Screening of Lentil Fields for Presence of Fusarium Wilt and Root Rot in Türkiye under Terrestrial Climate

Summary

A study in Yozgat province found that biotic factors, such as fungal diseases like wilt and root rot, limit lentil production. Fusarium isolates were found in 95.4% of samples, suggesting periodic local surveys and regular monitoring for sustainable technology development and effective control strategies.

Abstract

Lentil is an important self-pollinated legume crop plant. Its production is limited by various biotic factors, especially fungal agents causing the wilt and root rot complex. The study aimed to understand the regional epidemiology and etiology of phytopathogenic fungal agents to develop control strategies against soilborne Fusarium spp. This study investigated 83 lentil sowing localities in Yozgat province for wilt, root and crown rot diseases caused by common Fusarium species during 2022 and 2023. Symptomatic lentil plants were collected for fungal isolation and identification. The Fusarium isolates were grouped according to colony morphology and cultured on PDA medium. Moreover, genomic DNAs obtained from Fusarium isolates were analyzed using PCR and compared with other Fusarium isolates registered in the NCBI GenBank. Genetic relationships among Fusarium isolates were determined using the Maximum Parsimony (MP) method in the Mega 11 program. The results, mean incidence and disease severity rate of wilt and root rot diseases in Yozgat province were determined to be 16.9% and 38.6%, respectively. Fusarium isolates were found in 95.4% of the samples. There was 99.5% to 100% nucleotide sequence homogeneity among F. oxysporum, F. culmorum, F. graminearum, F. acuminatum and F. solani isolates, and the most isolated species was F. oxysporum. The MP dendrogram of Fusarium isolates was divided into two main branches, the first branch included all F. solani isolates. The second main branch included other Fusarium species isolated in the present study and in NCBI GenBank. The study suggests periodic local surveys to determine the frequency of Fusarium wilt for suppression in lentils. Timely suppression of Fusarium-based damages is strongly suggested to control the disease and conserve the lentil production system.

Introduction

Lentil (Lens culinaris Medik.), a small edible grain legume belonging to the Fabaceae family, is a self-pollinating, cool-season crop with needle-like leaves and white to pale purple or dark purple flowers¹. It was domesticated by humans about 10,000 years ago in the Mesopotamian part of the Fertile Crescent and quickly spread to the New World, including the Mediterranean Basin and Central Asia, and later it was naturalized to the Americas². The world lentil cultivation area is about 5.5 million hectares with production of 6.6 million tons³. Türkiye ranks 4^th in lentil production after Canada, India, and Australia. Lentil cultivation in Türkiye is very important and accounts for 6.7% of world production. Türkiye's total lentil production is 474,000 tons and is produced in at least 40 provinces⁴. About 89.5% of Türkiye's lentil production constitutes red and green lentils, which constitute 10.5% of the winter crop in the Southeastern Anatolia Region. The rest of the crop is grown as summer crops. Yozgat (39.5%), Konya (23.7%), Kırşehir (16.3%), Çorum (7.6%), and Ankara (2.9%) provinces largely contribute to the green lentil production⁴. Lentil production can be limited by biotic and abiotic stress factors. Frost and drought are the most common abiotic stress factors in summer green lentil production⁵. Fungal diseases like wilt, root, and crown rot complex caused by Ascochyta lentis, Rhizoctonia solani, R. bataticola, Aphanomyces euteiche, Pythium, and Fusarium species are the most important fungal diseases, which cause a combination of diseases including damping-off, seedling blight, wilt, and root rot, depending on the timing of infection, host susceptibility, and meteorological conditions^6,7,8.

Fusarium is a filamentous imperfect fungus found in soil, plants, and organic substrates and is a cosmopolitan genus among these pathogens⁹. It causes various diseases such as Fusarium wilt, root, and root collar rot, as well as Fusarium head blight in wheat, Fusarium wilt in cucurbits, and root rot in most legumes, including lentils^10,11,12. Vascular wilt, root, and root collar rot caused by Fusarium spp. is the most important disease of lentils in many lentil cultivation areas globally¹⁰. Fusarium oxysporum is the most common Fusarium species associated with wilt, root, and root collar rot in lentils. Globally, wilt, root, and crown rot diseases are caused by F. graminearum, F. sporotrichioides, F. equity, F. acuminatum, F. redolent, F. avenaceum, F. culmorum, F. solani, and F. verticillioides in lentil planting areas⁷. Wilt, root and crown rot diseases caused by Fusarium spp. occur in both seedling and adult stages and cause sudden wilting, drying, and eventual death of the leaves. Symptoms of the disease include seed rot, root rot, wilting upper leaflets, stunting, shrinkage, and curling of leaves. In the middle and late pod-filling stages, seeds are usually shrunken, and root symptoms include stunted growth, brown discoloration, damaged taproot tips, and proliferation of secondary roots. Discoloration of the vascular tissue may not be seen in all cases¹³.

In the Central Anatolia Region, studies on the status of wilt and root rot diseases in lentils have been conducted in limited numbers. Yozgat has a mild and moderate climate with abundant rainfall in winter when compared to summer and is classified as Dsb (Warm, humid terrestrial climate) by Köppen and Geiger¹⁴. The mean temperature is 9.6 °C with an average precipitation of 512 mm. Yozgat is located in the northern hemisphere. Summer occurs in June, July, August, and September. It is very important to have information about the regional epidemiology and etiology of the phytopathogenic fungal agents that cause the disease for developing different control strategies against soil-borne Fusarium spp., to control disease¹⁵. In this context, the objectives of the present study are to determine and identify - the disease parameters (disease prevalence, incidence, and severity) of wilt, root, and crown rot diseases in lentils by conducting a survey in Yozgat province, where approximately 40% of the total green lentil production is done singly, the pathogenic Fusarium species that cause wilt and root rot in lentils by morphological and molecular analyses, and to determine the individual virulence levels of the Fusarium species by carrying out pathogenicity tests.

Protocol

NOTE: The details of the reagents and the equipment used in the study are listed in the Table of Materials.

1. Field survey, sampling, and fungal isolation

NOTE: Survey work was carried out in 2022 and 2023, according to Endes¹⁶. A total of 83 lentil planting areas covering nine districts in Yozgat province were observed for wilt, root, and root collar rot disease (Figure 1).

1. Select lentil fields with over 1000 m² area as a sampling area. Collect each sample by walking randomly from the border to the center or middle of the field by zigzags walking along the diagonals using a 1 m² frame, placing it randomly at a minimum of three randomly selected different points. Collect lentil plants showing disease symptoms from each point, put them in paper bags, and transfer them to the laboratory for use in fungal isolation and identification studies.
   NOTE: The roots and root collars of diseased lentil plants transferred to the laboratory were first washed with tap water to get rid of coarse residues; later, they were subjected to surface disinfection for the isolation of the fungal pathogens as described by Endes¹⁶.
2. Soak diseased plant tissues in 70% ethanol for 10-15 s, and then rinse 3x for 3 min each in sterile water. Hold all of them in 1% sodium hypochlorite (NaOCl) for 5 min, and rinse 3x for 5 min each again with sterile water.
3. Dry the wet plant tissues on filter papers in a sterile cabinet to finish the surface disinfection process. Following this, cut the disinfected plant tissues into 5-10 mm long pieces and place 4-5 pieces on a PDA medium containing 0.01% streptomycin within Petri dishes (90 mm diameter). Put the Petri dishes in an incubator in the dark at 25 ± 1 °C for 4-7 days and observe the fungal growth.
   NOTE: The developing fungal isolates were purified through the single spore isolation method. For this purpose, the study conducted by Choi et al.¹⁷ on obtaining single spore cultures of fungi belonging to Ascomycetes, Basidiomycetes, Coelomycetes, and Hyphomycetes were modified and used as described below.
4. To purify fungal isolates, keep the fungal isolates obtained at the end of the isolation studies in an incubator at 25 ± 1 °C for 12 h of fluorescent light / 12 h of darkness for 15 days to encourage the formation of anamorphic reproduction structures on PDA.
5. Weigh about 100 mg of fungus mycelium from 15-day-old cultures with a spatula, transfer it to a 1.5 mL sterile microcentrifuge tube, and then grind it thoroughly with sterile plastic pestles for homogenization.
6. Add 1 mL of sterile water and vortex for 1 min to ensure the transfer of spores into the water. To adjust the number of spores transferring into the water, draw 20 µL of this mixture with a pipette and check the number of spores under 10x magnification of the light microscope.
7. When the amount of spores is more than the desired amount, dilute the spore-water mixture at ratios such as 1/10, 1/100, and 1/1000. Provide a mixture containing 4-6 spores in the microscope field of view.
8. Take 100 µL of the prepared spore suspension and transfer it to 90 mm diameter Petri dishes containing PDA medium supplemented with 0.1% streptomycin. Then, spread the transferred suspension on the PDA with a Drigalski spatula.
9. Incubate the prepared Petri dishes in the dark at 25 ± 1 °C for 12-24 h. At the end of this period, transfer small pieces of hyphae developed from a single conidia with an inoculation loop to a new Petri dish containing PDA medium. Each culture obtained from each spore is a single spore culture. Store these to be used in pathogenicity tests and morphological and molecular identification.
   NOTE: The main purpose is to keep fungal isolates alive for a long time without changing their morphology, genetics, and virulence. The storage process was carried out using two different methods^18,19. All the storage methods used in this study are explained in detail below.
   1. The first method to store samples is as follows. Grow fungal isolates on PDA medium at 25 ± 1 °C with a 12:12 h dark: light for 15 days to obtain 4 mm diameter mycelium disks that could be stored in sterile water.
   2. Cut mycelium discs (4 mm diameter, 10 discs) with a cork borer from fungal cultures that grew under the aforementioned conditions. Transfer the mycelium disks to microcentrifuge tubes containing 1 mL of sterile water. Keep the samples in microcentrifuge tubes in the refrigerator at -20 °C for 6 months.
   3. The second method to store samples is as follows. Firstly, take a pinch of the pure fungal disc from the single spore cultures obtained with an inoculation loop and transfer it to Petri dishes containing PDA supplemented with chloramphenicol, lactic acid, ampicillin, rifampicin, tetracycline, streptomycin, etc.
   4. Grow for 5-10 days prior to the storage process at 25 ± 1 °C with a 12 h: 12 h dark: light condition. Cut and sterilize 1 cm x 1 cm general-purpose filter papers in an autoclave at 121 °C, 15 psi for 60 min.
   5. Place the filter papers in new Petri dishes with the same or selective medium. Cut colonies/spores from pure fungal culture and place them on the top of each piece.
   6. Seal the Petri dishes and place them in an incubator at appropriate growth conditions (as mentioned above). The fungal isolates grow slowly on filter paper. Incubate for approximately 15 days to ensure complete colonization.
   7. After sporulation or complete colony formation on filter papers, transfer the individual pieces of paper to a new petri dish without a culture medium. Later, put the Petri dishes in the incubator until the filter paper and fungus are completely dry (approximately 20-30 days).
   8. After drying, put 10 pieces of filter paper in each sterile paper envelope, label each envelope, put these envelopes in plastic bags, and store the plastic bags containing the envelopes in a plastic and transparent container at -20 °C.
10. Calculate the prevalence rate of lentil wilt, root, and crown rot disease in Yozgat according to the formula given below, considering the prevalence of the disease in each lentil field, followed by the name of the district of the province.
    Disease prevalence rate (%) = (a / b) x 100
    where a indicates the number of diseased fields; b indicates the total number of surveyed fields in a district.
11. Calculate the incidence of the disease according to the weighted average method reported by Bora and Karaca²⁰. Count the plants in each square in the field. Separate them into diseased and non-diseased plants in each square and calculate disease prevalence according to the formula given below.
    Disease prevalence rate (%) = (x / y) x 100
    where x indicates the number of diseased plants; y indicates the total number of plants surveyed.
12. Calculate disease severity according to the scale 0-4 of Öğüt²¹, where 0 = showed no symptoms, 1 = mild level symptoms in 25% of leaves; 2 = moderate level symptoms in 26%-50% of leaves; 3= severe chlorosis and wilting in 51%-75% of leaves; and 4 = very severe chlorosis and wilting symptoms or drying, shedding, growth retardation or dead leaves on more than 75% plants in the same order (Figure 2).
13. Calculate disease severity using the following formula with the obtained scale values¹⁶.
    Disease Severity (%) = [∑ [ i (ni x vi) / (V) x N)] x 100
    where ni number of plants in the scale value; vi scale value; V highest scale value; N total number of plants observed; i indicates the number of classes.

2. Meteorological data

1. Conduct survey studies. For this protocol, surveys were conducted during the periods of May and June 2022 and 2023. Obtain the temperature, relative humidity, and total rainfall values for the March-July period in 2022, 2023, and long years from the Directorate of Provincial Meteorology at Yozgat (Table 1).

3. Morphological identification

1. Compare the cultural (colony color, aerial mycelium, mycelia growth rate) and conidial (conidial dimensions, shape, color, and number of septum) characteristics of the Fusarium isolates to those of earlier studies and tentatively identify fungal species.
2. Select representative samples from the groups to be used in morphological identification. Purify these samples according to the single spore isolation method as mentioned above. During this period, observe the colony pigmentation characteristics of Fusarium isolates as well as micro/macroconidia and chlamydospore structures.
3. To promote the formation of micromorphological structures such as micro/macroconidia and chlamydospores in the obtained pure fungal cultures, incubate on PDA at 25 ± 1 °C and 12 h: 12 h dark: light for 25-30 days in an incubator. Measure the length and width of conidia for each Fusarium isolate by light microscopy. In addition, document the structure, shape, color, and septa or without septa of the conidia using a light microscope supplied with a digital camera.
4. Based on the above observations, group the Fusarium isolates according to species level, as described in Leslie and Suerell²².

4. Molecular identification

NOTE: The total genomic DNA of the Fusarium isolates was extracted using the following method, which was slightly modified from the protocol of Cenis²³. PCR analyses and electrophoresis of Fusarium isolates were performed using the protocol described by Aras and Endes²⁴.

1. Fungal genomic DNA extraction
   1. From a fresh culture (10 days old) of Fusarium isolates grown on PDA, scrape 100 mg of mycelium with a sterile scalpel and then transfer it into a 2 mL microcentrifuge tube. Incubate the tubes at -20 °C overnight.
   2. After overnight incubation, add 500 µL of DNA extraction buffer (200 mM Tris-HCl pH: 8.5, 250 mM NaCl, 25 mM EDTA, 0.5% Sodium dodecyl sulfate) into the tubes and crush with a sterile plastic pestle.
   3. Subsequently, add 150 µL of 3M sodium acetate (NaOAc) pH 5.2 to the tubes and incubate at -20 °C for 30 min. After this stage, centrifuge the tubes at 4,000 x g for 10 min.
   4. After centrifugation, transfer 400 µL of the supernatant at the top of the tube to new tubes (1.5 mL) and add an equal volume of isopropanol (2-propanol). Incubate the new tubes at -20 °C for 30 min. During this time, gently mix the tubes 5x or 6x.
   5. Centrifuge at 4,000 x g for 10 min to precipitate the genomic DNA and discard all the liquid remaining in the tubes.
   6. Add 1 mL of 70% ethanol to the genomic DNA pellet as a white or cream-colored sediment at the bottom of the tube. Gently mix the tube up and down 4x-5x for approximately 1 min, discarding all the ethanol in the tubes. Then, open the tubes in laminar air flow for 30 min to completely evaporate the ethanol on the DNA pellet.
   7. To dissolve the genomic DNA and store it for a long time, add 50 µL of TE (1M Tris-HCl pH: 8.0; 0.5M EDTA pH 8.0) buffer solution to the tubes and incubate the tubes in a water bath at 65 °C for 1 h. During this time, gently mix the tube up and down 8x-10x. Store the genomic DNA dissolved in TE buffer solution in a -20 °C deep freezer for use in molecular studies.
2. For PCR studies, use oligonucleotide primers ITS5 F (5′GGAAGTAAAGTCGTAACAAGG3') / ITS4 R (5'TCCTCCGCTTATTGATATGC3') to amplify the ITS region of rDNA²⁵. Perform each PCR reaction with 2.5 µL of 10x PCR buffer, 2.5 µL of MgCl₂ (25 mM), 2.5 µL of dNTP (2 mM), 0.5 µL of each primer (10 µM), 2 µL of template DNA, 0.5 µL of Taq DNA polymerase (1 U/µL, Fermantas) and 14 µL of sQH2O in a total volume of 25 µL.
3. For the 25 µL PCR reaction, run the following PCR program 95 °C for 2 min (initial denaturation), followed by 40 cycles; 95 °C for 30 s (denaturation), 55 °C for 45 s (annealing), 72 °C for 90 s (extension) and 72 °C for 5 min (final extension). Electrophorese PCR products for 1.5 h at 90 V in 1.5% agarose gel prepared in 1x TAE (Tris Base - Glacial Acetic Acid - EDTA) buffer solution.
   1. To prepare TAE buffer for gel electrophoresis, dissolve 242 g Tris base in 700 mL of sterile water; add the 57.1 mL of Glacial acetic acid; add the 100 mL of 0.5 M EDTA solution, and adjust the volume to 1 L by adding sterile water. Adjust the final pH of the 1 L 50x TAE buffer to 8.5. To make the 1x TAE working buffer, add 49 parts of sterile water to 1 part of the 50x TAE buffer.
4. Stain the gels with 0.5 µg/mL ethidium bromide and visually inspect them by making them visible on a UV transilluminator.
5. In order to examine the phylogenetic relationship between root and crown rot agent isolates, obtain the ITS gene base sequences by PCR, which were synthesized bidirectionally (5´-3´ and 3´- 5´) through a vendor. Compare the base sequences with the gene data from the NCBI (National Center of Biotechnology Information) website and the base sequences of the ITS gene of other Fusarium isolates in the world using the Blast program. Use this to identify the isolates at the species level as described below.
   1. Go to https://www.ncbi.nlm.nih.gov website. Click on BLAST tab in the Popular Resources section.
   2. Click on the Nucleotide BLAST tab in the new window. In the Enter Query Sequence section in the new window, enter the base sequences in Fasta format, and write the name of the study in the Job Title section.
   3. Subsequently, check Standard databases (nr etc.) in the Database tab in the Choose Search Set section at the bottom.
   4. Check Highly similar sequences (megablast) in the Optimize for tab in the Program Selection section and click on the BLAST tab at the bottom of the page.
6. Use the MEGA 11 phylogenetic analysis program to determine the phylogenetic relationship between Fusarium isolates. Align the base sequences using the ClustalW program and create the genetic family trees of the isolates according to the maximum parsimony for the ITS gene²⁶.
   1. To download Mega software, go to the website https://www.megasoftware.net, and Install Mega software. MEGA software is provided FREE for use in research and education.
   2. First, save the sequences on the desktop as a Notepad file (.txt) in the FASTA format. Run the Mega software program and click on ALIGN tab. Click on Edit/Build Alignment in the window. Subsequently, check Create a New Alignment in the new window and click OK to confirm.
   3. Click on DNA tab. Delete the 1. Sequence that automatically appears in the window, and go to the Edit file, then click on Insert Sequence from File tab. Open the Notepad (.txt) file that contains the sequences and is located on the desktop.
   4. At this stage, all sequences appear on the screen. First, click on Any Sequence that appears on the screen, then mark all sequences with CTRL + A. Open the Alignment file and click Align by Clustal W from there, and click OK to run the program in default settings.
   5. After examining the differences in the alignment of the sequences, go to the Data file, click on Phylogenetic Analysis and then click on No in the checkbox in the window for whether the sequences synthesize proteins or not. Our sequences do not synthesize proteins because they belong to the ITS region.
   6. Return to the main window of Mega software. Click on Phylogeny and select Construct/Test Maximum Parsimony Tree(s). In the new window, select Bootstrap Method for the Phylogeny test and enter bootstrap values 1,000 to test Branch strength. In the Gaps/missing Data Treatment tab, select Partial Deletion, select Subtree-pruning-Regrafting (SPR) as the MP search method, and click OK to confirm the operations.
   7. Wait for analysis result to show the Phylogenetic tree.

5. Pathogenicity test

1. Use four isolates for pathogenicity studies for each representative species from the Fusarium species that were identified by molecular methods. Perform pathogenicity studies at 24 °C, 16 h of fluorescent light/8 h dark photoperiod, with 65% humidity in an air-conditioned room.
2. Sow lentil seeds in black plastic vials with 45 holes of 5 cm diameter. Keep each vial in 1% sodium hypochlorite for 3 min and then rinse with sterile distilled water 3x. Dry the seeds in a sterile cabinet for 24 h and sow with one seed in each hole.
   NOTE: The lentil seeds of the Kayı 91 variety, sensitive to the disease, were used in all pathogenicity tests⁶. The seedling immersion technique was used as the inoculation method²⁷.
3. Incubate pure cultures of each isolate in PDA at 24 °C for 7-10 days. Scrape the colonies cultivated from the stock culture from the surface of the medium with a spatula and prepare the spore/mycelium suspension using sterile distilled water.
4. Remove large residues from the suspension by filtration through a 4-layer cheesecloth and adjust the spore/mycelium concentration to 1 x 10⁶ spores/mL with the help of a hemocytometer.
5. After this stage, uproot the roots of the seedlings previously grown in the vials when they have 2-3 true leaves. Wash in tap water and slightly injure roots with a sterile needle. Immerse these seedlings in the prepared spore/mycelium suspension for 3 min and then transplant them into plastic vials containing sterile soil/peat (2:1; v/v) mixture.
6. For the seedlings used as controls, uproot their roots, injure them, and then plant them by immersing them only in sterile water. Make pathogenicity test evaluations 3 weeks after the inoculation process according to the 0-4 scale.
7. After the calculated disease severity values were subjected to angle transformation, subject the values obtained to variance analysis and evaluate the differences between the means according to Tukey's HSD (p = 0.05) test. Disease severity: Isolates with 0%-15% were evaluated as having very low virulence (LV), isolates with 16%-35% were evaluated as low virulence (LV), isolates with 36%-50% were evaluated as moderate virulence (O), isolates with 51%-70% were evaluated as high virulence (VV), isolates with 71%-100% were evaluated as very high virulence (VV) and isolates without disease symptoms were evaluated as saprophytic or epiphytic isolates.

Results

Determination of disease parameters
A total of 83 lentil sowing areas covering nine different regions of Yozgat were evaluated in terms of wilt, root, and crown rot disease symptoms were surveyed, extending over an area of 1.1984 x 10⁶ m² (Table 2). Wilt or root rot disease symptoms were encountered in all fields. However, the incidence of wilt and root rot disease in Yozgat was determined as 16.9%, with disease severity of 38....

Discussion

Fusarium wilt is known to cause serious economic yield losses in some parts of the world³¹. The disease was first reported in Hungary³² and later reported in many countries such as Egypt, India, Myanmar, Nepal, Pakistan, Türkiye, Syria, and the USA³³. Kumar et al.³⁴ reported a wide distribution of lentil wilt, root, and root collar rot with reports of occurrence in at least 26 countries worldwide. In a recent stu...

Materials

Name	Company	Catalog Number	Comments
(S)-lactic acid	Merck	100366	Was used as an antibiotic in studies.
2-propanol	Merck	109634	Used in molecular studies.
Adjustable micro automatic pipette (0.1-2.5 µL)	Eppendorf Research	LB.EP.3123000012	Used to measure small volumes of liquids.
Adjustable micro automatic pipette set (2 – 20 µl, 20 – 200 µl, 100 – 1.000 µl)	Eppendorf Research	LB.EP.4924000916	Used to measure small volumes of liquids.
Agar	Merck	110453	For use in making fungal media.
Agarose	Sigma-Aldrich	18300012	For use in gel preparation in electrophoresis.
Air conditioning room	İklimlab		Was used to grow plants under controlled conditions.
Ampisilin	Sigma-Aldrich	A9393	Was used as an antibiotic in studies.
Analytical precision balance	Shimadzu ATX224		Was used to weigh the solid materials used in the study.
Autoclave sterilizer	Zealway	GF-120DR	It was used to sterilize solid and liquid materials at every stage of the study.
Binocular microscope	Leica DM750		For use in morphological diagnosis.
Biological safety cabinet	HFsafe Class II A2		To ensure the safety of the work area, the user, the environment and the operation.
Centrifugal	DLAB DM1424	LB.DL.903001124	Used to separate particles in a sample based on their shape, size and density
Chloramphenicol	Sigma-Aldrich	220551	Was used as an antibiotic in studies.
Cork-borer set	Sigma-Aldrich	Z165220	It was used to take samples from fungus culture in petri dishes.
Cover glass and slide	ISOLAB	075.01.006 / 075.02.005	Was used in the preparation process for microscope studies.
D(+)-glucose monohydrate	Merck	108342	For use in making fungal media.
DFC450 with digital camera	Leica		Digital microscope camera with c-mount interface and with a 5 megapixel ccd sensor.
Dm750 binocular microscope	Leica	MIC5246	Was used for morphological identification of fungi.
DNA gel electrophoresis	thermo fisher scientific	B2-UVT
Dna gel loading dye (6x)	Thermo Scientific	R0611	For use in molecular diagnostics.
dNTP mix	Thermo Scientific	R0192	Used in molecular studies.
Dreamtaq pcr master mixes (2x)	Thermo Scientific	K1082	For use in molecular diagnostics.
Drigalski spatule	ISOLAB	082.03.001	It was used to scrape and spread fungal cultures grown in petri dishes.
Edta	Thermo Scientific	17892	For use in molecular diagnostics.
Ethanol	Merck	100983	Used in molecular studies and surface disinfection studies.
Ethidium bromide	Sigma-Aldrich	E7637	Used to stain dna in gels during gel electrophoresis.
Ethylenediaminetetraacetic acid (EDTA)	Sigma-Aldrich	E6758	Used in molecular studies.
Filter paper	ISOLAB	107.58.158	Used in stock culture studies.
Forced air drying cabinet	ZHICHENG ZXDS-A-1090		For use in incubation processes.
Fume hood	Elektromag EM1201	LB.EM.EM1201	It was used to control harmful chemical vapors, gases and dust.
Gel imaging system	Syngene G:BOX Chemi XX6		For use in molecular diagnostics.
Generuler 50 bp dna ladder	Thermo Scientific	SM0372	For use in molecular diagnostics.
Glacial acetic acid	Merck	1005706	Used in molecular studies.
Glycerol	Merck	104094	For use in stock culture of fungi.
Lancet	ISOLAB	048.50.002	Used to remove diseased tissue from plant samples.
Magnesium chloride	Sigma-Aldrich	814733	Used in molecular studies.
Measuring tape	ISOLAB	016.07.500	Used to measure liquid volumes.
Microcentrifuge tubes	ISOLAB	0778.03.001 / 0778.03.002 / 0778.03.003	Used to store different volumes of liquids.
PCR tube	ISOLAB	123.01.002	It was used to put dna mix in pcr studies.
Petri dishes	ISOLAB	120.13.090	For use in growing fungus culture.
Pipette tips	ISOLAB	005.01.001 / 005.01.002 / 005.01.003 / 005.01.004	To transfer liquid volumes used in analyses.
Plastic bag	ISOLAB	039.30.005	Was used to transport samples to the laboratory.
Plastic pot	ToXA		Was used for growing plants.
Pliers, clamps	ISOLAB	048.08.130	It was used to put filter papers into envelopes after the fungus grew in the petri dish.
Porcelain mortar	ISOLAB	038.02.150	Was used to crush fungal mycelia.
Potato dextrose agar	Condalab	1022	For the identification and cultivation and of fungi.
Pure water system	human CORPORATION	LT.HC.NHP009	Was used in solution preparation and analysis throughout the studies.
Refrigerator (+4 °C / -20 °C)	Vestel		For use in the storage of stock materials.
Rifampicin	Sigma-Aldrich	557303	Was used as an antibiotic in studies.
Sodium acetate	Merck	106268	Used in molecular studies.
Sodium chloride	Merck	1064041000	Used in molecular studies.
Sodium dodecyl sulfate	Sigma-Aldrich	436143	Used in molecular studies.
Sodium hypochlorite solution	Merck	105614	Used for surface disinfection.
Spatula	ISOLAB	047.33.210	It was used to scrape the fungus culture growing in petri dishes.
Streptomycın sulfate	BioShop Canada	STP101	To prevent contamination in fungal culture cultivation.
Teksoll extra pure	Tekkim	TK.200650	For use as a disinfectant in all stages of work.
Tetrasiklin	Sigma-Aldrich	T3258	Was used as an antibiotic in studies.
Thermal cycler PCR	Bio‐Rad T100		For use in genomic analyses.
Thoma lam	ISOLAB	075.03.002	For use in spore counting.
Tris HCL	Roche	10812846001	Used in molecular studies.
Trizma	Sigma-Aldrich	T1503	Used in molecular studies.
Tween 80	Merck	822187	For use in spore solution in pathogenicity testing.
Vortex mixer vorteks	Velp WIZARD	LB.VLP.F202A0175	Used to mix substances in liquid volumes.
Water baths	Memmert WNB 22	1018-5702	It was used during incubation in dna extraction studies.