We acknowledge Dr. Jean-Claude Sirard from the Center for Infection and Immunity of Lille, Institute Pasteur de Lille-France, for kindly providing the purified flagellin and Dr. Teresa Camou, Director of the National Reference Laboratory, Ministry of Health of Uruguay for kindly providing the pneumococcal strain. 
The authors would like to express their acknowledgement to Mr. Diego Acosta and Mr. Ignacio Turel form BichoFeo Producciones-Uruguay for their commitment and hard work during the entire video production and edition. 
This work was supported by the grants PR_FCE_2009_1_2783 and BE_POS_2010_1_2544 from the National Agency of Research and Innovation, ANII from Uruguay, the Program for Development of Basic Sciences, PEDECIBA of Uruguay and Sectoral Commission of Scientific research, CSIC-Universidad de la Rep&#250;blica, Uruguay.

<ol>
	<li>. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Pneumococcal+vaccines+WHO+position+paper--2012.">Pneumococcal vaccines WHO position paper--2012.</a> Weekly Epidemiological Record. 14, 129-144 (2012).</li><li>Appelbaum, P. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Carriage+of+antibiotic-resistant+Streptococcus+pneumoniae+by+children+in+eastern+and+central+Europe-a+multicenter+study+with+use+of+standardized+methods.">Carriage of antibiotic-resistant Streptococcus pneumoniae by children in eastern and central Europe-a multicenter study with use of standardized methods.</a> Clin Infect Dis. 23, 712-717 (1996).</li><li>Ramirez, J. A., Anzueto, A. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Changing+needs+of+community-acquired+pneumonia.">Changing needs of community-acquired pneumonia.</a> J Antimicrob Chemother. 66, 3-9 (2011).</li><li>Cuburu, N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Sublingual+immunization+induces+broad-based+systemic+and+mucosal+immune+responses+in+mice.">Sublingual immunization induces broad-based systemic and mucosal immune responses in mice.</a> Vaccine. 25, 8598-8610 (2007).</li><li>Pedersen, G. K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Evaluation+of+the+sublingual+route+for+administration+of+influenza+H5N1+virosomes+in+combination+with+the+bacterial+second+messenger+c-di-GMP.">Evaluation of the sublingual route for administration of influenza H5N1 virosomes in combination with the bacterial second messenger c-di-GMP.</a> PLoS One. 25, 1-12 (2011).</li><li>Song, J. H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Sublingual+vaccination+with+influenza+virus+protects+mice+against+lethal+viral+infection.">Sublingual vaccination with influenza virus protects mice against lethal viral infection.</a> Proc Natl Acad Sci USA. 105, 1644-1649 (2008).</li><li>Cogo, R., Ramponi, A., Scivoletto, G., Rippoli, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Prophylaxis+for+acute+exacerbations+of+chronic+bronchitis+using+an+antibacterial+sublingual+vaccine+obtained+through+mechanical+lysis:+a+clinical+and+pharmacoeconomic+study.">Prophylaxis for acute exacerbations of chronic bronchitis using an antibacterial sublingual vaccine obtained through mechanical lysis: a clinical and pharmacoeconomic study.</a> Acta Biomed. 74, 76-87 (2003).</li><li>Rosaschino, F., Cattaneo, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Strategies+for+optimizing+compliance+of+paediatric+patients+for+seasonal+antibacterial+vaccination+with+sublingually+administered+Polyvalent+Mechanical+Bacterial+Lysates+(PMBL).">Strategies for optimizing compliance of paediatric patients for seasonal antibacterial vaccination with sublingually administered Polyvalent Mechanical Bacterial Lysates (PMBL).</a> Acta Biomed. 75, 171-178 (2004).</li><li>Senna, G., Caminati, M., Canonica, G. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Safety+and+tolerability+of+sublingual+immunotherapy+in+clinical+trials+and+real+life.">Safety and tolerability of sublingual immunotherapy in clinical trials and real life.</a> Curr Opin Allergy Clin Immunol. 13, 656-662 (2013).</li><li>Mascarell, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Oral+dendritic+cells+mediate+antigen-specific+tolerance+by+stimulating+TH1+and+regulatory+CD4++T+cells.">Oral dendritic cells mediate antigen-specific tolerance by stimulating TH1 and regulatory CD4+ T cells.</a> J Allergy Clin Immunol. 122, 603-609 (2008).</li><li>Mascarell, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mapping+of+the+lingual+immune+system+reveals+the+presence+of+both+regulatory+and+effector+CD4++T+cells.">Mapping of the lingual immune system reveals the presence of both regulatory and effector CD4+ T cells.</a> Clin Exp Allergy. 39, 1910-1919 (2009).</li><li>Mascarell, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Oral+macrophage-like+cells+play+a+key+role+in+tolerance+induction+following+sublingual+immunotherapy+of+asthmatic+mice.">Oral macrophage-like cells play a key role in tolerance induction following sublingual immunotherapy of asthmatic mice.</a> Mucosal Immunology. 4, 638-647 (2011).</li><li>Hervouet, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Antigen-bearing+dendritic+cells+from+the+sublingual+mucosa+recirculate+to+distant+systemic+lymphoid+organs+to+prime+mucosal+CD8+T+cells.">Antigen-bearing dendritic cells from the sublingual mucosa recirculate to distant systemic lymphoid organs to prime mucosal CD8 T cells.</a> Mucosal Immunology. 7, 280-291 (2014).</li><li>Munoz, N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mucosal+administration+of+flagellin+protects+mice+from+Streptococcus+pneumoniae+lung+infection.">Mucosal administration of flagellin protects mice from Streptococcus pneumoniae lung infection.</a> Infect Immun. 78, 4226-4233 (2010).</li><li>Hayashi, F., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+innate+immune+response+to+bacterial+flagellin+is+mediated+by+Toll-like+receptor+5.">The innate immune response to bacterial flagellin is mediated by Toll-like receptor 5.</a> Nature. 410, 1099-1103 (2001).</li><li>Lightfield, K. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Critical+function+for+Naip5+in+inflammasome+activation+by+a+conserved+carboxy-terminal+domain+of+flagellin.">Critical function for Naip5 in inflammasome activation by a conserved carboxy-terminal domain of flagellin.</a> Nature Immunology. 9, 1171-1178 (2008).</li><li>Lightfield, K. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Differential+requirements+for+NAIP5+in+activation+of+the+NLRC4+inflammasome.">Differential requirements for NAIP5 in activation of the NLRC4 inflammasome.</a> Infect Immun. 79, 1606-1614 (2011).</li><li>Honko, A. N., Mizel, S. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mucosal+administration+of+flagellin+induces+innate+immunity+in+the+mouse+lung.">Mucosal administration of flagellin induces innate immunity in the mouse lung.</a> Infect Immun. 72, 6676-6679 (2004).</li><li>Janot, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Radioresistant+cells+expressing+TLR5+control+the+respiratory+epithelium's+innate+immune+responses+to+flagellin.">Radioresistant cells expressing TLR5 control the respiratory epithelium's innate immune responses to flagellin.</a> Eur J Immunol. 39 (6), 1587-1596 (2009).</li><li>Van Maele, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=TLR5+signaling+stimulates+the+innate+production+of+IL-17+and+IL-22+by+CD3(neg)CD127++immune+cells+in+spleen+and+mucosa.">TLR5 signaling stimulates the innate production of IL-17 and IL-22 by CD3(neg)CD127+ immune cells in spleen and mucosa.</a> J Immunol. 185, 1177-1185 (2010).</li><li>Lee, S. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Neurologic+adverse+events+following+influenza+A+(H1N1)+vaccinations+in+children.">Neurologic adverse events following influenza A (H1N1) vaccinations in children.</a> Pediatrics international: official journal of the Japan Pediatric Society. 54, 325-330 (2012).</li><li>Lewis, D. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transient+facial+nerve+paralysis+(Bell's+palsy)+following+intranasal+delivery+of+a+genetically+detoxified+mutant+of+Escherichia+coli+heat+labile+toxin.">Transient facial nerve paralysis (Bell's palsy) following intranasal delivery of a genetically detoxified mutant of Escherichia coli heat labile toxin.</a> PLoS One. 4, e6999 (2009).</li><li>Mutsch, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Use+of+the+inactivated+intranasal+influenza+vaccine+and+the+risk+of+Bell's+palsy+in+Switzerland.">Use of the inactivated intranasal influenza vaccine and the risk of Bell's palsy in Switzerland.</a> N Engl J Med. 350, 896-903 (2004).</li><li>Kuo, C. H., Wang, W. L., Chu, Y. T., Lee, M. S., Hung, C. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Sublingual+immunotherapy+in+children:+an+updated+review.">Sublingual immunotherapy in children: an updated review.</a> Pediatr Neonatol. 50, 44-49 (2009).</li><li>Nempont, C., Cavet, D., Rumbo, M., Bompard, C., Villeret, V., Sirard, J. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Deletion+of+flagellin's+hypervariable+region+abrogates+antibody-mediated+neutralization+and+systemic+activation+of+TLR5-dependent+immunity.">Deletion of flagellin's hypervariable region abrogates antibody-mediated neutralization and systemic activation of TLR5-dependent immunity.</a> J. Immunol. 181, 2036-2043 (2008).</li><li>Marques, J. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Protection+against+Streptococcus+pneumoniae+serotype+1+acute+infection+shows+a+signature+of+Th17-+and+IFN-gamma-mediated+immunity.">Protection against Streptococcus pneumoniae serotype 1 acute infection shows a signature of Th17- and IFN-gamma-mediated immunity.</a> Immunobiology. 217, 420-429 (2012).</li><li>Stewart, C. C., Stewart, S. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Titering+antibodies.">Titering antibodies.</a> Current Protocols in Cytometry. 4, Unit 4.1 (2001).</li><li>Kubista, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+real-time+polymerase+chain+reaction.">The real-time polymerase chain reaction.</a> Molecular Aspects of Medicine. 27, 95-125 (2006).</li><li>Pedersen, G., Cox, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+mucosal+vaccine+quandary:+intranasal+vs.+sublingual+immunization+against+influenza.">The mucosal vaccine quandary: intranasal vs. sublingual immunization against influenza.</a> Human Vaccines &amp; Immunotherapeutics. 8, 689-693 (2012).</li><li>Vitaliti, G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mucosal+immunity+and+sublingual+immunotherapy+in+respiratory+disorders.">Mucosal immunity and sublingual immunotherapy in respiratory disorders.</a> Journal of Biological Regulators and Homeostatic Agents. 26, S85-S93 (2012).</li></ol>

The authors have nothing to disclose.

Somministrazione sublinguale di agenti terapeutici è stato dimostrato come un mezzo utile per modulare la risposta immunitaria nel tratto respiratorio. Il vantaggio principale della SLIT per il trattamento delle malattie respiratorie è che non comporta la consegna diretta dei composti nei polmoni o le narici, essendo più sicuro di trattamenti basati sulla somministrazione intranasale 31. Immunoterapia sublinguale può essere utilizzato per modulare la risposta immunitaria in modi diversi, sia per l&#39;induzione di risposte normative che possono migliorare i sintomi di infiammazione allergica e asma 32 o per indurre l&#39;attivazione transitoria dei meccanismi immunitari innati per trattare le infezioni polmonari acute come mostrato qui. Il modello di topo presentato in questo video è un metodo conveniente per lo screening di composti diversi, come agenti terapeutici per SLIT. Questo modello animale offre un utile mezzo per determinare l&#39;impattodella SLIT nella risposta immunitaria dei polmoni e in altri organi (ad es., linfonodi drenanti o siti mucose distali) che non può essere imitato con l&#39;uso di modelli in vitro. Anche se ci sono diversi documenti che descrivono i risultati ottenuti con l&#39;immunoterapia sublinguale, non sono stati resi ancora disponibili metodi dettagliati per le procedure di somministrazione sublinguale. Inoltre, il modello può essere utilizzato per la valutazione dei vaccini sublinguali inibitori a conferire protezione sistemica e locale nel tratto respiratorio. Come mostrato nel video allegato, la somministrazione sublinguale di composti è una procedura semplice che può essere facilmente eseguita senza la necessità di una formazione. In genere, una persona abile nella manipolazione degli animali richiede 1 ora per eseguire SLIT in un gruppo di 10 topi utilizzando anestetici iniettabili come descritto in questo protocollo. Se sfida pneumococco viene eseguita come pure, 90 min aggiuntivo sarà richiesto per prepararesospensione batterica ed effettuare intranasale sfida degli animali. I protocolli FACS qui presentati consentono comoda caratterizzazione dell&#39;impatto della SLIT nel sito locale di somministrazione, linfonodi, nonché i loro effetti sulla dinamica delle cellule dei polmoni. Analisi separata dei contenuti e del polmone broncoalveolare parenchima è importante per discriminare residente immunitario delle vie respiratorie &quot;e infiltrazione tipi di cellule da quelle che rimangono all&#39;interno del tessuto. L&#39;analisi del contenuto BAL consente lo studio del fatturato macrofagi alveolari nonché le dinamiche di cellule assunzione negli spazi alveolari indotte da trattamenti diversi, ad esempio., PMN, eosinofili, monociti. BAL può essere utilizzato anche per valutare la presenza di citochine e chemochine secrete da Enzyme-linked immunosorbent assay (ELISA) o il rilevamento di anticorpi IgA secreti ottenuta dopo la vaccinazione sublinguale. Studio del tessuto dei polmonipermetterà la caratterizzazione di altri tipi di cellule, le cellule dendritiche in stile classico, le cellule T e le cellule B. Preparazione dei campioni BAL e linfonodi per l&#39;analisi FACS è semplice. Dopo la raccolta del campione, normalmente 60 minuti sono necessari per completare il protocollo di colorazione per 10-20 campioni. Al contrario, l&#39;isolamento di cellule da polmoni o tessuto sublinguale richiede più tempo in quanto è necessaria la digestione della matrice extracellulare. L&#39;assorbimento dell&#39;agente terapeutico consegnato da via sublinguale può essere affrontato il monitoraggio di molecole modo fluorescente o marcati radioattivamente utilizzando sistemi di imaging in vivo. Immunoterapia sublinguale è un metodo interessante per indurre efficacemente risposte immunitarie nel tratto respiratorio e sistemica che può essere usato per trattare o prevenire patologie respiratorie. Delucidazione dei meccanismi che determinano l&#39;attivazione vs tolleranza della risposta immunitaria nel tratto respiratorio dopo SLIT is cruciale per permettere progettazione razionale di nuove strategie terapeutiche che possono essere usati da soli o in combinazione con trattamenti contro patologie respiratorie diverse.

The overall goal of this work is to illustrate the benefits of sublingual immunotherapy for the treatment of acute respiratory infections (ARI) and present the advantages of this delivery route compared to other routes of administration, namely intranasal.
ARI cause millions of deaths every year especially in children under five. Streptococcus pneumoniae remains as one of the major etiological agents of bacterial pneumonia in infants and the elderly1,2. To present, the main available treatment relies on the use of antibiotics but resistant strains are continuously arising3,4.
SLIT induces broad responses at systemic and also mucosal level, particularly at the respiratory tract5. It has proven effectiveness against influenza infection, promoting long term protection with production of humoral and cellular responses6,7. Besides, it has been shown that prophylactic treatment with bacterial lysates delivered by sublingual route reduced exacerbations of chronic obstructive bronchitis in the elderly8 and prevented recurrent respiratory infections in children9. SLIT has been widely used for the treatment of allergies and asthma. Clinical studies had not only demonstrated its efficacy to modulate the immune response in the respiratory tract but also its safety10. Despite the growing interest of pharmaceutical companies and researchers in SLIT, the mechanisms involved in the induction of mucosal immune responses after sublingual delivery of compounds remain obscure. Recently, attention has been focused on the mechanisms promoting tolerance associated with allergen desensitization. It has been proposed that resident and recruited cells at the sublingual mucosa, like dendritic cells and macrophages, can promote tolerance after SLIT11-13. Dendritic cells of the oral mucosa can promote IFN-gamma and IL-10 producing T helper cells11 as well as recirculate to the distal genital mucosa and promote CD8+ T cells14. However, little is known about the impact of SLIT on innate cells or its capacity to improve pathogen clearance during acute respiratory infections.
The natural control of pneumococcal infection in the lungs greatly depends on the efficient and swift activation of local innate defences. We previously showed that enhancement of lungs&#8217; innate immunity by a single intranasal dose of flagellin (FliC), a TLR5 and NLRC4 agonist, protects 75-100% of mice challenged with a lethal dose of a clinical isolate of Streptococcus pneumoniae serotype 1. This protection was shown to be dependent on local recruitment of GR1+ cells (likely polymorphonuclear neutrophils, PMNs) and not dependent on antibodies, B or T cells15. 
Flagellin is the structural component of the bacterial flagellum. In its monomeric form it is recognized by two Pathogen Recognition Receptors (PRRs), TLR5 that senses extracellular FliC16 and NLRC4/NAIP5 inflammasome that detects intracellular flagellin17,18. When FliC is sensed by the PRRs an important inflammatory response is triggered. We and others have demonstrated that instillation of purified FliC from Salmonella enterica serovar Typhimurium into the lungs drives swift production of chemokines and cytokines specially when recognized by the lungs&#8217; epithelium that in turn orchestrate the recruitment of immune cells into the airways, mainly PMNs15,19-21. Although transient, the substantial neutrophil infiltration that takes place into the airways after nasal delivery of FliC could be a concern if moving towards clinical therapies for human use. Excessive inflammation could be detrimental for the lungs&#8217; function. Moreover, it has been shown that intranasal delivery of immunostimulatory molecules may cause facial paralysis and/or brain toxicity22-24. 
Sublingual immunotherapy offers a safer alternative to modulate the immune response in the respiratory tract compared to the intranasal route. It is non-invasive, painless, simple and has good patient compliance25. Furthermore, as mentioned before, it can induce protective responses in the respiratory mucosa without the risks associated to direct intranasal or intrapulmonary delivery of formulations. Sublingual route could be alternatively used to deliver molecules that have great effects onto the lung&#8217;s immune system but that have been proven to be toxic or to elicit great inflammation when administered intranasally. Besides these advantages, formulations for sublingual immunotherapy have lower cost of manufacture since non-sterile products can be delivered by this route and endotoxic shock is not a concern for SLIT. On the other hand, it is worth noticing that higher doses of the immunostimulatory compounds compared to those used by intranasal or parenteral routes are necessary to induce an immune response in the lungs; also highly concentrated solutions are needed when using the mouse model of SLIT since the anatomical site where the formulations are deposited is small. 
Based on our previous published data, we developed a model of protection using sublingual immunotherapy with flagellin as model immunostimulant. We demonstrated that a single dose of flagellin induced 60% survival against invasive pneumococcal pneumonia caused by the serotype 1 strain while all mice in the control group died of infection within 5 days. Flow cytometry analysis showed that higher numbers of PMN are recruited into the airways of protected animals after sublingual treatment with flagellin suggesting that these cells might be involved in the mechanism of protection induced by sublingual immunotherapy. 
This video shows in detail how to perform sublingual immunotherapy and also how to recover relevant tissue from the sublingual mucosa, draining lymph nodes as well as lungs and airways to perform further analysis. Additionally, it illustrates the general technique of cell preparation for FACS analysis and briefly shows how to prepare Streptococcus pneumoniae suspensions and how to perform intranasal infections in mouse to set up the acute infection model.

<table border="0" cellpadding="0" cellspacing="0" width="992">
	<tbody>
		<tr height="21">
			<td height="21" style="height:21px;width:395px;">Name of Material/ Equipment</td>
			<td style="width:212px;">Company</td>
			<td style="width:141px;">Catalog Number</td>
			<td style="width:245px;">Comments/Description</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:395px;">Ketamine solution (50 mg/ml)</td>
			<td style="width:212px;">Pharma Service, Uruguay</td>
			<td style="width:141px;">N/A</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:395px;">Xilacine solution (2 %)</td>
			<td style="width:212px;">Portinco S.A., Uruguay</td>
			<td style="width:141px;">N/A</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:395px;">Sterile 1ml syringe</td>
			<td style="width:212px;">Modern, Uruguay</td>
			<td style="width:141px;">N/A</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:395px;">Sterile 27G needle</td>
			<td style="width:212px;">Modern, Uruguay</td>
			<td style="width:141px;">N/A</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:395px;">RPMI 1640</td>
			<td style="width:212px;">General Electric Health Care</td>
			<td style="width:141px;">E15885</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:395px;">Fetal Bovine Serum</td>
			<td style="width:212px;">ATCC</td>
			<td style="width:141px;">302020</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:395px;">Penicillin/Streptimycin Solution</td>
			<td style="width:212px;">SIGMA</td>
			<td style="width:141px;">P4333</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:395px;">Sterile PBS without Ca2+/Mg2+</td>
			<td style="width:212px;">PAA</td>
			<td style="width:141px;">H21002</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:395px;">Type-I Collagenase</td>
			<td>Life Technologies/Gibco</td>
			<td style="width:141px;">17100017</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:395px;">Deoxyribonuclease I (DNAse-I)</td>
			<td>SIGMA</td>
			<td style="width:141px;">D4513</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:395px;">Dispase</td>
			<td>Life Technologies/Gibco</td>
			<td>17105041</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:395px;">PerCP-Cy5.5 conjugated rat anti mouse IgG2b anti CD11b</td>
			<td style="width:212px;">BD</td>
			<td style="width:141px;">550993</td>
			<td style="width:245px;">Clone M1/70</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:395px;">APC conjugated hamster anti mouse IgG1 anti CD11c</td>
			<td style="width:212px;">BD</td>
			<td style="width:141px;">550261</td>
			<td style="width:245px;">Clone HL3&#160;</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:395px;">APC-Cy7 conjugated rat anti mouse IgG2a anti Ly6G</td>
			<td style="width:212px;">BD</td>
			<td style="width:141px;">560600</td>
			<td style="width:245px;">Clone 1A8</td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;width:395px;">Sterile Saline Solution</td>
			<td style="width:212px;">Laboratorio Farmaco Uruguayo, Uruguay</td>
			<td style="width:141px;">N/A</td>
			<td style="width:245px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:395px;">Tryptic Soy Agar</td>
			<td style="width:212px;">BD Difco, France</td>
			<td style="width:141px;">236950</td>
			<td style="width:245px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:395px;">Defibrinated Sheep Blood</td>
			<td style="width:212px;">Biokey, Uruguay</td>
			<td style="width:141px;">N/A</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:395px;">Sterile Petri Dishes</td>
			<td style="width:212px;">Greiner</td>
			<td style="width:141px;">633180</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:395px;">p10 Pipette</td>
			<td style="width:212px;">Gilson</td>
			<td style="width:141px;">F144802</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:395px;">P20 Pipette</td>
			<td>Eppendorf</td>
			<td style="width:141px;">3120000097</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">p200 Pipette</td>
			<td style="width:212px;">Gilson</td>
			<td style="width:141px;">F123601</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">p200 Pipette</td>
			<td style="width:212px;">Capp</td>
			<td style="width:141px;">C200</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">p200 Pipette</td>
			<td>Eppendorf</td>
			<td style="width:141px;">3120000054</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">p1000 Pipette</td>
			<td>Eppendorf</td>
			<td style="width:141px;">3120000062</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Sterile Filter Tips P10</td>
			<td>Greiner</td>
			<td>771288</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Sterile Filter Tips P200</td>
			<td>Greiner</td>
			<td>739288</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Sterile Filter Tips P1000</td>
			<td>Greiner</td>
			<td>750288</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Vortex</td>
			<td>BIOSAN</td>
			<td>V1-plus</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Stainless steel fine tip forceps&#160;</td>
			<td>SIGMA</td>
			<td>Z168785/Z168777</td>
			<td>curved and straight</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Dressing tissue forceps</td>
			<td>SIGMA</td>
			<td>F4392</td>
			<td>length 8 inches</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Micro-dissecting forceps</td>
			<td>SIGMA</td>
			<td>F4017</td>
			<td>straight&#160;</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Micro-dissecting forceps</td>
			<td>SIGMA</td>
			<td>F4142&#160;</td>
			<td>Curved</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Mayo Scissors</td>
			<td>SIGMA</td>
			<td>Z265993&#160;</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Scalpel</td>
			<td>SAKIRA MEDICAL</td>
			<td style="width:141px;">N/A</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Sterile Biopsy Punch &#216; 3mm</td>
			<td>Stiefel Laboratories Ltd.</td>
			<td>2079D</td>
			<td>5mm diameter can also be used</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Sterile 1.5ml Tubes</td>
			<td>Deltalab</td>
			<td>200400P</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Sterile 15ml Tubes</td>
			<td>Greiner</td>
			<td>188271</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Sterile 50ml Tubes</td>
			<td>Greiner</td>
			<td>227261</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Sterile serological pipettes 5 ml</td>
			<td>Greiner</td>
			<td>606160</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Sterile serological pipettes 10 ml</td>
			<td>Greiner</td>
			<td>607160</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Sterile serological pipettes 25 ml</td>
			<td>Greiner</td>
			<td>760180</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Biological safety cabinet, class II</td>
			<td>Thermo Scientific</td>
			<td>1300 series, type A2</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Micro-Isolator&#160;Rack</td>
			<td>RAIR&#160;IsoSystem&#160;</td>
			<td>76144W</td>
			<td>Super&#160;Mouse&#160;1800 AllerZone&#160;</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Refrigerated Microcentfifuge</td>
			<td>Eppendorf</td>
			<td>Legend Micro 21R</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Microcentfifuge</td>
			<td>Heraeus</td>
			<td>Biofuge-pico</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Centrifuge</td>
			<td>Thermo Scientific</td>
			<td>Sorval ST40R</td>
			<td></td>
		</tr>
		<tr height="25">
			<td height="25" style="height:25px;">CO2 Incubator&#160;</td>
			<td>Thermo Scientific</td>
			<td>Model&#160; 3111</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Sterile Thin-tip pasteur pipettes</td>
			<td>Deltalab</td>
			<td>D210022</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Sterile pasteur pipettes</td>
			<td>Deltalab</td>
			<td>200007</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Sterile 24-well plate</td>
			<td>Greiner</td>
			<td>662160</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Trypan Blue Solution&#160;</td>
			<td>Life Technologies</td>
			<td>T10282</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Automatic Cell Counter - Cuntess</td>
			<td>Life Technologies</td>
			<td>C10227&#160;</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Countess Cell Counting Chamber Slides</td>
			<td>Life Technologies</td>
			<td>C10312</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Flow Cytometry Tubes</td>
			<td>BD</td>
			<td>343675</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Flow Cytometer - FACS Canto-II</td>
			<td>BD</td>
			<td style="width:141px;">N/A</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Real Time PCR Instrument - Rotor Gene Q or ABI 7900</td>
			<td>Qiagen / Applied Biosystems</td>
			<td style="width:141px;">N/A</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Trizol Reagent</td>
			<td>Life Technologies</td>
			<td>15596-026</td>
			<td>Molecular Biology Grade</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">DNAse-I</td>
			<td>Life Technologies</td>
			<td>18068-015</td>
			<td>Molecular Biology Grade</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">DNAse-I Buffer 10X</td>
			<td>Life Technologies</td>
			<td>18068015</td>
			<td>Molecular Biology Grade</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">EDTA 25 mM</td>
			<td>Life Technologies</td>
			<td>18068015</td>
			<td>Molecular Biology Grade</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Ultra-Pure Water</td>
			<td>Life Technologies</td>
			<td>10977</td>
			<td>Molecular Biology Grade</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">RNAse Out</td>
			<td>Life Technologies</td>
			<td>100000840</td>
			<td>Molecular Biology Grade</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Rndom Hexamer Primers</td>
			<td>Life Technologies</td>
			<td>N8080127</td>
			<td>Molecular Biology Grade</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">M-MLV-RT buffer</td>
			<td>Life Technologies</td>
			<td>18057-018</td>
			<td>Molecular Biology Grade</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">M-MLV-RT enzime</td>
			<td>Life Technologies</td>
			<td>28025-021</td>
			<td>Molecular Biology Grade</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">QuantiTect Syber Green PCR Kit</td>
			<td>Qiagen</td>
			<td>204143</td>
			<td>Molecular Biology Grade</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Specific primers&#160;</td>
			<td>Life Technologies</td>
			<td style="width:141px;">N/A</td>
			<td>Molecular Biology Grade</td>
		</tr>
	</tbody>
</table>

sublingual immunotherapy as an alternative to induce protection against acute respiratory infections

Sublingual route has been widely used to deliver small molecules into the bloodstream and to modulate the immune response at different sites. It has been shown to effectively induce humoral and cellular responses at systemic and mucosal sites, namely the lungs and urogenital tract. Sublingual vaccination can promote protection against infections at the lower and upper respiratory tract; it can also promote tolerance to allergens and ameliorate asthma symptoms. Modulation of lung&#8217;s immune response by sublingual immunotherapy (SLIT) is safer than direct administration of formulations by intranasal route because it does not require delivery of potentially harmful molecules directly into the airways. In contrast to intranasal delivery, side effects involving brain toxicity or facial paralysis are not promoted by SLIT. The immune mechanisms underlying SLIT remain elusive and its use for the treatment of acute lung infections has not yet been explored. Thus, development of appropriate animal models of SLIT is needed to further explore its potential advantages. 
This work shows how to perform sublingual administration of therapeutic agents in mice to evaluate their ability to protect against acute pneumococcal pneumonia. Technical aspects of mouse handling during sublingual inoculation, precise identification of sublingual mucosa, draining lymph nodes and isolation of tissues, bronchoalveolar lavage and lungs are illustrated. Protocols for single cell suspension preparation for FACS analysis are described in detail. Other downstream applications for the analysis of the immune response are discussed. Technical aspects of the preparation of Streptococcus pneumoniae inoculum and intranasal challenge of mice are also explained.
SLIT is a simple technique that allows screening of candidate molecules to modulate lungs&#8217; immune response. Parameters affecting the success of SLIT are related to molecular size, susceptibility to degradation and stability of highly concentrated formulations.

Immunoterapia sublinguale può essere utilizzato con successo per modulare la risposta immunitaria polmoni. Abbiamo mostrato che una singola dose di flagellina, l&#39;agonista TLR5 e NLRC4, può indurre significativo sovraregolazione del mRNA codificante la CXCL1 chemochine, CCL20 e la citochina IL-6 rispetto ai controlli trattati con soluzione salina. Fold induzione di livelli di mRNA alzato a 8 ore dopo SLIT e tornare ai livelli basali dopo 20 ore (Figura 1). Tuttavia, quando la SLIT è stata effettuata 2 ore prima infezione intranasale con S. Pneumoniae, i livelli di CXCL1 e IL6 mRNA rimasero sovraregolati significativamente anche 24 ore dopo SLIT rispetto agli animali non trattati (Figura 2). Analisi delle popolazioni cellulari in BAL e tessuto polmonare mediante FACS rivelato che gli animali trattati con FLIC per via sublinguale avevano aumentato numero di neutrofili nelle vie aeree, ma non nel tessuto dei polmoni (Figura 3). <p class = &quot;jove_content&quot;&gt; Infine, la sopravvivenza dopo la sfida pneumococcica è stato confrontato in animali precedentemente trattati con FLIC per via sublinguale o con soluzione salina come controllo. Come mostrato in Figura 4, SLIT con flagellin promosso protezione e aumentato la sopravvivenza contro la polmonite pneumococcica acuta. <img alt="Figura 1" fo:content-width="6.7in" src="/files/ftp_upload/52036/52036fig1highresV2.jpg" width="680" /> Figura 1: Cinetica di profilo trascrizionale dei polmoni dopo immunoterapia sublinguale con flagellina. Otto a 10 settimane di età topi BALB / c (n = 4) sono stati trattati con 10 mg di flagellin o soluzione salina per via sublinguale sotto anestesia. I polmoni sono stati raccolti in diversi momenti e posti in conservante acido nucleico. Estrazione di RNA totale è stato eseguito e cDNA è stato sintetizzato. livelli di mRNA sono stati valutati mediante real time PCR usando primer specifici elencati in Tabl1 e quantificazione relativa è stata eseguita secondo il metodo ΔCt utilizzando i livelli ACTB mRNA per la normalizzazione. I risultati sono mostrati come volte maggiore rispetto al gruppo trattato con soluzione salina come mediana ± SEM. Gli asterischi indicano differenze statisticamente significative (p &lt;0.05) calcolati in base al test di Mann-Whitney. I risultati sono rappresentativi di 2 esperimenti indipendenti. <img alt="Figura 2" fo:content-width="6.2in" src="/files/ftp_upload/52036/52036fig2highresV2.jpg" width="660" /> Profilo trascrizionale Figura 2 polmoni durante la polmonite pneumococcica dopo immunoterapia sublinguale con flagellina. Otto a 10 settimane i topi BALB / c (n = 4 per il gruppo di controllo e n = 7 per il gruppo trattato) sono stati trattati con 10 mg di flagellin o soluzione salina da via sublinguale sotto anestesia. 2 ore più tardi topi sono stati sfidati per via intranasale con la dose letale minima (MLD) causando 100% di mortalità di un isolato clinico di S. pneumoniae sierotipo 1 E1585, corrispondente a 4x10 5 CFU / 50 microlitri. I polmoni sono stati raccolti 24 ore dopo la sfida e conservati in conservante acido nucleico finché sono stati eseguiti estrazione di RNA e cDNA sintesi. Real time PCR è stata effettuata (vedi elenco in fondo Tabella 1) e relativa quantificazione è stata eseguita secondo il metodo ΔCt utilizzando i livelli ACTB mRNA per la normalizzazione. I risultati sono mostrati come volte maggiore rispetto al gruppo trattato con soluzione salina come mediana ± SEM. Gli asterischi indicano differenze statisticamente significative (p &lt;0.05) calcolati in base al test di Mann-Whitney. <img alt="Figura 3" fo:content-width="6.5in" src="/files/ftp_upload/52036/52036fig3highresV2.jpg" width="680" /> Figura 3 Analisi dei polimorfonucleati neutrofili (PMN) reclutamento nel tessuto e le vie respiratorie polmoni dopo SLIT. Eight di10 settimane topi BALB / c (n = 4) sono stati trattati con 10 mg di flagellin o soluzione salina per via sublinguale sotto anestesia. 2 ore più tardi topi sono stati sfidati per via intranasale con la MLD di S. pneumoniae sierotipo 1 E1585. 24 ore dopo la sfida, BAL è stata eseguita e polmoni sono stati elaborati per l&#39;analisi FACS. PMN sono stati identificati come cellule CD11b Ly6G alta / alta / CD11c negativi e basato sul profilo FCS-SSC. I risultati sono espressi come percentuale di PMN rispetto di numero di cellule totali in BAL o polmoni. Barre rappresentano mediana ± SEM. Gli asterischi indicano differenze statisticamente significative (p &lt;0.05) calcolati secondo senso unico test di Mann-Whitney. <img alt="Figura 4" fo:content-width="5.3in" src="/files/ftp_upload/52036/52036fig4highresV2.jpg" width="530" /> Figura 4 SLIT con flagellin protegge i topi contro la polmonite pneumococcica acuta. </strong&gt; Otto a 10 settimane di età BALB / c topi (n = 8) sono stati trattati con 10 mg di flagellin o soluzione salina per via sublinguale sotto anestesia. 2 ore più tardi topi sono stati sfidati per via intranasale con la MLD di S. pneumoniae sierotipo 1 E1585. La sopravvivenza è stata valutata su base giornaliera. Le curve di Kaplan-Meier sono stati confrontati in base Log-rank (Mantel-Cox) test. Gli asterischi indicano differenze statisticamente significative (p &lt;0,05) .Results sono rappresentativi di 2 esperimenti indipendenti. <table align="center" border="1" cellpadding="0" cellspacing="0"><tbody align="center"><tr><td> Nome </td><td> Sequenza 5&#39;-3 &#39; </td><td> PCR lunghezza del prodotto (bp) </td></tr><tr><td> mB-actin_F </td><td> GCTTCTTTGCAGCTCCTTCGT </td><td rowspan="2"> 68 </td></tr><tr><td> mB-actin_R </td><td> CGTCATCCATGGCGAACTG </td></tr><tr><td>mCCL20_F </td><td> TTTTGGGATGGAATTGGACAC </td><td rowspan="2"> 69 </td></tr><tr><td> mCCL20_R </td><td> TGCAGGTGAAGCCTTCAACC </td></tr><tr><td> mCXCL1_F </td><td> CTTGGTTCAGAAAATTGTCCAAAA </td><td rowspan="2"> 84 </td></tr><tr><td> mCXCL1_R </td><td> ACGGTGCCATCAGAGCAGTCT </td></tr><tr><td> mIL-6_F </td><td> GTTCTCTGGGAAATCGTGGAAA </td><td rowspan="2"> 78 </td></tr><tr><td> mIL-6_R </td><td> AAGTGCATCATCGTTGTTCATACA </td></tr><tr><td> mTNFalpha_F </td><td> CATCTTCTCAAAATTCGAGTGACAA </td><td rowspan="2"> 63 </td></tr><tr><td> mTNFalpha_R </td><td> CCTCCACTTGGTGGTTTGCT </td></tr><tr><td> mCxcl2_F </td><td> CCCTCAACGGAAGAACCAAA </td><td rowspan="2"> 72 </td></tr><tr><td> mCxcl2_R </td><td> CACATCAGGTACGATCCAGGC </td></tr></tbody></table> Tabella 1 Lista Primer utilizzati per real time PCR. Sequenze di primer specifiche utilizzate per l&#39;analisi qPCR. Avanti e indietro primer per il mouse ACTB, Cccl20, CXCL1, IL6, TNFa e CXCL1 sono presentati come sequenze 5&#39;-3 &#39;e la durata prevista del prodotto è indicato in paia di basi (bp).

Watch this Scientific Journal Video about Sublingual Immunotherapy as an Alternative to Induce Protection Against Acute Respiratory Infections at JoVE.com

Sublingual Immunotherapy as an Alternative to Induce Protection Against Acute Respiratory Infections

The present work illustrates the convenience of using sublingual immunotherapy to boost the innate immune response in the lungs and confer protection against acute pneumococcal pneumonia in mouse.

L&#39;immunoterapia sublinguale come alternativa di indurre una protezione contro le infezioni respiratorie acute

Sublingual route has been widely used to deliver small molecules into the bloodstream and to modulate the immune response at different sites. It has been ...

sublingual-immunotherapy-as-an-alternative-to-induce-protection

Research

Education

JoVE Core

JoVE Journal

Pharmacology

Medicine

Unit 1

Other Respiratory Disorders

SCIENTISTS IN ACTION

16.7K Views.  Universidad de la República. The present work illustrates the convenience of using sublingual immunotherapy to boost the innate immune response in the lungs and confer protection against acute pneumococcal pneumonia in mouse.

Video: Sublingual Immunotherapy as an Alternative to Induce Protection Against Acute Respiratory Infections

Pressure Controlled Ventilation to Induce Acute Lung Injury in Mice

Murine models are extensively used to investigate acute injuries of different organs systems (1-34). Acute lung injury (ALI), which occurs with prolonged mechanical ventilation, contributes to morbidity and mortality of critical illness, and studies on novel genetic or pharmacological targets are areas of intense investigation (1-3, 5, 8, 26, 30, 33-36). ALI is defined by the acute onset of the disease, which leads to non-cardiac pulmonary edema and subsequent impairment of pulmonary gas exchange (36). We have developed a murine model of ALI by using a pressure-controlled ventilation to induce ventilator-induced lung injury (2). For this purpose, C57BL/6 mice are anesthetized and a tracheotomy is performed followed by induction of ALI via mechanical ventilation. Mice are ventilated in a pressure-controlled setting with an inspiratory peak pressure of 45 mbar over 1 - 3 hours. As outcome parameters, pulmonary edema (wet-to-dry ratio), bronchoalveolar fluid albumin content, bronchoalveolar fluid and pulmonary tissue myeloperoxidase content and pulmonary gas exchange are assessed (2). Using this technique we could show that it sufficiently induces acute lung inflammation and can distinguish between different treatment groups or genotypes (1-3, 5). Therefore this technique may be helpful for researchers who pursue molecular mechanisms involved in ALI using a genetic approach in mice with gene-targeted deletion.

A murine model for ventilator induced lung injury is an important tool to study an acute lung injury in vivo. Here, we report an easy applicable in situ model for acute lung injury using high-pressure mechanical ventilation to induce acute failure of the lung.

Pressione di ventilazione controllata per indurre lesioni polmonari acute nei topi

Murine models are extensively used to investigate acute injuries of different organs systems (1-34). Acute lung injury (ALI), which occurs with prolonged ...

Ricerca

Medicina

Bilateral Common Carotid Artery Occlusion as an Adequate Preconditioning Stimulus to Induce Early Ischemic Tolerance to Focal Cerebral Ischemia

There is accumulating evidence, that ischemic preconditioning - a non-damaging ischemic challenge to the brain - confers a transient protection to a subsequent damaging ischemic insult. We have established bilateral common carotid artery occlusion as a preconditioning stimulus to induce early ischemic tolerance to transient focal cerebral ischemia in C57Bl6/J mice. In this video, we will demonstrate the methodology used for this study.

There is accumulating evidence, that ischemic preconditioning (PC) &#x2013; a non-damaging ischemic challenge to the brain - confers a transient protection to a subsequent damaging ischemic insult. We established bilateral common carotid artery occlusion (BCCAO) as a preconditioning stimulus to induce early ischemic tolerance (IT) to transient focal cerebral ischemia (induced by middle cerebral artery occlusion, MCAO) in C57Bl6/J mice.

Bilaterale occlusione comune Arteria carotide come uno stimolo precondizionamento in grado di indurre tolleranza ischemica precoce di focale Ischemia Cerebrale

There is accumulating evidence, that ischemic preconditioning - a non-damaging ischemic challenge to the brain - confers a transient protection to a ...

Pharmacologic Induction of Epidermal Melanin and Protection Against Sunburn in a Humanized Mouse Model

Fairness of skin, UV sensitivity and skin cancer risk all correlate with the physiologic function of the melanocortin 1 receptor, a Gs-coupled signaling protein found on the surface of melanocytes. Mc1r stimulates adenylyl cyclase and cAMP production which, in turn, up-regulates melanocytic production of melanin in the skin. In order to study the mechanisms by which Mc1r signaling protects the skin against UV injury, this study relies on a mouse model with "humanized skin" based on epidermal expression of stem cell factor (Scf). K14-Scf transgenic mice retain melanocytes in the epidermis and therefore have the ability to deposit melanin in the epidermis. In this animal model, wild type Mc1r status results in robust deposition of black eumelanin pigment and a UV-protected phenotype. In contrast, K14-Scf animals with defective Mc1r signaling ability exhibit a red/blonde pigmentation, very little eumelanin in the skin and a UV-sensitive phenotype. Reasoning that eumelanin deposition might be enhanced by topical agents that mimic Mc1r signaling, we found that direct application of forskolin extract to the skin of Mc1r-defective fair-skinned mice resulted in robust eumelanin induction and UV protection 1. Here we describe the method for preparing and applying a forskolin-containing natural root extract to K14-Scf fair-skinned mice and report a method for measuring UV sensitivity by determining minimal erythematous dose (MED). Using this animal model, it is possible to study how epidermal cAMP induction and melanization of the skin affect physiologic responses to UV exposure.

Epidermal melanin is induced by topical application of forskolin in a murine model of the fair-skinned UV-sensitive human. Pharmacologic manipulation of cAMP levels in the skin and epidermal darkening strongly protect against UV-mediated inflammation (sunburn) as measured by the minimum erythematous dose (MED) assay.

Induzione farmacologica di melanina epidermica e di protezione contro le scottature in un modello di topo umanizzato

Fairness of skin, UV sensitivity and skin cancer  risk all correlate with the physiologic function of the melanocortin 1  receptor, a Gs-coupled signaling ...

Lavage-induced Surfactant Depletion in Pigs As a Model of the Acute Respiratory Distress Syndrome (ARDS)

Various animal models of lung injury exist to study the complex pathomechanisms of human acute respiratory distress syndrome (ARDS) and evaluate future therapies. Severe lung injury with a reproducible deterioration of pulmonary gas exchange and hemodynamics can be induced in anesthetized pigs using repeated lung lavages with warmed 0.9% saline (50 ml/kg body weight). Including standard respiratory and hemodynamic monitoring with clinically applied devices in this model allows the evaluation of novel therapeutic strategies (drugs, modern ventilators, extracorporeal membrane oxygenators, ECMO), and bridges the gap between bench and bedside. Furthermore, induction of lung injury with lung lavages does not require the injection of pathogens/endotoxins that impact on measurements of pro- and anti-inflammatory cytokines. A disadvantage of the model is the high recruitability of atelectatic lung tissue. Standardization of the model helps to avoid pitfalls, to ensure comparability between experiments, and to reduce the number of animals needed.

Lavage-induced Surfactant Depletion in Pigs As a Model of the Acute Respiratory Distress Syndrome ARDS

Repeated pulmonary lavages in anesthetized pigs induce lung injury resembling major aspects of human acute respiratory distress syndrome (ARDS). For this purpose the lungs are repeatedly lavaged with 0.9% saline at 37 &#176;C. The goal of the protocol is a reproducible mitigation of gas exchange and hemodynamics for research in ARDS.

Lavage indotta surfattante esaurimento nei suini come un modello della sindrome da distress respiratorio acuto (ARDS)

Various animal models of lung injury exist to study the complex pathomechanisms of human acute respiratory distress syndrome (ARDS) and evaluate future ...

Oleic Acid-Injection in Pigs As a Model for Acute Respiratory Distress Syndrome

The acute respiratory distress syndrome is a relevant intensive care disease with an incidence ranging between 2.2% and 19% of intensive care unit patients. Despite treatment advances over the last decades, ARDS patients still suffer mortality rates between 35 and 40%. There is still a need for further research to improve the outcome of patients suffering from ARDS. One problem is that no single animal model can mimic the complex pathomechanism of the acute respiratory distress syndrome, but several models exist to study different parts of it. Oleic acid injection (OAI)-induced lung injury is a well-established model for studying ventilation strategies, lung mechanics and ventilation/perfusion distribution in animals. OAI leads to severely impaired gas exchange, deterioration of lung mechanics and disruption of the alveolo-capillary barrier. The disadvantage of this model is the controversial mechanistic relevance of this model and the necessity for central venous access, which is challenging especially in smaller animal models. In summary, OAI-induced lung injury leads to reproducible results in small and large animals and hence represents a well-suited model for studying ARDS. Nevertheless, further research is necessary to find a model that mimics all parts of ARDS and lacks the problems associated with the different models existing today.

In this article, we present a protocol to induce acute lung injury in pigs by central-venous injection of oleic acid. This is an established animal model for studying the acute respiratory distress syndrome (ARDS).

Iniezione di acido oleico in maiali come modello per la sindrome da Distress respiratorio

The acute respiratory distress syndrome is a relevant intensive care disease with an incidence ranging between 2.2% and 19% of intensive care unit ...

Subclavian Vein Puncture As an Alternative Method of Blood Sample Collection in Rats

Blood collection with enough blood volume is essential in animal experiments. Blood collection from the tail vein of rats is popular and less stressful compared to other more aggressive methods such as retro-orbital plexus sample collection. However, this blood collection method is sometimes limited by an unsatisfactory success rate. Here, we introduce a method for blood collection through the subclavian vein puncture. The subclavian vein is located just under the clavicle and this vein is large enough to fulfill the volume requirements of blood collection. Our results show that this method is safe and applicable for blood collection sampling with the required blood volume. Blood collection through the subclavian vein puncture could serve as an alternative blood collection method in case of failed tail vein blood sampling in rats.

Here, we present a protocol to collect blood samples from the rat subclavian vein.

Puntura della vena succlavia come metodo alternativo di raccolta del campione di sangue in ratti

Blood collection with enough blood volume is essential in animal experiments. Blood collection from the tail vein of rats is popular and less stressful ...

Implantation of an Isoproterenol Mini-Pump to Induce Heart Failure in Mice

Isoproterenol (ISO), is a non-selective beta-adrenergic agonist, that is used widely to induce cardiac injury in mice. While the acute model mimics stress-induced cardiomyopathy, the chronic model, administered through an osmotic pump, mimics advanced heart failure in humans. The purpose of the described protocol is to create the chronic ISO-induced heart failure model in mice using an implanted mini-pump. This protocol has been used to induce heart failure in 100+ strains of inbred mice. Techniques on surgical pump implantation are described in detail and may be relevant to anyone interested in creating a heart failure model in mice. In addition, the weekly cardiac remodeling changes based on echocardiographic parameters for each strain and expected time to model development are presented. In summary, the method is simple and reproducible. Continuous ISO administered via the implanted mini-pump over 3 to 4 weeks is sufficient to induce cardiac remodeling. Finally, the success for ISO model creation may be assessed in vivo by serial echocardiography demonstrating hypertrophy, ventricular dilation, and dysfunction.

The chronic administration of isoproterenol via an implanted osmotic pump has been used widely to mimic advanced heart failure in mice. Here, we describe detailed methods in surgical mini-pump implantation for the continuous isoproterenol administration over 3 weeks, as well as, echocardiographic assessment for the successful model creation.

Impianto di una mini-pompa Isoproterenol per indurre un errore cardiaco nei topi

Isoproterenol (ISO), is a non-selective beta-adrenergic agonist, that is used widely to induce cardiac injury in mice. While the acute model mimics ...

The Rigid Tube as an Alternative in Controlling the Problematic Airway

The unexpected problematic airway represents a large proportion of anesthesia-related morbidity and mortality. The retromolar or paraglossal approach is an alternative to the majority of the rigid instruments used for tracheal intubation, which follow the midline to access the glottis. This single-center, prospective case-series study offers an option to conventional laryngoscopy in case of a poor glottic view, introducing an instrument (the rigid tube for laryngoscopy) that uses the retromolar approach to accomplish tracheal intubation. If after anesthesia induction, the modified Cormack-Lehane glottis view grade &#62;2b, the intubation is carried further with the rigid tube. The tube follows the direction of the thyroid cartilage while advancing from the labial commissure, displacing the tongue to the contralateral side. Adjusting the position of the larynx with the nondominant hand by gently pushing the thyroid cartilage and following an imaginary line towards it while advancing it improves the time needed for proper glottis visualization. Once the epiglottis is in sight, the practitioner progresses slowly, lifting the epiglottis and aiming the tip of the tube more anteriorly. When the glottis appears in the visual field, the intubating tube introducer is placed in the trachea, and a lubricated cuffed intubating tube is advanced over the introducer after the rigid tube is extracted. This tool was tested on 30 patients with an unsatisfactory glottic view when using the Macintosh laryngoscope and obtained excellent results with respect to intubation time and complications. The reduced visual field is the main limitation of this method, which requires a training period for reasonable expertise. This simple, robust, and cheap instrument could be a rescue option in case of a difficult airway.

Presented here is a protocol of tracheal intubation over an intubating tube introducer using a rigid tube for laryngoscopy with an attached light source. The main characteristics of this maneuver are the retromolar approach and the use of the thyroid cartilage as a landmark while advancing the rigid tube.

Il tubo rigido come alternativa nel controllo delle vie aeree problematiche

The unexpected problematic airway represents a large proportion of anesthesia-related morbidity and mortality. The retromolar or paraglossal approach is ...

Halogenated Agent Delivery in Porcine Model of Acute Respiratory Distress Syndrome via an Intensive Care Unit Type Device

Acute respiratory distress syndrome (ARDS) is a common cause of hypoxemic respiratory failure and death in critically ill patients, and there is an urgent need to find effective therapies. Preclinical studies have shown that inhaled halogenated agents may have beneficial effects in animal models of ARDS. The development of new devices to administer halogenated agents using modern intensive care unit (ICU) ventilators has significantly simplified the dispensing of halogenated agents to ICU patients. Because previous experimental and clinical research suggested potential benefits of halogenated volatiles, such as sevoflurane or isoflurane, for lung alveolar epithelial injury and inflammation, two pathophysiologic landmarks of diffuse alveolar damage during ARDS, we designed an animal model to understand the mechanisms of the effects of halogenated agents on lung injury and repair. After general anesthesia, tracheal intubation, and the initiation of mechanical ventilation, ARDS was induced in piglets via the intratracheal instillation of hydrochloric acid. Then, the piglets were sedated with inhaled sevoflurane or isoflurane using an ICU-type device, and the animals were ventilated with lung-protective mechanical ventilation during a 4 h period. During the study period, blood and alveolar samples were collected to evaluate arterial oxygenation, the permeability of the alveolar-capillary membrane, alveolar fluid clearance, and lung inflammation. Mechanical ventilation parameters were also collected throughout the experiment. Although this model induced a marked decrease in arterial oxygenation with altered alveolar-capillary permeability, it is reproducible and is characterized by a rapid onset, good stability over time, and no fatal complications.
We have developed a piglet model of acid aspiration that reproduces most of the physiological, biological, and pathological features of clinical ARDS, and it will be helpful to further our understanding of the potential lung-protective effects of halogenated agents delivered through devices used for inhaled ICU sedation.

We describe a model of hydrochloric acid-induced acute respiratory distress syndrome (ARDS) in piglets receiving sedation with halogenated agents, isoflurane and sevoflurane, through a device used for inhaled intensive care sedation. This model can be used to investigate the biological mechanisms of halogenated agents on lung injury and repair.

Somministrazione di agenti alogenati in modelli suini di sindrome da distress respiratorio acuto tramite un dispositivo di tipo unità di terapia intensiva

Acute respiratory distress syndrome (ARDS) is a common cause of hypoxemic respiratory failure and death in critically ill patients, and there is an urgent ...

Conducting Respiratory Oscillometry in an Outpatient Setting

Respiratory oscillometry is a different modality of pulmonary function testing that is increasingly used in a clinical and research setting to provide information regarding lung mechanics. Respiratory oscillometry is conducted through three acceptable measurements of tidal breathing and can be performed with minimal contraindications. Young children and patients who cannot perform spirometry due to cognitive or physical impairment can usually complete oscillometry. The main advantages of respiratory oscillometry are that it requires minimal patient cooperation and is more sensitive in detecting changes in small airways than conventional pulmonary function tests. Commercial devices are now available. Updated technical guidelines, standard operating protocols, and quality control/assurance guidelines have recently been published. Reference values are also available. 
We conducted oscillometry test audits before and after implementing a formal respiratory oscillometry training program and standard operating protocol. We observed improvement in the quality of tests completed, with a significant increase in the number of acceptable and reproducible measurements. 
The current paper outlines and demonstrates a standard operating protocol to conduct respiratory oscillometry in an outpatient setting. We highlight the key steps to ensuring acceptable and reproducible quality measurements according to the recommended European Respiratory Society (ERS) guidelines, as quality control is critical to measurement accuracies. Potential problems and pitfalls are also discussed with suggestions to resolve technical errors.

We demonstrate a standard operating protocol to conduct respiratory oscillometry, highlighting key quality control and assurance procedures.

Conduzione dell'oscillometria respiratoria in ambito ambulatoriale

Respiratory oscillometry is a different modality of pulmonary function testing that is increasingly used in a clinical and research setting to provide ...