JoVE 비디오를 활용하시려면 도서관을 통한 기관 구독이 필요합니다. 전체 비디오를 보시려면 로그인하거나 무료 트라이얼을 시작하세요.
Method Article
여기 우리는 프리온 단백질 표정 신경 분화 과정을 평가 하기 위해 인간의 치과 펄프의 줄기 세포 분리 및 전파에 대 한 프로토콜을 제시.
Bioethical 문제점 배아 줄기 세포의 조작에 관련 된 의료 연구의 분야에서 발전을 방해 있다. 이러한 이유로, 혈액, 골 수, 탯 줄, 지방 같은 다른 조직에서 성체 줄기 세포를 얻기 위해 매우 중요 하다. 가능한 소스 중 치과 펄프 이므로 특히 흥미로운 bioethical 고려 사항에 대 한 얻을 쉽습니다. 실제로, 인간 치과 펄프 줄기 세포 (hDPSCs) 같은 신경 세포에서 분화 할 수 성인 줄기 세포의 종류와 건강 한 환자 (13-19 세)의 세 번째 어 금 니에서 얻어질 수 있다. 특히, 치과 펄프 굴 삭 기 제거, 작은 조각으로 잘라, 콜라 4로 치료 되었고 플라스 크에서 경작. 신경 감 별 법을 유도, hDPSCs는 2 주 동안 EGF/bFGF와 자극 했다. 이전에 우리는 분화 과정에서 세포 프리온의 내용을 hDPSCs에서 단백질 (PrPC) 증가 증명 하고있다. Cytofluorimetric 분석 PrPC 신경 감 별 법 과정 후 증가의 초기 표현을 했다. SiRNA로 PrPC 의 절제 PrP EGF/bFGF에 의해 유도 된 신경 감 별 법을 방지. 이 문서에 우리 우리 향상 격리, 분리 및 여러 쉬운 절차를 가진 hDPSCs의 재배 방법을 생체 외에서 보다 효율적인 세포 클론 했다 중간 엽 줄기 세포 (MSCs)의 획득 및 대규모 확장 설명 관찰 되었다. 우리는 또한 어떻게는 프로토콜에 대 한 자세한 방법으로 얻은 hDPSCs는 MSCs의 신경 분화 과정과 후속 세포질과 분자 과정을 공부 하는 우수한 실험 모델을 보여줍니다.
중간 엽 줄기 세포는 골 수, 탯 줄 혈액, 인간의 치과 펄프, 지방 조직, 그리고 혈액1,2,3,,45 를 포함 하 여 여러 조직에서 고립 되어 있다 , 6. 여러 저자에 의해 보고, hDPSCs 표시 플라스틱 준수, 전형적인 구와 같은 형태학. 이러한 개별 복제와 증식 및 차별화 용량7,8차이 매우 이질적인 인구를 나타냅니다. hDPSCs 익스프레스 중간 엽 줄기 세포 (CD44, CD90, CD73, CD105, STRO-1)에 대 한 특정 마커, 그들은 일부 조 혈 마커 (CD14 CD19 등)에 대 한 부정적인 고 생체 외에서 multilineage 차별화9, 의 10,11.
몇몇 저자가이 세포는 NGF, bFGF, 특정 미디어 및 보충7,12와 함께에서 EGF의 추가 포함 하는 다른 프로토콜을 사용 하 여 같은 신경 세포로 분화 할 수 나타났습니다. 또한, 많은 단백질 신경 분화 과정에 참여 하 고,이 중, 여러 논문 표시 모두 배아와 성체 줄기 세포13, 관련 역할 및 세포 프리온 단백질 (PrPC)의 중요 한 표현 14. PrPC 나타냅니다 구리 물질 대사, apoptosis로 셀 안에 서로 다른 기능을 수행할 수 있는 다 면 발현 성 분자 그리고 저항을 산화 스트레스15,,1617 , 18 , 19 , 20 , 21 , 22.
우리의 이전 종이23, 우리는 PrPC hDPSCs 신경 분화 과정에서의 역할을 조사. 사실, hDPSCs 익스프레스 PrPC 조 하 고, 신경 감 별 법 후 추가 증가 관찰 하는 것이 가능 했다. 다른 저자는 PrPC 줄기 세포의 신경 분화 과정에서의 가능한 역할을 가정 했다. 실제로, PrPC 신경, oligodendrocytes, 및 이다24에 인간 배아 줄기 세포의 분화를 드라이브. 이 연구의 목적은 신경 감 별 법 동안 치과 펄프, 그것의 분화 과정과 PrPC 의 역할에서 줄기 세포를 얻기 위한 방법론을 강조 했다.
Access restricted. Please log in or start a trial to view this content.
연구에 사용 하는 세 번째 어 금 니 환자 (13-19 세)의 약물 또는 알코올 소비 이전 역사 없이, 모든 비 흡연와 적절 한 구강 위생에서에서 excised 했다. 설명 과학 치과와 로마의 "역사적인" 대학 Maxillofacial 당일 동의 환자 또는 부모에서 얻은 했다. 동의 윤리적 고려 사항 및 윤리 위원회의 승인에 따라 얻은 했다.
1. 치아 및 치과 펄프 추출
2. 치과 펄프의 줄기 세포 분리 처리
3. 줄기 세포 배양 및 전파
4. 과도 PrPC Silencing siRNA에 의해
5. 신경 유도 과정 hDPSCs
6입니다. hDPSCs Flow Cytometry로의 특성
7. hDPSCs Flow Cytometry 분석에 PrPC 식의 평가
Access restricted. Please log in or start a trial to view this content.
세 번째 모 랄에서 얻은 치과 펄프에서 hDPSCs의 격리 및 분리 절차는 작은 변화 파괴적인 결과 발생할 수 있는 복잡 한 프로세스. 이 문서에서 사용 하는 프로토콜의 아서 외. 12 여러 가지 개선입니다. 절차의 대표적인 구조는 그림 1에 표시 됩니다.
hDPSCs 셀 별개 복제와 증식 및 차?...
Access restricted. Please log in or start a trial to view this content.
이 작품에서는, 우리가 격리와 hDPSCs;의 신경 분화에 대 한 방법론에 초점을 맞춘 또한, 우리는이 과정에서 PrPC 의 역할 평가. 분리 과정에서 신경 세포와 같은 세포에 중요 한 단계는 hDPSCs를 차별화 하는 여러 방법이 있다. hDPSCs는 chondroblasts, adipocytes, osteoblasts, 신경 등 여러 계보에서 차별화 수 있습니다. 우리 신문, 우리 신경 감 별 법의 메커니즘 및 PrPC의 존재를 조사. 위에서 설명...
Access restricted. Please log in or start a trial to view this content.
저자는 공개 없다.
이 작품은 "피코 Varrone" 및 티 대학 허브 "사비 나 Universitas" 빈첸초 Mattei에 의해 지원 되었다.
그림 5 (A, B) 테일러 & 프랜시스 회사에서 게시자의 허가 reprinted: 역할의 프리온 단백질-EGFR multimolecular 복잡 한 인간의 치과 펄프 파생 된 줄기 세포의 신경 분화 하는 동안. Martellucci, S., Manganelli V. Santacroce C., Santilli F., 자녀 가족 L., Sorice M., Mattei V. 프리온. 3 월 4 2018입니다. 테일러 & 프랜시스
Access restricted. Please log in or start a trial to view this content.
Name | Company | Catalog Number | Comments |
Amphotericin B solution | Sigma-Aldrich | A2942 | It is use to supplement cell culture media, it is a polyene antifungal antibiotic from Streptomyce |
Anti-B3tubulin | Cell Signaling Technology | #4466 | One of six B-tubulin isoform, it is expressed highly during fetal and postnatal development, remaining high in the peripheral nervous system |
Anti-CD105 | BD Biosciences | 611314 | Endoglin (CD105), a major glycoprotein of human vascular endothelium, is a type I integral membrane protein with a large extracellular region, a hydrophobic transmembrane region, and a short cytoplasmic tail |
Anti-CD44 | Millipore | CBL154-20ul | Positive cell markers antibodies directed against mesenchymal stem cells |
Anti-CD73 | Cell Signaling Technology | 13160 | CD73 is a 70 kDa glycosyl phosphatidylinositol-anchored, membrane-bound glycoprotein that catalyzes the hydrolysis of extracellular nucleoside monophosphates into bioactive nucleosides |
Anti-CD90 | Millipore | CBL415-20ul | Positive cell markers antibodies directed against mesenchymal stem cells |
Anti-GAP43 | Cell Signaling Technology | #8945 | Is a nervous system specific, growth-associated protein in growth cones and areas of high plasticity |
Anti-mouse PE | Abcam | ab7003 | Is an antibody used in in flow cytometry or FACS analysis |
Anti-NFH | Cell Signaling Technology | #2836 | Is an antibody that detects endogenous levels of total Neurofilament-H protein |
Anti-PrP mAb EP1802Y | Abcam | ab52604 | Rabbit monoclonal [EP 1802Y] to Prion protein PrP |
Anti-rabbit CY5 | Abcam | ab6564 | Is an antibody used in in flow cytometry or FACS analysis |
Anti-STRO 1 | Millipore | MAB4315-20ul | Positive cell markers antibodies directed against mesenchymal stem cells |
B27 Supp XF CTS | Gibco by life technologies | A14867-01 | B-27 can be used to support induction of human neural stem cells (hNSCs) from pluripotent stem cells (PSCs), expansion of hNSCs, differentiation of hNSCs, and maintenance of mature differentiated neurons in culture |
BD Accuri C6 flow cytometer | BD Biosciences | AC6531180187 | Flow cytometer equipped with a blue laser (488 nm) and a red laser (640 nm) |
BD Accuri C6 Software | BD Biosciences | Controls the BD Accuri C6 flow cytometer system in order to acquire data, generate statistics, and analyze results | |
bFGF | PeproThec, DBA | 100-18B | basic Fibroblast Growth Factor |
Centrifuge CL30R | Termo fisher Scientific | 11210908 | it is a device that is used for the separation of fluids,gas or liquid, based on density |
CO2 Incubator 3541 | Termo fisher Scientific | 317527-185 | it ensures optimal and reproducible growth conditions for cell cultures |
Collagenase, type IV | Life Technologies | 17104019 | Collagenase is a protease that cleaves the bond between a neutral amino acid (X) and glycine in the sequence Pro-X-Glyc-Pro, which is found with high frequency in collagen |
Disposable scalpel | Swann-Morton | 501 | It is use to cut tissues |
DMEM-L | Euroclone | ECM0060L | Dulbecco's Modified Eagle's Medium Low Glucose with L-Glutamine with Sodium Pyruvate |
EGF | PeproThec, DBA | AF-100-15 | Epidermal Growth Factor |
Fetal Bovine Serum | Gibco by life technologies | 10270-106 | FBS is a popular media supplement because it provides a wide array of functions in cell culture. FBS delivers nutrients, growth and attachment factors and protects cells from oxidative damage and apoptosis by mechanisms that are difficult to reproduce in serum-free media (SFM) systems |
Filtropur BT50 0.2,500 mL Bottle top filter | Sarstedt | 831,823,101 | it is a device that is used for filtration of solutions |
Flexitube GeneSolution for PRNP | Qiagen | GS5621 | 4 siRNAs for Entrez gene 5621. Target sequence N.1 TAGAGATTTCATAGCTATTTA N.2 CAGCAAATAACCATTGGTTAA N.3. CTGAATCGTTTCATGTAAGAA N.4 CAGTGACTATGAGGACCGTTA |
Hank's solution 1x | Gibco by life technologies | 240200083 | The essential function of Hanks′ Balanced Salt solution is to maintain pH as well as osmotic balance. It also provides water and essential inorganic ions to cells |
HiPerFect Transfection Reagent | Qiagen | 301705 | HiPerFect Transfection Reagent is a unique blend of cationic and neutral lipids that enables effective siRNA uptake and efficient release of siRNA inside cells, resulting in high gene knockdown even when using low siRNA concentrations |
Neurobasal A | Gibco by life technologies | 10888022 | Neurobasal-A Medium is a basal medium designed for long-term maintenance and maturation of pure post-natal and adult brain neurons |
Paraformaldehyde | Sigma-Aldrich | 30525-89-4 | Paraformaldehyde has been used for fixing of cells and tissue sections during staining procedures |
penicillin/streptomycin | Euroclone | ECB3001D | It is use to supplement cell culture media to control bacterial contamination |
Phosphate buffered saline (PBS) | Euroclone | ECB4004LX10 | PBS is a balanced salt solution used for the handling and culturing of mammalian cells. PBS is used to to irrigate, wash, and dilute mammalian cells. Phosphate buffering maintains the pH in the physiological range |
TC-Platte 6 well, Cell+,F | Sarstedt | 833,920,300 | It is a growth surface for adherent cells |
Tissue culture flask T-25,Cell+,Vented Cap | Sarstedt | 833,910,302 | Tissue culture flask T-25, polystyrene, Cell+ growth surface for sensitive adherent cells, e.g. primary cells, canted neck, ventilation cap, yellow, sterile, Pyrogen-free, non-cytotoxic, 10 pcs./bag |
Triton X-100 | Sigma-Aldrich | 9002-93-1 | Widely used non-ionic surfactant for recovery of membrane components under mild non-denaturing conditions |
Trypsin-EDTA | Euroclone | ECB3052D | Trypsin will cleave peptides on the C-terminal side of lysine and arginine amino acid residues. Trypsin is used to remove adherent cells from a culture surface |
Tube | Sarstedt | 62,554,502 | Tube 15 mL, 120 mm x17 mm, PP |
VBH 36 C2 Compact | Steril | ST-003009000 | Offers totally protection for the enviroment and worker |
ZEISS Axio Vert.A1 – Inverted Microscope | Zeiss | 3849000962 | ZEISS Axio Vert.A1 provides a unique entry level price and can provide all contrasting techniques, including brightfield, phase contrast, PlasDIC, VAREL, improved Hoffman Modulation Contrast (iHMC), DIC and fluorescence. Incorporate LED illumination for gentle imaging for fluorescently-labeled cells. Axio Vert.A1 is ergonomically designed for routine work and compact enough to sit inside tissue culture hoods. |
Access restricted. Please log in or start a trial to view this content.
JoVE'article의 텍스트 или 그림을 다시 사용하시려면 허가 살펴보기
허가 살펴보기This article has been published
Video Coming Soon
Copyright © 2025 MyJoVE Corporation. 판권 소유