hDPSCs at 21 and 28 days from dental pulp separation and after 7 and/or 14 days with neuronal culture medium (step 5.1) with 1 mL of trypsin-EDTA and stop the trypsin action as described in step 6.4. Fix the specimens with 4% paraformaldehyde in PBS for 10 min at 4 °C.
3. Permeabilize with 0.1% (v/v) non-ionic surfactantin PBS for 10 min at RT. Remove the supernatant and stain the cells with rabbit anti-PrP mAb EP1802Y (1:50/5 x 10⁵ cells) mAb for 1 h at RT. Incubate with anti-rabbit CY5 (1:50/5 x 10⁵ cells) mAb for additional 1 h at RT.
4. Analyze all samples with a Flow cytometer and acquire at least 20,000 events.

Access restricted. Please log in or start a trial to view this content.

Wyniki

The isolation and separation procedures of hDPSCs from dental pulp, obtained from the third molar, are complex processes in which small changes can lead a ruinous result. In this paper, we use the protocol of Arthur et al.¹² with several improvements. A representative scheme of procedures is shown in Figure 1.

hDPSCs represents a heterogeneous population of cells wit...

Access restricted. Please log in or start a trial to view this content.

Dyskusje

In this work, we focused on methodology for isolation and neuronal differentiation of hDPSCs; moreover, we evaluated the role of PrP^C in this process. There are several methods to isolate and differentiate hDPSCs in neuron-like cells and critical steps during the process. hDPSCs are able to differentiate in several lineages such as chondroblasts, adipocytes, osteoblasts, and neurons. In our paper, we investigated the mechanisms of neuronal differentiation and the presence of PrP^C. As discussed above...

Access restricted. Please log in or start a trial to view this content.

Materiały

Name	Company	Catalog Number	Comments
Amphotericin B solution	Sigma-Aldrich	A2942	It is use to supplement cell culture media, it is a polyene antifungal antibiotic from Streptomyce
Anti-B3tubulin	Cell Signaling Technology	#4466	One of six B-tubulin isoform, it is expressed highly during fetal and postnatal development, remaining high in the peripheral nervous system
Anti-CD105	BD Biosciences	611314	Endoglin (CD105), a major glycoprotein of human vascular endothelium, is a type I integral membrane protein with a large extracellular region, a hydrophobic transmembrane region, and a short cytoplasmic tail
Anti-CD44	Millipore	CBL154-20ul	Positive cell markers antibodies directed against mesenchymal stem cells
Anti-CD73	Cell Signaling Technology	13160	CD73 is a 70 kDa glycosyl phosphatidylinositol-anchored, membrane-bound glycoprotein that catalyzes the hydrolysis of extracellular nucleoside monophosphates into bioactive nucleosides
Anti-CD90	Millipore	CBL415-20ul	Positive cell markers antibodies directed against mesenchymal stem cells
Anti-GAP43	Cell Signaling Technology	#8945	Is a nervous system specific, growth-associated protein in growth cones and areas of high plasticity
Anti-mouse PE	Abcam	ab7003	Is an antibody used in in flow cytometry or FACS analysis
Anti-NFH	Cell Signaling Technology	#2836	Is an antibody that detects endogenous levels of total Neurofilament-H protein
Anti-PrP mAb EP1802Y	Abcam	ab52604	Rabbit monoclonal [EP 1802Y] to Prion protein PrP
Anti-rabbit CY5	Abcam	ab6564	Is an antibody used in in flow cytometry or FACS analysis
Anti-STRO 1	Millipore	MAB4315-20ul	Positive cell markers antibodies directed against mesenchymal stem cells
B27 Supp XF CTS	Gibco by life technologies	A14867-01	B-27  can be used to support induction of human neural stem cells (hNSCs) from pluripotent stem cells (PSCs), expansion of hNSCs, differentiation of hNSCs, and maintenance of mature differentiated neurons in culture
BD Accuri C6 flow cytometer	BD Biosciences	AC6531180187	Flow cytometer equipped with a blue laser (488 nm) and a red laser (640 nm)
BD Accuri C6 Software	BD Biosciences		Controls the BD Accuri C6 flow cytometer system in order to acquire data, generate statistics, and analyze results
bFGF	PeproThec, DBA	100-18B	basic Fibroblast Growth Factor
Centrifuge CL30R	Termo fisher Scientific	11210908	it is a device that is used for the separation of fluids,gas or liquid, based on density
CO2 Incubator 3541	Termo fisher Scientific	317527-185	it ensures optimal and reproducible growth conditions for cell cultures
Collagenase, type IV	Life Technologies	17104019	Collagenase is a protease that cleaves the bond between a neutral amino acid (X) and glycine in the sequence Pro-X-Glyc-Pro, which is found with high frequency in collagen
Disposable scalpel	Swann-Morton	501	It is use to cut tissues
DMEM-L	Euroclone	ECM0060L	Dulbecco's Modified Eagle's Medium Low Glucose with L-Glutamine with Sodium Pyruvate
EGF	PeproThec, DBA	AF-100-15	Epidermal Growth Factor
Fetal Bovine Serum	Gibco by life technologies	10270-106	FBS is a popular media supplement because it provides a wide array of functions in cell culture. FBS delivers nutrients, growth and attachment factors and protects cells from oxidative damage and apoptosis by mechanisms that are difficult to reproduce in serum-free media (SFM) systems
Filtropur BT50 0.2,500 mL Bottle top filter	Sarstedt	831,823,101	it is a device that is used for filtration of solutions
Flexitube GeneSolution for PRNP	Qiagen	GS5621	4 siRNAs for Entrez gene 5621. Target sequence N.1 TAGAGATTTCATAGCTATTTA  N.2 CAGCAAATAACCATTGGTTAA  N.3. CTGAATCGTTTCATGTAAGAA  N.4  CAGTGACTATGAGGACCGTTA
Hank's solution 1x	Gibco by life technologies	240200083	The essential function of Hanks′ Balanced Salt solution is to maintain pH as well as osmotic balance. It also provides water and essential inorganic ions to cells
HiPerFect Transfection Reagent	Qiagen	301705	HiPerFect Transfection Reagent is a unique blend of cationic and neutral lipids that enables effective siRNA uptake and efficient release of siRNA inside cells, resulting in high gene knockdown even when using low siRNA concentrations
Neurobasal A	Gibco by life technologies	10888022	Neurobasal-A Medium is a basal medium designed for long-term maintenance and maturation of pure post-natal and adult brain neurons
Paraformaldehyde	Sigma-Aldrich	30525-89-4	Paraformaldehyde has been used for fixing of cells and tissue sections during staining procedures
penicillin/streptomycin	Euroclone	ECB3001D	It is use to supplement cell culture media to control bacterial contamination
Phosphate buffered saline  (PBS)	Euroclone	ECB4004LX10	PBS is a balanced salt solution used for the handling and culturing of mammalian cells. PBS is used to to irrigate, wash, and dilute mammalian cells. Phosphate buffering maintains the pH in the physiological range
TC-Platte 6 well, Cell+,F	Sarstedt	833,920,300	It is a growth surface for adherent cells
Tissue culture flask T-25,Cell+,Vented Cap	Sarstedt	833,910,302	Tissue culture flask T-25, polystyrene, Cell+ growth surface for sensitive adherent cells, e.g. primary cells, canted neck, ventilation cap, yellow, sterile, Pyrogen-free, non-cytotoxic, 10 pcs./bag
Triton X-100	Sigma-Aldrich	9002-93-1	Widely used non-ionic surfactant for recovery of membrane components under mild non-denaturing conditions
Trypsin-EDTA	Euroclone	ECB3052D	Trypsin will cleave peptides on the C-terminal side of lysine and arginine amino acid residues. Trypsin is used to remove adherent cells from a culture surface
Tube	Sarstedt	62,554,502	Tube 15 mL, 120 mm x17 mm, PP
VBH 36 C2 Compact	Steril	ST-003009000	Offers totally protection for the enviroment and worker
ZEISS Axio Vert.A1 – Inverted Microscope	Zeiss	3849000962	ZEISS Axio Vert.A1 provides a unique entry level price and can provide all contrasting techniques, including brightfield, phase contrast, PlasDIC, VAREL, improved Hoffman Modulation Contrast (iHMC), DIC and fluorescence. Incorporate LED illumination for gentle imaging for fluorescently-labeled cells. Axio Vert.A1 is ergonomically designed for routine work and compact enough to sit inside tissue culture hoods.