이 작품은 보조금 CRUK 15043 및 CRU​​K 14251에 의해 지원되었다. 우리는 기술 지원 및 원고의 중요한 읽기 다니엘 Wetterskog 및 카 케이 호 감사합니다.

응답 마커 1. 실험 섭동과 셀 라벨 (역 형질의 siRNA 화면) <ol><li> 멸균 조직 문화 후드 피펫에서 멸균, 일반 96 웰 플레이트의 우물에서 1X siRNA를 버퍼에 200 nM의 siRNA를 70 μL. 무 혈청 DMEM 매체의 볼륨 (40)로 형질 전환 된 지질 희석시키고 각 웰에 siRNA를 함유하는 105 μl를 분배. 참고 : 무 혈청 DMEM의 10.5 ml의에 262.5 μL 지질를 희석은 물론 당 지질의 2.6 μl를 제공, siRNA를의 전체 96 웰 플레이트에 적합한 마스터 믹스를 얻을 수 있습니다. 이 단계에서 200 nM의 siRNA를 시작 농도의 사용 단계 1.3에서 20 nm의 작업 농도를 제공 할 것입니다,하지만 절차는 적절하게 조정 시작 농도 (즉, 50 ㎚)로, 5 nm의 아래로 농도를 작업에 작동합니다. 그들에 응답하여 타겟의 크기를 감소시킬 수 있지만, 낮은 농도는 작동 온 타지 증가로 이어지는, 오프 - 타겟 스코어 위양성을 감소시킬 수있다위음성 율을 t. </li><li> 실온 전해조 부드럽게 진동 플레이트 섞는다. 세 50 μL로 결과 175 μl를 하위 분할은 투명 기재와, 96 웰 플레이트 처리 불투명, 조직 배양에 목표 PER 복제합니다. </li><li> 50 μL - 지질 복합체에 직접 siRNA를 10 % 혈청을 함유하는 150 μL의 DMEM에 웰 당 8,000 세포를 분배함으로써 역방향 트랜. 사용 HCT116 인간의 대장 암 세포를 안정적으로 CDK2 활동 5,8를보고 GFP 태그가 지정된 마커를 표현. 더 이상 혼합이 필요하지 않습니다. 습도를 제어하고 판 &#39;에지 효과&#39;를 방지하고 48 시간 동안 37 ° C, 5 % CO 2에서 가습 인큐베이터에 접시를 배치 멸균, 접착제 통기성 멤브레인 플레이트를 밀봉합니다. </li><li> 용지의 잔량이 적은 것을 웰에 남아 매체는 기음. 각 웰에 4 % 완충 포름 알데히드 100 ㎕를 첨가하여 세포를 고정시키고 실온 t에서 10 분 동안 흄 후드에서 부화칼 럼. </li><li> 접시를 흡입하여 고정 솔루션을 제거합니다. 어느 이때하는 플레이트를 한 다음 100 ㎕의 인산 완충 식염수 (PBS)로 세 번 세척하여 실험 중지는 주까지 4 ℃에서 어둠 속에서, PBS 100 ㎕ 하에서 밀봉 또는 진행 저장할 세포 투과성으로. 참고 : 우리는 고정 후 가능한 빨리 처리 판을 추천, 일반적으로 완전히 처리 플레이트의 스토리지를 선호합니다. 예컨대 치메로살, 아 지드 화 나트륨, 또는 상업적 대안으로서 살충 보존제 micoroganismal 성장을 방지하기 위해 첨가 될 수있다. 포스파타제 억제제를 첨가 포스 에피토프를 유지하도록 돕고, 다른 수단에 관련된 분석 콘텍스트에서 유용 할 수있는 단백질의 변형 상태를 보존 </li><li> 플레이트로부터 제거하고 PBS를 투과성으로 용액 100 ㎕를 첨가하여 세포를 Permeabilize 하시려면. 진탕없이 실온에서 10 분 동안 인큐베이션. multich를 사용하여 투과성으로 솔루션을 기음annel 피펫. 이 단계를 세 번 반복합니다. </li><li> 실온에서 30 분 동안 웰 당 100 μL 블록 용액을 첨가하여 세포를 차단. 실온에서 어둠 속에서 2 시간 동안 차단 용액에 500 배 희석 안티 P-S780의 RB1 항체 50 μL와 프로브, 플레이트를 흡입하여 블록 용액을 제거한다. </li><li> 5 분마다의 접시에 솔루션을 떠나, 100 μL 판 세척 용액으로 판을 세 번 씻으십시오. 염색질 특정 DNA 염료 Bisbenzimide 2 μM 보충 블록 솔루션 50 μl의 형광 표지 된 이차 항체 희석 1,000 배와 4 ° C에서 밤새 어둠 속에서 접시를 프로브. 4 ° C에서 어둠 속에서 100 μl의 PBS에서, 이전에 저장 밀봉으로 판을 세 번 씻으십시오. 이미지 2 주 이내에 접시입니다. </li></ol> 2. 이미징 및 영상 분할 <ol><li> 별도 취할 20 배의 목적으로 공 초점 또는 회전하는 디스크 형광 현미경을 사용하여 16- 비트, DNA 염료, GFP 및 면역 염색 형광체에 해당하는 세 개의 채널에서 그레이 스케일 TIFF 이미지. 비 중첩 이미지 세트 많은, 잘 당 이미지, 프레임으로 여기에 약 1,000-2,000 세포를 언급 캡처합니다. </li><li> 각각의 파일 이름 &#39;실험 이름&#39;, &#39;잘 어드레스&#39;의 순서로 &#39;프레임 번호&#39;및 &#39;채널 식별자&#39;(도 3)의 고유 한 조합이되도록 체계적 이미지 파일 이름. 예를 들어, 데이터 세트는 &quot;블루&quot;(염색질의 DNA 염색) 또는 &quot;녹색&quot;(GFP) 또는 &quot;레드&quot;채널 식별자로 (면역 염색 형광)을 사용합니다. 웰 주소, 프레임 번호 및 채널 식별자는 상기 이미지에 메타 데이터라고 칭한다. 혼란 잘 프레임 메타 데이터를 피하기 위해 밑줄 기호를 사용합니다. </li><li> 지정된 순서에 따라 메타 데이터 요소와 파일 이름을 지정합니다. 이는 후속 단계들은 소프트웨어 이리와! 빨리되도록하는 데 필요분석을위한 이미지 ctly 그룹 설정합니다. </li><li> 프리웨어 셀 프로파일을 다운로드하여 설치, 액티브 펄 커뮤니티 에디션, R 통계 프로그래밍 환경과 RStudio. 설치시 기본 옵션을 모두 수락; 액티브 펄을 설치 한 PC 사용자는 메시지 곳 PATH, 파일 확장자 협회 및 스크립트 매핑과 관련된 모든 옵션을 사용하도록 설정해야합니다. 액티브 펄은 Mac 사용자를위한 선택 사항이지만 그들은 그렇지 않으면 터미널 명령 줄에서 단계 3.2보다는 아이콘 클릭을 사용하여 Perl 스크립트를 실행해야합니다. </li><li> &#39;파일&#39; &#39;파일&#39;다음 &#39;가져 오기 파이프 라인&#39;을 클릭, 셀 프로파일 러 소프트웨어를 열고 파일 3_channels_pipeline.cppipe (그림 S1A 및 S1B)를 선택합니다. 이 파일은 설명 파일 이름 규칙에서 이미지 파일의 메타 데이터를 해석 할 수있는 소프트웨어에 필요한 지침이 포함되어 있습니다. 셀 프로파일 러는 이제 일에서 핵 DNA 항체 농도를 추출, 이미지에 관한양반과 각 셀에 대해 검출 (도 4 및 5) 세포질 강도 대 핵의 비율을 계산하는 GFP 채널을 사용한다. </li><li> 셀 프로파일 러 창의 왼쪽 아래 모서리에있는 버튼을 &#39;보기 출력 설정&#39;을 클릭합니다. 새로운 화면 상단의 &#39;기본 입력 폴더&#39;와 &#39;기본 출력 폴더&#39;라고 표시된 텍스트 상자입니다. 한번에 하나는,이 상자의 우측에 폴더 아이콘을 클릭하고 (S1C도)를 각각 추출 된 데이터에 대한 분석을위한 이미지 파일의 위치와 목적지를 선택한다. </li><li> 셀 프로파일 러의 왼쪽 하단 모서리에있는 &#39;분석 이미지&#39;버튼을 눌러 이미지 분석을 시작합니다. 화면 하단에있는 데이터 추출, &#39;STOP 분석&#39;과 &#39;일시 정지&#39;버튼의 남은 시간을 관찰합니다. 필요한 경우에 유용합니다 언제든지에서 &#39;일시 정지&#39;버튼을 선택하여 분석을 일시 중지영상을 시청하는 것이 분석되는 경우 (단계 2.8 참조). </li><li> 선택적으로, 프로그램 창 (그림 S1D)의 맨 왼쪽에있는 패널에서 눈 아이콘을 클릭하여 이미지 분석 단계 중 하나의 창을 엽니 다. 셀 프로파일의 현재 설정은 이미지 분할이 적합한 수행 (이러한 설정 수정에 대한 조언을 그림 1 및 토론 참조) 확인하기 위해 &#39;IdentifyPrimaryObjects&#39;창 &#39;차&#39;와 &#39;고등 객체&#39;에 대한 사람들을 관찰한다. </li><li> 분석이 완료되면 메시지 상자가 나타나면 &#39;확인&#39;을 클릭합니다. 결과에 모든 데이터 파일이 쉼표로 구분 된 값 (.csv) 파일 (그림 S2A)로 저장되는 위치 &#39;기본 출력 폴더&#39;로 이동합니다. </li></ol> 3. 데이터 추출 <ol><li> 사이에 포함 된 새 파일 &#39;Nuclei.csv&#39;을 찾기셀 프로파일에서 출력. 이 파일은 형광 핵 항체 강도, 핵 DNA 강도와 GFP-CDK2 기자 비율 값 (도 6A 및 S2A)에 대한 개별 셀의 데이터가 포함되어 있습니다. 주의 : 다른 실험실 분석 자신의 성질에 맞게 이러한 유형의 데이터를 처리 할 것이다. 항체 제공된 데이터 및 펄 스크립트 &#39;2_gate_classifier.pl&#39;를 이용하여 GFP-CDK2 리포터 값에 따라 각각의 처리 조건에서 세포의 게이팅은 현재 제안 된 데이터이다. </li><li> &#39;Nuclei.csv&#39;데이터 파일 (그림 S2A)와 동일한 폴더에 제공 Perl 스크립트 파일 &#39;2_gate_classifier.pl&#39;를 복사합니다. 두 번 클릭하여 Perl 스크립트의 아이콘과 메시지가 표시되면, 세포가 항체 마지막으로 게이트 값 게이트 및 작성할 수있는 파일의 &#39;.CSV&#39;파일 이름 이름 다음에 데이터 파일의 전체 이름을 입력형광 및 GFP-CDK2 기자 데이터. 참고 : 주로 게이트 설정을 확인하고 데이터의 분석을 위해 이러한를 적용하는 방법이 대표적인 데이터 섹션 및 그림 6에 아래에 설명되어 있습니다 (데이터 제공 사용 &#39;0.004&#39;각각 &#39;1.5&#39;, 분석). Mac 사용자가 입력하여 터미널 명령 행에서 Perl 스크립트를 실행해야합니다 : &#39;펄 2_gate_classifier.pl을&#39;. </li><li> 각 웰에서 각 셀은 모두 게이트 (그림 6C)에 대해 수행하는 방법을 보여 하위 집단 레이블 원래 셀 프로파일 데이터로부터 원료 개별 셀의 분석 값을 결합하여 새로 생성 된 파일을 확인하십시오. </li><li> RStudio 소프트웨어를 개방함으로써 개별 셀 모집단 라벨을 사용하여 각 실험 조건에 대한 데이터를 그린다. &#39;파일&#39;과 &#39;파일 열기&#39;를 클릭 한 후 제공 &#39;analysis.r&#39;파일을 선택합니다. 도 6B 음모 명령을 관찰, <sRStudio (도 S2B)의 상부 좌측 창 trong&gt; (7, 8). 왼쪽 창에서, 선, 5, 6에 큰 따옴표 기호 사이에, 게이트 데이터를 포함하는 폴더의 컴퓨터 주소를 입력합니다. ( &quot;/ 분석 폴더 / 분석 출력 C&quot;와 &quot;nuclei_gated.csv&quot;예를 들어,) 드라이브 문자와 각각 파일 자체의 이름을 포함합니다. 주 : RStudio 주어진 컴퓨터를 처음 사용하는 경우, R 그래픽 패키지 &#39;ggplot2&#39;이 처음 설치 될 필요가있을 것이다. 이는이 단계가 중복이되는 후 RStudio의 새 설치에 대해 한 번만 단계입니다. &#39;ggplot2&#39;를 설치하려면, RStudio의 오른쪽 하단 모서리에있는 창 위의 &#39;패키지&#39;라는 탭을 클릭이 아래에 나타납니다 &#39;패키지 설치&#39;버튼을 클릭합니다. 새 창이 나타납니다. &#39;패키지의 타입으로&#39;ggplot2 &#39;(생략 인용)이 새 창에서 속도와 마지막 단계 3.6에서 계속 창을 닫으 필요한 ggplot2 기능을 설치하고 주 RStudio 창으로 돌아갑니다 &#39;설치&#39;버튼을 클릭합니다. </li><li> RStudio의 왼쪽 창에서 17을 통해 강조 라인 한 후 &#39;실행&#39;버튼을 클릭합니다. 이 R (그림 S2C)에 실험 데이터, 임계 값과 잘 위치 세부 정보를 입력 할 수 있습니다. R 지금은 일시적으로 플로팅 관련 데이터를 개최한다. </li><li> 라인 (17) 아래에있는 나머지 코드의 각각의 블록을 선택하고 이전과 &#39;실행&#39;버튼을 클릭하여 해당 플롯을 만들 수 있습니다. RStudio의 오른쪽 하단 모서리에있는 창에 플롯을 관찰하고 &#39;내보내기&#39;버튼 (그림 S2D)을 클릭하여 형식의 수를 저장합니다. </li><li> RStudio을 닫는 동안 메시지가 표시되면 &#39;저장 안함&#39;을 클릭합니다. 이것은 그렇지 않으면 데이터를 개최한다 RStudio의 다음 사용에 혼란을 방지이전 세션에서. </li></ol>

<ol>
	<li>Carpenter, A. E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=CellProfiler:+image+analysis+software+for+identifying+and+quantifying+cell+phenotypes.">CellProfiler: image analysis software for identifying and quantifying cell phenotypes.</a> Genome Biol. 7 (10), 100 (2006).</li><li>Khan, A., Eldaly, H., Rajpoot, N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+gamma-gaussian+mixture+model+for+detection+of+mitotic+cells+in+breast+cancer+histopathology+images.">A gamma-gaussian mixture model for detection of mitotic cells in breast cancer histopathology images.</a> J Pathol Inform. 4, 11 (2013).</li><li>Selzer, P., Beibel, M., Gubler, H., Parker, C. N., Gabriel, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Comparison+of+multivariate+data+analysis+strategies+for+high-content+screening.">Comparison of multivariate data analysis strategies for high-content screening.</a> J Biomol Screen. 16 (3), 338-347 (2011).</li><li>Lyman, S. K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High+content,+high-throughput+analysis+of+cell+cycle+perturbations+induced+by+the+HSP90+inhibitor+XL888.">High content, high-throughput analysis of cell cycle perturbations induced by the HSP90 inhibitor XL888.</a> PLoS One. 6 (3), e17692 (2011).</li><li>Richardson, E., Stockwell, S. R., Li, H., Aherne, W., Cuomo, M. E., Mittnacht, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mechanism-based+screen+establishes+signalling+framework+for+DNA+damage-associated+G1+checkpoint+response.">Mechanism-based screen establishes signalling framework for DNA damage-associated G1 checkpoint response.</a> PLoS One. 7 (2), e17692 (2012).</li><li>Heynen-Genel, S., Pache, L., Chanda, S. K., Rosen, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Functional+genomic+and+high-content+screening+for+target+discovery+and+deconvolution.">Functional genomic and high-content screening for target discovery and deconvolution.</a> Expert Opin Drug Discov. 7 (10), 955-968 (2012).</li><li>Krausz, E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High-content+siRNA+screening.">High-content siRNA screening.</a> Mol Biosyst. 3 (4), 232-240 (2007).</li><li>Gu, J., Xia, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cell+Cycle-dependent+Regulation+of+a+Human+DNA+Helicase+That+Localizes+in.">Cell Cycle-dependent Regulation of a Human DNA Helicase That Localizes in.</a> DNA Damage Foci. Mol Biol Cell. 15 (7), 3320-3332 (2004).</li><li>Mittnacht, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Control+of+pRB+phosphorylation.">Control of pRB phosphorylation.</a> Curr Opin Genet Dev. 8 (1), 21-27 (1998).</li><li>Mittnacht, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+retinoblastoma+protein--from+bench+to+bedside.">The retinoblastoma protein--from bench to bedside.</a> Eur J Cell Biol. 84 (2-3), 97-107 (2005).</li><li>Nybo, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=GFP+imaging+in+fixed+cells.">GFP imaging in fixed cells.</a> BioTechniques. 52 (6), 359-360 (2012).</li><li>Schwartz, R. L., Foy, B. D., Phoenix, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Learning Perl - Making Easy Things Easy and Hard Things Possible. , 1-363 (2011).</li><li>Wickham, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> ggplot2: Elegant Graphics for Data Analysis. , 978-970 (2009).</li></ol>

저자는 공개 아무것도 없어

설명한 워크 플로우의 siRNA, 후속 마커 검출을 통해 세포의 멀티 웰 동요하는 절차를 구성하고, 최종적으로 얻어진 형광 현미경 이미지에서 정량적 데이터의 추출을 용이하게하기 위해 소프트웨어를 지원하는 일련의 단계의 사용. 접근 방식은 많은 셀 기반 응용 프로그램의 광범위한 실용적인 응용 프로그램을 가지고 각각의 세포 핵 및 세포질 강도 값의 전달에 초점을 맞추고 있습니다. 여기에 사용되는 예시적인 데이터는 G1 단계에서 세포주기 통과 두 형광 분석법을 시험하고 다시 핵 DNA 함량의 직접적인 상관 관계를 측정하기 위해 생물 물리학 된 siRNA의 설정 화면이 생성 되었음. 그것은 개별 셀을 식별 할 수있게하고, 생성 된 &#39;핵 마스크&#39;대응 cytoplasmi를 식별 할 시작점 역할로서 화상 핵 DNA에 형광 DNA 얼룩의 사용은 이미지 분할 과정에서 필수적인 단계이다C 지역. 안정적으로 세포에서 발현되는 GFP-CDK2 태그 기자, 아직이 구획 묘사 될 수있는 세포질 배경 신호보다 일관되게 더 높은 변수를 제공한다. 동일한 분석 파이프 라인은 다른 적합한 형광 결합 기자 동요 그들의 응답을 이용하여 단백질 전좌 이벤트의 분석에 적용 할 수 있어야한다. 또한, 세포질 특정 형광 염료로 GFP 리포터-CDK2 치환하면이 알고리즘의 대안적인 사용은 세포질의 치수와 이미지의 상대적인 세포의 크기를 측정 할 수있는 것이다. 여기에 설명 된 영상 분할 전략 디자인의 또 다른 고려 사항은 DNA 정량화 통합 강도 값들을 제공하는 셀 프로파일의 사용이다. 강도의 통합 염색 데이터가 핵의 크기는 가능한 변화를 허용 핵 DNA에 대한 값 및 본 정량 프로파일 근접한을 나타냅니다대한 프로피 디움 요오드 스테인드 FACS 데이터. 그러나, 통합 강도는 항원 형광의 평균 강도로 예시 평균 농도가 더 생물학적 세포 구획 내 단백질 (및 관련 형광)의 집적 총량보다 중요한 곳 단백질 기능을 평가하는 적절한 수단을 제공하지 않을 수있다. 따라서 강도 값이 P-S780 RB1 및 GFP 데이터에 사용 된 것을 의미한다. 이 옵션은 셀 프로파일 러 소프트웨어의 &#39;ExportToSpreadsheet&#39;패널에서 발견되는 두 가지 모드 (평균 또는 통합) 데이터 평가의 사이에 변경합니다. 3_channels_pipeline.cppipe 파일 분석 설정은 예를 들어 데이터 세트의 이미지에 대해 최적화된다. 이 프로토콜을 사용하여 새 이미지 세트의 분석은 파일 이름이 명명 규칙은 위의 (그림 3) 기술 채택 할 것을 요구합니다. 또한, 감도는 배경에 대한 핵 DNA 염색 및 임계 값의 밝기에 맞게 값새 이미지 세트의 강도가 셀 프로파일 설정에서 조정해야 할 수도 있습니다. DNA 염색은 다양한 이미지 분할 마스크를 구축하기위한 보유 중요한 역할을 감안할 때,이 채널에 대한 정확한 감도 설정의인가는 셀 프로파일 소프트웨어와 새로운 영상 데이터의 성공적인 분석에 중요하다. 제공되는 셀 프로파일 설정 파일 (3_channels_pipeline.cppipe)는 새로운 데이터에 대한 분석을 적응에 가장 자주 유용한 매개 변수에 대한 메모가 포함되어 있습니다. 이 노트는 셀 프로파일 메인 윈도우 화면 상단의 텍스트 박스에 있고 민감도 설정을 변경하고 채널 수가 분석 될 조정에 대한 지침을 포함한다. 새로운 이미지 데이터에 대한 설정을 테스트하는 프로토콜의 2.8 절에 기소로 (그림 S1D &#39;... 확인 된 개체&#39;의 각각에 대해 &#39;눈&#39;아이콘을 열고 클릭하여 프로토콜 단계를 이미지 분석시 이미지 분할을 관찰 할 필요가있다 </strong&gt;). 핵 마스크가 올바르게 DNA 염색 이미지에서 식별된다면 특히, &#39;IdentifyPrimaryOjects&#39;를 통해 화상 데이터의 시각화 보여줄 것이다. &#39;IdentifyPrimaryOjects&#39;모듈의 셀 프로파일 러 소프트웨어 페이지에서 임계 값 보정 계수이다. 이 값의 시행 착오를 조정은 대부분의 핵 인식 오류를 수정합니다. 값은 각 이미지에 대해 배경 강도 DNA 채널 균형. 임계 값 보정 계수의 값은이보다 더 (일반 이미지에 대 한 좋은) 엄격한 미만 1 관대 한 (염색 및 배경의 적은 콘트라스트 이미지에 적합)입니다 1, 주위에 힌지. 셀 프로파일에서 개별 셀 데이터의 출력은 원시 다른 연구의 요구에 맞는 다양한 방식으로 분석 될 수있다. 여기에 도시 한 데이터로부터 생물학적 경향을 추출 돕기 위해 셀에 따라 측정 파라미터의 2 개에 게이트를 적용하는 펄 스크립트의 사용이다추가 측정으로 확인 된 개체군의 개발 허가 상호 참조. 그것이 셀 프로파일의 프레임 워크 내에서 게이팅의 요소를 포함 할 수도 있지만 동등하게, 여기서 사용되는 대체 경로가 큰 데이터 세트가 평가 될 필요가있는 경우 특히, 유연성 및 속도를 제공한다. 현재 프로토콜의 사후 이미지 수집 단계에서 가장 느린 단계는 셀 프로파일 러 소프트웨어의 실행이다. 필요한 경우 셀 프로파일 러는 여기에 다른 게이트 값을 반복적으로,보다 신속하게 후속 펄 스크립트를 재분석 할 수있는 게이팅 원시 데이터 세트를 생성하기 위해 게이트를 부과하지 않고 실행됩니다. 모든 연구는이 같은 적합한 게이트 값이 잠재적으로 시간이 지남에 따라 데이터의 특정 세트에 시약과 다를 수 있고 사전에 알 수 있습니다. 이 때문에, 적합한 가치있는 게이트를 식별하기 위해 양성 대조군 및 모델 섭동 전지용 셀 프로파일로부터 얻어진 원시 데이터 분포를 나타내는 히스토그램을 생성하는 추천관심의 매개 변수에 대한 말이지. 펄 스크립트는 셀 프로파일의 데이터를 엄격하게 정의 된 열 구조를 받아 작성하고 사용자가 &#39;ExportToSpreadsheet&#39;설정을 사용하여 셀 프로파일에 의해 매개 변수 출력의 수를 수정하는 경우 작동하지 않을 수 있습니다. 노트 펄 스크립트 파일에 포함 된 설정의 수정을 구현하는 데 도움합니다. 이러한 텍스트 편집기에서 스크립트보기를 참조하기 위해, 바람직하게는 프로그래머의 텍스트 편집기 (예를 들어, http://www.activestate.com/komodo-edit) 컬러 코드 펄 요소로 설정. 데이터 형식의 변화에​​ 적응하기 위해 스크립트를 조정하는 곳이 노트를 나타냅니다. 펄 스크립트와 유사하게, 이미지 분석 데이터로부터 인물 플로팅 명령을 포함 제공된 R-코드 파일 (analysis.r)는, 사용 및 적응에 대한 추가적인 정보를 참조하는 텍스트 편집기 또는 RStudio 소프트웨어에서 판독 할 수있다. 이 노트는 정규 표현식 펄 &lt;에 대한 자세한 내용을 보충 할 수있다SUP&gt; (12) 및 데이터 판독 주석 각각 플롯 방법에 대한 기초를 형성하는 둘 R, 13 대 ggplot2 패키지. 형광 현미경을 사용하여 새로운 연구뿐만 아니라 오픈 소스 공보 증착 원 데이터는 여기에 기재된 것과 같은 분석 방법 의무이다. 하이 콘텐츠 데이터의 본질은 임의의 주어진 관찰자의 연구 분야에 따라 다른 분석 역점으로 재귀 분석 빌려 준다. 상기 데이터의 요청받을 수 질문 원래 사용 프로브에 의해 제한되지만, 화상 데이터는 종종 의미들을 생성 연구 다루지 재분석 될 수있다.

여기에 제시된 작품은 각각의 세포와 정의 세포 내 영역을 식별하기 위해 부착 세포의 형광 현미경 이미지의 알고리즘을 유도 분석을 수행하기 위해 무료로 사용할 수있는 소프트웨어 셀 프로파일 러를 사용하는 방법을 설명한다. 이미지 분할이라고도 이러한 접근 방식은, 각 셀 또는 (분절화 된 객체 라 함) 세포 내 영역에 국부적 인 형광 표지 된 마커를 정량함으로써 묘화 셀의 후속 멀티 파라미터 분석을 허용한다. 이 흐름은 높은 함량 분석을 가능하게하기위한 기초를 구성하고, 추가로 개발 된 멀티 파라 맞게 수정, 개별 셀은 특수 고 함량 악기 또는 독점 소프트웨어에 액세스하지 않고도 실험실에서 분석 할 수있는 도구의 역할을하도록 의도된다. 이 원고가 공급 설명한 파일을 생성하는 분석 관련 미가공 이미지 데이터, 알고리즘 설정 및지지 스크립트 테스트 세트를 포함한다. 제공된 알고리즘 설정 F또는 셀 프로파일 설정 예제 데이터 및 조정이 다른 연구에서 이미지 데이터의 사용을 활성화 할 필요가있다 어떤 토론 섹션 세부 사항에 최적화되어 있습니다. 정량적 데이터 셀 프로파일을 사용하여 추출되고 나면, 다른 실험실 원시 데이터의 개별 셀 값에 의해 제공된 정보를 사용하는 방법에 대해 다른 요건을 가질 수있다; 여기에 표시된 게이트는 각각의 분석에 대한 원시 데이터에 적용되는 하나의 방법입니다. 이러한 게이트 사용 데이터는 게이트에 의해 정의 된 응답을받은 세포의 개체군과 다른 처리를 연결 추세 시각화를 허용 응답 이진면으로 변환된다. 게이트는 각 관련 측정을 위해 적절한 음성 및 양성 컨트롤에 대한 얻은 데이터 분포의 관찰에 기초하여 설정된다. 게이트의 사용 원료, 셀 기반 측정을 관리하는 방법의 한 예이다. 또한 여기에 표시된 핵 DNA 강도의 사용이다 나게이트 데이터와 함께 값의 연속적인 범위로 자신의 원시 형태 asurements. 이미지 분석 데이터를 관리 할 수​​있는 다른 방법들이 연구의 특성에 따라 고려되어야한다; 소집단에 셀을 할당하는 게이트를 사용하는 대안 통계적 파라미터들의 많은 수를 세보고되었다 걸쳐 높은 컨텐츠 데이터를 요약하는 전략이 체계적인 비교를보고되었다. 6 - 이미지 데이터의 고 함량의 분석은 약물 반응 세포 연구에도 사용되어왔다 유전학 4 시그널링 환경 스트레스 역방향. 고 함량 분석의 장점은 형광 현미경 데이터의 알고리즘 분석 및 정량 공간 파라미터가 개별 셀 7 걸쳐 동시에 고려 될 수 있다는 사실로부터 유래한다. 이러한 방식으로, 다수의 분석 결과는 셀룰러 분석-D의 상호 참조, 차동 동작 될 수있다efined 세포 개체군은 형태 학적 변수의 고려를 포함 할 수 있습니다 실험 조건과 분석에서 추적 할 수 있습니다. 전략 및 분석 워크 플로우는 다른 높은 콘텐츠 접근에 관해서는, 각각의 세포에 교차 참조 다중화 된 데이터를 제공 할 수있다, 여기에서 논의. 형광 현미경 이미지를 생성하고 이미지의 수천을 통해 처리량이 낮은 기존의 형광 기반의 현미경에서 생성 된 이미지의 수십에 이르기까지 데이터의 분석에 적용 할 수있는 높은 콘텐츠 방법 정장 연구 자동화 높은 콘텐츠 심사 플랫폼을 사용하여 제조. 흐름은 별도 분석법 핵 형광 표지 강도 또는 각각 형광 리포터 단백질의 핵 / 세포질 전좌, 하나의 관점에서 측정되는 예를 들어 데이터와 함께 여기에 설명된다. 흐름은이 분석법 별도로 또는 조합하여 고려 EAC에 따라 될 수 있다는 점에서 유연시간은 다른 연구자들에 의해 연구 문제를 주어진. 예를 들어 데이터는 RNA 간섭 (RNAi의) 실험 (도 1)의 일부로서 생성된다. 작은 간섭 RNA 올리고 뉴클레오티드 (siRNA의)는 사이클린 의존성 키나제 (CDK) 활동의 두 형광 기자의 변경 사항이 발생할 HCT116 인간의 대장 암 세포에서 특정 단백질을 녹다운하는 데 사용됩니다. 세린 핵 망막 모세포종 단백질 780 (P-S780의 RB1)의 CDK6 의존성 인산화 항체 염색에 의해 평가된다. 동일한 셀에서, CDK2 활성 (GFP-CDK2 기자)의 녹색 형광 단백질 표지 된 리포터는 CDK2 활성의 부재하에 리포터가 세포질로 핵 및 CDK2 활성 셔틀에있는 세포질 비율 핵에 의해 평가되고 8. 또한, 각 셀의 DNA는 핵 DNA 인터 - 염료를 사용하여 염색하고, 이미지의 경계를 핵 세포를 식별하고 정의하기위한 수단을 구성한다 Bisbenzimide뿐만DNA 풍부 세포의 세포주기의 위치에 대한 정보를 제공한다 (그림 2)의 SA 측정. CDK2 및 CDK6의 활성은 세포주기 (5)의 S G1 단계로의 세포 수송과 같은 검출 가능한 그러한 개별 셀 내의 두 기자 간의 일치도 확대가 예상되는 바와 같이, 서로 9,10 성공할. 여기서 사용되는 데이터 세트는 데모의 siRNA의 효과 CDK6, 망막 모세포종 단백질 (RB1) 및 비 - 타겟팅 음성 대조군 (표 1)을 대상으로 예로서 분석한다. CDK6의 녹다운 P-S780의 RB1 에피토프의 저하 및 세포주기의 G1 단계에서 세포의 축적을 유도한다 모두. RB1 녹다운는 포스 S780 항체의 특이성 시약 제어부로서 기능한다. 포르말린에서 형광 현미경 이미지는 형광 염색 HCT116 조직 배양 세포를 이미지 분석 알고리즘에 사용되는, 11 고정. 결과 숫자 데이터는 데 사용됩니다상호 참조 기자와는 다른 최저 상태의 영향을 측정. 이러한 유형의 분석에 의해 생성 된 데이터의 크기는 정상 전위 분석 도구에 도전을 제공 할 수있다. 예를 들어, 개별 데이터 셀은 스프레드 시트 소프트웨어 일부가 수용 할 수보다 클 수있다. 큰 데이터 세트의 분석을 돕기 위해 데이터의 단순, 높은 반복, 감독 처리를 수행 펄 스크립트가 포함되어 있습니다. 펄 스크립트는 특정 파일 명명 규칙 (도 3)와 함께 이미지 파일을 처리 할 때 셀 프로파일에 의해 생성되는 출력 파일에 대해 특별히 기록하고 분석에 사용되는 웰 당 분야의 가변 수 있도록되어있다. 그것은 세포 아 집단 5 ​​동향을 추적 게이트 개별 세포 분석 데이터에 자주 중요하고 여기에 도시 각 분석 유형에 대해 소정 세트 게이트에 기초하여 각각의 셀은 플래그 펄 스크립트의 사용이다. 또한 포함 된 옵션 펄 스크립트는이는 개별 우물 (또는 조건)에 대한 데이터 결과를 요약, 제공 : 세트 게이트 내에서 세포와 원시 분석 점수의 평균 값의 비율입니다. 응답이 전부 또는 웰 내의 다수의 셀에 영향을주는 곳 시청 데이터를 후자보다 균질 방법은 유효하다. 전술 한 바와 같이, 이러한 평가는 응답이 모집단 내의 셀의 서브 세트로 한정되는 개별 셀 데이터 게이팅 의해 수득보다 덜 유용하다. 설명한 워크 플로우의 유틸리티 또는 siRNA에 기재된 마커 분석에 의해 섭동에 한정되지 않는다. 연구는 siRNA를 조합, 화학 억제제 및 방사선 치료를 사용하여 조직 배양 실험에서와 CDK6 이외의 마커와 CDK2 활동 (5)의 평가에 대한 응답을 분석하기 위해이 방법을 사용했다. 개념적으로, 실험적 전략은 생물학적으로 유용한 세포 내 영역의 다양한 자동으로 등록 할 수 있습니다형광 현미경 이미지에 존재하는 각각의 세포에. 이와 같이,이 접근 방법은 개체군보다는 개별 셀에 초점 기술을 통해 누락 될 수 정량, 다중화 데이터 드러내는 생체 정보를 얻을 수있다. 약간의 수정으로 기술 된 접근 및 분석 워크 플로우는 형광 기반의 분석 출력 및 세포 생물학적 반응에 대한 양적, 개별 셀의 데이터를 얻을 수있는 DNA 함량의 정량적 평가, 핵이나 세포질 형광의 정량 또는 이들 사이에 마커의 셔틀 링 두 구획 개별적으로 또는 다중화 방식은 흥미 롭다. 출판 요구 사항은 점점 더 게시 된 데이터를 재분석을 찾고 실험실에도 직접적인 관심이 될 것입니다 여기에 설명 된 것과 같은 공개적으로 접근 원시 데이터에 대한 액세스 및 현미경 이미지 분석을위한 무료 도구에 익숙 제출을 향해 경향이있다.

<table border="0" cellpadding="0" cellspacing="0" width="604">
	<tbody>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Name of Material/ Equipment</td>
			<td style="width:103px;">Company</td>
			<td style="width:119px;">Catalog Number</td>
			<td style="width:167px;">Comments/Description</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">AllStars negative control siRNA</td>
			<td style="width:103px;">Qiagen</td>
			<td align="right" style="width:119px;">1027280</td>
			<td style="width:167px;">Negative control siRNA.</td>
		</tr>
		<tr height="63">
			<td height="63" style="height:63px;width:216px;">CDK6 siRNA</td>
			<td style="width:103px;">Dharmacon/ Custom synthesis</td>
			<td style="width:119px;">NA</td>
			<td style="width:167px;">Antisense sequence: 5&#39; CUCUAGGCCAGUCUUCUUCUU</td>
		</tr>
		<tr height="63">
			<td height="63" style="height:63px;width:216px;">RB1 siRNA</td>
			<td style="width:103px;">Dharmacon/ Custom synthesis</td>
			<td style="width:119px;">NA</td>
			<td style="width:167px;">Antisense sequence: 5&#39; GGUUCAACUACGCGUGUAATT</td>
		</tr>
		<tr height="63">
			<td height="63" style="height:63px;width:216px;">5x siRNA buffer</td>
			<td style="width:103px;">Thermo Scientific</td>
			<td>B-002000-UB-100</td>
			<td style="width:167px;">To be diluted with nuclease-free, non-DEPC treated water.</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Nulcease-free water (non-DEPC)</td>
			<td style="width:103px;">Applied Biosystems</td>
			<td>AM9937</td>
			<td style="width:167px;">For dilution of siRNA buffer.</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Hiperfect</td>
			<td style="width:103px;">Qiagen</td>
			<td align="right">301705</td>
			<td style="width:167px;">Transfection lipid.</td>
		</tr>
		<tr height="63">
			<td height="63" style="height:63px;width:216px;">DMEM</td>
			<td style="width:103px;">Life Technologies</td>
			<td align="right">41966052</td>
			<td style="width:167px;">Pyruvate and high-glucose supplemented tissue culture media.</td>
		</tr>
		<tr height="126">
			<td height="126" style="height:126px;width:216px;">96 well tissue culture plate</td>
			<td style="width:103px;">Falcon</td>
			<td align="right">3072</td>
			<td style="width:167px;">Plain, 96-well tissue culture plate for the parallel, compartmentalized mixing of transfection complexes.</td>
		</tr>
		<tr height="189">
			<td height="189" style="height:189px;width:216px;">Packard Viewplate</td>
			<td style="width:103px;">Perkin Elmer LAS</td>
			<td align="right">6005182</td>
			<td style="width:167px;">96 well TC plate with optical base on which cells are transfected, grown, fixed and eventually imaged. Supplied with opaque, adhesive plate seals, which are used during storage of used plates.</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Breathable membrane</td>
			<td style="width:103px;">Alpha Labs</td>
			<td style="width:119px;">LW2783</td>
			<td style="width:167px;">Sterile, gas-permeable, adhesive membrane.</td>
		</tr>
		<tr height="63">
			<td height="63" style="height:63px;width:216px;">Neutral buffered formalin, 10%</td>
			<td style="width:103px;">Sigma-Aldrich</td>
			<td>HT5012-1CS</td>
			<td style="width:167px;">10% Formalin (4% formaldehyde) fixative used neat in protocol.</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Triton X-100</td>
			<td style="width:103px;">Sigma-Aldrich</td>
			<td>X100PC</td>
			<td>Non-ionic detergent</td>
		</tr>
		<tr height="63">
			<td height="63" style="height:63px;width:216px;">Tris</td>
			<td style="width:103px;">Sigma-Aldrich</td>
			<td style="width:119px;">T1503</td>
			<td style="width:167px;">Trizma base (tris(hydroxymethyl)aminomethane)</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Tween 20</td>
			<td style="width:103px;">Sigma-Aldrich</td>
			<td style="width:119px;">P2287</td>
			<td style="width:167px;">For plate wash solution.</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Anti-P-S780 RB1 antibody</td>
			<td style="width:103px;">Abcam</td>
			<td>ab32513</td>
			<td>Rabbit monoclonal</td>
		</tr>
		<tr height="63">
			<td height="63" style="height:63px;width:216px;">AlexaFluor647 Anti-rabbit</td>
			<td style="width:103px;">Invitrogen</td>
			<td>A21245</td>
			<td style="width:167px;">Highly cross-adsorbed, fluorescently labelled secondary antibody.</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Hoechst 33342 (Bisbenzimide)</td>
			<td style="width:103px;">Sigma-Aldrich</td>
			<td>B2261</td>
			<td style="width:167px;">Fluorescent, chromatin-intercalating, DNA dye.</td>
		</tr>
		<tr height="63">
			<td height="63" style="height:63px;width:216px;">Permeabilization solution</td>
			<td style="width:103px;">NA</td>
			<td style="width:119px;">NA</td>
			<td style="width:167px;">0.1% Triton X-100 in 50 mM Tris-buffered saline, pH 8.0.</td>
		</tr>
		<tr height="63">
			<td height="63" style="height:63px;width:216px;">Plate wash solution</td>
			<td style="width:103px;">NA</td>
			<td style="width:119px;">NA</td>
			<td style="width:167px;">Tris-buffered saline containing 0.1 % Tween-20.</td>
		</tr>
		<tr height="126">
			<td height="126" style="height:126px;width:216px;">Block solution</td>
			<td style="width:103px;">NA</td>
			<td style="width:119px;">NA</td>
			<td style="width:167px;">5% powdered milk in Tris-buffered saline and 0.1% Tween-20. For blocking plate prior to immuno-staining and dilution of antibodies.</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Cell Profiler 2.1</td>
			<td style="width:103px;">Broad Institute</td>
			<td style="width:119px;"></td>
			<td>http://www.cellprofiler.org/download.shtml</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Active Perl Community Edition</td>
			<td style="width:103px;">ActiveState</td>
			<td style="width:119px;"></td>
			<td>http://www.activestate.com/activeperl/downloads</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">R programming environment</td>
			<td style="width:103px;">The R Foundation</td>
			<td style="width:119px;"></td>
			<td>http://www.r-project.org</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Rstudio</td>
			<td style="width:103px;">Rstudio</td>
			<td style="width:119px;"></td>
			<td>http://www.rstudio.com/</td>
		</tr>
	</tbody>
</table>

workflow for high-content, individual cell quantification of fluorescent markers from universal microscope data, supported by open source software

점착성 포유 동물 조직 배양 세포 모델에서의 동작을 관장하는 제어 메커니즘을 이해의 발전은 단일 셀 형태의 분석에 점점 의존하게된다. 세포 집단에서 바이오 마커의 평균 값을 반영하는 복합 데이터를 전달하는 방법은 연구 생물학적 시스템의 이질성을 반영 하위 집단 역학을 잃고 위험이 있습니다. 이을 유지, 전통적인 접근 방법에 의해 대체되고있다, 또는 높은 콘텐츠 현미경에 의해 평가를 할 수 있도록 개발 된 세포 분석의,보다 정교한 형태의 지원. 이러한 분석은 잠재적으로 독점 소프트웨어 패키지와 함께 제공으로 활성화 형광 바이오 마커의 이미지의 큰 숫자를 생성, 셀 당 멀티 파라미터 측정이 가능합니다. 그러나, 상대적으로 높은 자본 비용과 이러한 장치의 많은 overspecialization 많은 연구자 자신의 접근성을 방지했다. 여기에 설명입니다대부분의 형광 현미경의 이미지와 함께 사용하기에 적합 개별 세포의 특정 세포 내 지역의 여러 형광 마커 강도의 정량화를위한​​ 보편적으로 적용 워크 플로우. 이 워크 플로의 핵심 형광 마커 강도를 이러한 이미지로 각 셀, 정의 세포 내 영역으로 세그먼트를 구분하고 제공하는 무료로 사용할 수있는 휴대 프로파일 러 소프트웨어 (1)의 구현은이 지역에 특정 값입니다. 이미지 데이터로부터 개별 셀 세기 값의 추출이 워크 플로우의 중앙 목적 및 인간 세포에 부착 G1 체크 포인트 레귤레이터 siRNA의 화면에서 제어 데이터의 분석을 예시한다. 그러나, 여기에 제시된 플로 셀 섭동의 다른 수단으로부터의 데이터의 분석에 적용될 수있다 (예를 들면, 복합 화면) 이와 같이 형광 계 세포 마커의 다른 형태와는 실험실의 다양한 유용 할 것이다.

Watch this Scientific Journal Video about Workflow for High-content, Individual Cell Quantification of Fluorescent Markers from Universal Microscope Data, Supported by Open Source Software at JoVE.com

Workflow for High-content, Individual Cell Quantification of Fluorescent Markers from Universal Microscope Data, Supported by Open Source Software

형광 표지 된 세포의 다중 이미지 기반 분석을 가능하게하는 유연한 정보학 워크 플로우입니다 발표. 워크 플로는 핵 및 세포질 마커를 정량화하고 이러한 구획 사이에 마커 전위를 계산한다. 절차 96- 웰 포맷으로 간접 면역 형광에 의해 마커 검출 용 siRNA를 안정적인 방법을 사용하여 세포의 섭동 제공된다.

높은 콘텐츠, 오픈 소스 소프트웨어에 의해 지원되는 범용 현미경 데이터에서 형광 마커, 개별 셀 정량화를위한​​ 워크 플로우

Advances in understanding the control mechanisms governing the behavior of cells in adherent mammalian tissue culture models are becoming increasingly ...

workflow-for-high-content-individual-cell-quantification-fluorescent

Research

JoVE Journal

Biology

12.9K 조회수.  UCL Cancer Institute.  형광 표지 된 세포의 다중 이미지 기반 분석을 가능하게하는 유연한 정보학 워크 플로우입니다 발표. 워크 플로는 핵 및 세포질 마커를 정량화하고 이러한 구획 사이에 마커 전위를 계산한다. 절차 96- 웰 포맷으로 간접 면역 형광에 의해 마커 검출 용 siRNA를 안정적인 방법을 사용하여 세포의 섭동 제공된다. 

비디오: Workflow for High-content, Individual Cell Quantification of Fluorescent Markers from Universal Microscope Data, Supported by Open Source Software

A Neuronal and Astrocyte Co-Culture Assay for High Content Analysis of Neurotoxicity

High Content Analysis (HCA) assays combine cells and detection reagents with automated imaging and powerful image analysis algorithms, allowing measurement of multiple cellular phenotypes within a single assay. In this study, we utilized HCA to develop a novel assay for neurotoxicity. Neurotoxicity assessment represents an important part of drug safety evaluation, as well as being a significant focus of environmental protection efforts. Additionally, neurotoxicity is also a well-accepted in vitro marker of the development of neurodegenerative diseases such as Alzheimer's and Parkinson's diseases. Recently, the application of HCA to neuronal screening has been reported. By labeling neuronal cells with &beta;III-tubulin, HCA assays can provide high-throughput, non-subjective, quantitative measurements of parameters such as neuronal number, neurite count and neurite length, all of which can indicate neurotoxic effects. However, the role of astrocytes remains unexplored in these models. Astrocytes have an integral role in the maintenance of central nervous system (CNS) homeostasis, and are associated with both neuroprotection and neurodegradation when they are activated in response to toxic substances or disease states. GFAP is an intermediate filament protein expressed predominantly in the astrocytes of the CNS. Astrocytic activation (gliosis) leads to the upregulation of GFAP, commonly accompanied by astrocyte proliferation and hypertrophy. This process of reactive gliosis has been proposed as an early marker of damage to the nervous system. The traditional method for GFAP quantitation is by immunoassay. This approach is limited by an inability to provide information on cellular localization, morphology and cell number. We determined that HCA could be used to overcome these limitations and to simultaneously measure multiple features associated with gliosis - changes in GFAP expression, astrocyte hypertrophy, and astrocyte proliferation - within a single assay. In co-culture studies, astrocytes have been shown to protect neurons against several types of toxic insult and to critically influence neuronal survival. Recent studies have suggested that the use of astrocytes in an in vitro neurotoxicity test system may prove more relevant to human CNS structure and function than neuronal cells alone. Accordingly, we have developed an HCA assay for co-culture of neurons and astrocytes, comprised of protocols and validated, target-specific detection reagents for profiling &beta;III-tubulin and glial fibrillary acidic protein (GFAP). This assay enables simultaneous analysis of neurotoxicity, neurite outgrowth, gliosis, neuronal and astrocytic morphology and neuronal and astrocytic development in a wide variety of cellular models, representing a novel, non-subjective, high-throughput assay for neurotoxicity assessment. The assay holds great potential for enhanced detection of neurotoxicity and improved productivity in neuroscience research and drug discovery.

This article describes a novel protocol and reagent set designed for sensitive measurement of neurotoxic effects of compounds and treatments on co-cultures of neurons and astrocytes using high content analysis. Results demonstrate that high content analysis represents an exciting novel technology for neurotoxicity assessment.

Neurotoxicity 높은 컨텐츠 분석의 연결 및 Astrocyte 공동 문화 분석

High Content Analysis (HCA) assays combine cells and detection reagents with automated imaging and powerful image analysis algorithms, allowing ...

연구

생물학

Imaging C. elegans Embryos using an Epifluorescent Microscope and Open Source Software

Cellular processes, such as chromosome assembly, segregation and cytokinesis,are inherently dynamic. Time-lapse imaging of living cells, using fluorescent-labeled reporter proteins or differential interference contrast (DIC) microscopy, allows for the examination of the temporal progression of these dynamic events which is otherwise inferred from analysis of fixed samples1,2. Moreover, the study of the developmental regulations of cellular processes necessitates conducting time-lapse experiments on an intact organism during development. The Caenorhabiditis elegans embryo is light-transparent and has a rapid, invariant developmental program with a known cell lineage3, thus providing an ideal experiment model for studying questions in cell biology4,5and development6-9. C. elegans is amendable to genetic manipulation by forward genetics (based on random mutagenesis10,11) and reverse genetics to target specific genes (based on RNAi-mediated interference and targeted mutagenesis12-15). In addition, transgenic animals can be readily created to express fluorescently tagged proteins or reporters16,17. These traits combine to make it easy to identify the genetic pathways regulating fundamental cellular and developmental processes in vivo18-21. In this protocol we present methods for live imaging of C. elegans embryos using DIC optics or GFP fluorescence on a compound epifluorescent microscope. We demonstrate the ease with which readily available microscopes, typically used for fixed sample imaging, can also be applied for time-lapse analysis using open-source software to automate the imaging process.

Imaging C. elegans Embryos using an Epifluorescent Microscope and Open Source Software

The C. elegans embryo is a powerful system for studying cell biology and development. We present a protocol for live imaging of C. elegans embryos utilizing DIC optics or fluorescence using readily available epifluorescent microscopes and open-source software.

이미징 C. 엘레간스</emEpifluorescent 현미경과 오픈 소스 소프트웨어를 사용> 태아

Cellular processes, such as chromosome assembly, segregation and cytokinesis,are inherently dynamic. Time-lapse imaging of living cells, using ...

A High-content Imaging Workflow to Study Grb2 Signaling Complexes by Expression Cloning

Signal transduction by growth factor receptors is essential for cells to maintain proliferation and differentiation and requires tight control. Signal transduction is initiated by binding of an external ligand to a transmembrane receptor and activation of downstream signaling cascades. A key regulator of mitogenic signaling is Grb2, a modular protein composed of an internal SH2 (Src Homology 2) domain flanked by two SH3 domains that lacks enzymatic activity. Grb2 is constitutively associated with the GTPase Son-Of-Sevenless (SOS) via its N-terminal SH3 domain. The SH2 domain of Grb2 binds to growth factor receptors at phosphorylated tyrosine residues thus coupling receptor activation to the SOS-Ras-MAP kinase signaling cascade. In addition, other roles for Grb2 as a positive or negative regulator of signaling and receptor endocytosis have been described. The modular composition of Grb2 suggests that it can dock to a variety of receptors and transduce signals along a multitude of different pathways1-3.
	Described here is a simple microscopy assay that monitors recruitment of Grb2 to the plasma membrane. It is adapted from an assay that measures changes in sub-cellular localization of green-fluorescent protein (GFP)-tagged Grb2 in response to a stimulus4-6. Plasma membrane receptors that bind Grb2 such as activated Epidermal Growth Factor Receptor (EGFR) recruit GFP-Grb2 to the plasma membrane upon cDNA expression and subsequently relocate to endosomal compartments in the cell. In order to identify in vivo protein complexes of Grb2, this technique can be used to perform a genome-wide high-content screen based on changes in Grb2 sub-cellular localization. The preparation of cDNA expression clones, transfection and image acquisition are described in detail below. Compared to other genomic methods used to identify protein interaction partners, such as yeast-two-hybrid, this technique allows the visualization of protein complexes in mammalian cells at the sub-cellular site of interaction by a simple microscopy-based assay. Hence both qualitative features, such as patterns of localization can be assessed, as well as the quantitative strength of the interaction.

A high-content screening method for the identification of novel signaling competent transmembrane receptors is described. This method is amenable to large-scale automation and allows predictions about in vivo protein binding and the sub-cellular localization of protein complexes in mammalian cells.

표현 복제가 Grb2 신호 복합 단지를 공부하기 위해 높은 콘텐츠 이미징 워크 플로우

Signal  transduction by growth factor receptors is essential for cells to maintain  proliferation and differentiation and requires tight control. Signal  ...

Profiling Individual Human Embryonic Stem Cells by Quantitative RT-PCR

Heterogeneity of stem cell population hampers detailed understanding of stem cell biology, such as their differentiation propensity toward different lineages. A single cell transcriptome assay can be a new approach for dissecting individual variation. We have developed the single cell qRT-PCR method, and confirmed that this method works well in several gene expression profiles. In single cell level, each human embryonic stem cell, sorted by OCT4::EGFP positive cells, has high expression in OCT4, but a different level of NANOG expression. Our single cell gene expression assay should be useful to interrogate population heterogeneities.

Single cell gene expression assay is needed for understanding stem cell heterogeneities.

정량적 RT-PCR에 의해 개별 인간 배아 줄기 세포를 프로파일 링

Heterogeneity of stem cell population hampers detailed understanding of stem cell biology, such as their differentiation propensity toward different ...

Tracking and Quantifying Developmental Processes in C. elegans Using Open-source Tools

Quantitatively capturing developmental processes is crucial to derive mechanistic models and key to identify and describe mutant phenotypes. Here protocols are presented for preparing embryos and adult C. elegans animals for short- and long-term time-lapse microscopy and methods for tracking and quantification of developmental processes. The methods presented are all based on C. elegans strains available from the Caenorhabditis Genetics Center and on open-source software that can be easily implemented in any laboratory independently of the microscopy system used. A reconstruction of a 3D cell-shape model using the modelling software IMOD, manual tracking of fluorescently-labeled subcellular structures using the multi-purpose image analysis program Endrov, and an analysis of cortical contractile flow using PIVlab (Time-Resolved Digital Particle Image Velocimetry Tool for MATLAB) are shown. It is discussed how these methods can also be deployed to quantitatively capture other developmental processes in different models, e.g., cell tracking and lineage tracing, tracking of vesicle flow.

Tracking and Quantifying Developmental Processes in C. elegans Using Open-source Tools

Here it is shown how to track and quantify developmental processes in C. elegans. The methods presented are based on open-source tools that can be easily implemented. It is demonstrated how to reconstruct 3D cell-shape models, how to manually track subcellular structures, and how to analyze cortical contractile flow.

의 발달 프로세스 추적 및 정량화<em&gt; C. 엘레</em&gt; 오픈 소스 도구를 사용하여

Quantitatively capturing developmental processes is crucial to derive mechanistic models and key to identify and describe mutant phenotypes. Here ...

Open Source High Content Analysis Utilizing Automated Fluorescence Lifetime Imaging Microscopy

We present an open source high content analysis instrument utilizing automated fluorescence lifetime imaging (FLIM) for assaying protein interactions using F&#246;rster resonance energy transfer (FRET) based readouts of fixed or live cells in multiwell plates. This provides a means to screen for cell signaling processes read out using intramolecular FRET biosensors or intermolecular FRET of protein interactions such as oligomerization or heterodimerization, which can be used to identify binding partners. We describe here the functionality of this automated multiwell plate FLIM instrumentation and present exemplar data from our studies of HIV Gag protein oligomerization and a time course of a FRET biosensor in live cells. A detailed description of the practical implementation is then provided with reference to a list of hardware components and a description of the open source data acquisition software written in &#181;Manager. The application of FLIMfit, an open source MATLAB-based client for the OMERO platform, to analyze arrays of multiwell plate FLIM data is also presented. The protocols for imaging fixed and live cells are outlined and a demonstration of an automated multiwell plate FLIM experiment using cells expressing fluorescent protein-based FRET constructs is presented. This is complemented by a walk-through of the data analysis for this specific FLIM FRET data set.

We present an open source high content analysis (HCA) instrument utilizing automated fluorescence lifetime imaging (FLIM) for assaying protein interactions using F&#246;rster resonance energy transfer (FRET) based readouts. Data acquisition for this openFLIM-HCA instrument is controlled by software written in &#181;Manager and data analysis is undertaken in FLIMfit.

자동 형광 수명 이미징 현미경을 활용하여 오픈 소스 높은 콘텐츠 분석

We present an open source high content analysis instrument utilizing automated fluorescence lifetime imaging (FLIM) for assaying protein interactions ...

Cellular Redox Profiling Using High-content Microscopy

Reactive oxygen species (ROS) regulate essential cellular processes including gene expression, migration, differentiation and proliferation. However, excessive ROS levels induce a state of oxidative stress, which is accompanied by irreversible oxidative damage to DNA, lipids and proteins. Thus, quantification of ROS provides a direct proxy for cellular health condition. Since mitochondria are among the major cellular sources and targets of ROS, joint analysis of mitochondrial function and ROS production in the same cells is crucial for better understanding the interconnection in pathophysiological conditions. Therefore, a high-content microscopy-based strategy was developed for simultaneous quantification of intracellular ROS levels, mitochondrial membrane potential (&#916;&#936;m) and mitochondrial morphology. It is based on automated widefield fluorescence microscopy and image analysis of living adherent cells, grown in multi-well plates, and stained with the cell-permeable fluorescent reporter molecules CM-H2DCFDA (ROS) and TMRM (&#916;&#936;m and mitochondrial morphology). In contrast with fluorimetry or flow-cytometry, this strategy allows quantification of subcellular parameters at the level of the individual cell with high spatiotemporal resolution, both before and after experimental stimulation. Importantly, the image-based nature of the method allows extracting morphological parameters in addition to signal intensities. The combined feature set is used for explorative and statistical multivariate data analysis to detect differences between subpopulations, cell types and/or treatments. Here, a detailed description of the assay is provided, along with an example experiment that proves its potential for unambiguous discrimination between cellular states after chemical perturbation.

This paper presents a high-content microscopy workflow for simultaneous quantification of intracellular ROS levels, as well as mitochondrial membrane potential and morphology &#8211; jointly referred to as mitochondrial morphofunction &#8211; in living adherent cells using the cell-permeant fluorescent reporter molecules 5-(and-6)-chloromethyl-2&#39;,7&#39;-dichlorodihydrofluorescein diacetate, acetyl ester (CM-H2DCFDA) and tetramethylrhodamine methylester (TMRM).

고감도 현미경을 이용한 세포 산화 환원 프로파일 링

Reactive oxygen species (ROS) regulate essential cellular processes including gene expression, migration, differentiation and proliferation. However, ...

Open-source Single-particle Analysis for Super-resolution Microscopy with VirusMapper

Super-resolution fluorescence microscopy is currently revolutionizing cell biology research. Its capacity to break the resolution limit of around 300 nm allows for the routine imaging of nanoscale biological complexes and processes. This increase in resolution also means that methods popular in electron microscopy, such as single-particle analysis, can readily be applied to super-resolution fluorescence microscopy. By combining this analytical approach with super-resolution optical imaging, it becomes possible to take advantage of the molecule-specific labeling capacity of fluorescence microscopy to generate structural maps of molecular elements within a metastable structure. To this end, we have developed a novel algorithm &#8212; VirusMapper &#8212; packaged as an easy-to-use, high-performance, and high-throughput ImageJ plugin. This article presents an in-depth guide to this software, showcasing its ability to uncover novel structural features in biological molecular complexes. Here, we present how to assemble compatible data and provide a step-by-step protocol on how to use this algorithm to apply single-particle analysis to super-resolution images.

This manuscript uses the Fiji-based open-source software package VirusMapper to apply single-particle analysis to super-resolution microscopy images in order to generate precise models of nanoscale structure.

VirusMapper 슈퍼 해상도 현미경을위한 오픈 소스 단일 입자 분석

Super-resolution fluorescence microscopy is currently revolutionizing cell biology research. Its capacity to break the resolution limit of around 300 nm ...

IR-TEx: An Open Source Data Integration Tool for Big Data Transcriptomics Designed for the Malaria Vector Anopheles gambiae

IR-TEx is an application written in Shiny (an R package) that allows exploration of the expression of (as well as assigning functions to) transcripts whose expression is associated with insecticide resistance phenotypes in Anopheles gambiae mosquitoes. The application can be used online or downloaded and used locally by anyone. The local application can be modified to add new insecticide resistance datasets generated from multiple -omics platforms. This guide demonstrates how to add new datasets and handle missing data. Furthermore, IR-TEx can be completely and easily recoded to use-omics datasets from any experimental data, making it a valuable resource to many researchers. The protocol illustrates the utility of IR-TEx in identifying new insecticide resistance candidates using the the microsomal glutathione transferase, GSTMS1, as an example. This transcript is upregulated in multiple pyrethroid resistant populations from C&#244;te D&#39;Ivoire and Burkina Faso. The identification of co-correlated transcripts provides further insight into the putative roles of this gene.

IR-TEx: An Open Source Data Integration Tool for Big Data Transcriptomics Designed for the Malaria Vector Anopheles gambiae

IR-TEx explores insecticide resistance-related transcriptional profiles in the species Anopheles gambiae. Provided here are full instructions for using the application, modifications for exploring multiple transcriptomic datasets, and using the framework to build an interactive database for collections of transcriptomic data from any organism, generated in any platform.

IR-TEx: 말라리아 벡터 아노펠레스 감비아를 위해 설계된 빅 데이터 전사학을 위한 오픈 소스 데이터 통합 도구

IR-TEx is an application written in Shiny (an R package) that allows exploration of the expression of (as well as assigning functions to) transcripts ...

Worm-align and Worm_CP, Two Open-Source Pipelines for Straightening and Quantification of Fluorescence Image Data Obtained from Caenorhabditis elegans

An issue often encountered when acquiring image data from fixed or anesthetized C. elegans is that worms cross and cluster with their neighbors. This problem is aggravated with increasing density of worms and creates challenges for imaging and quantification. We developed a FIJI-based workflow, Worm-align, that can be used to generate single- or multi-channel montages of user-selected, straightened and aligned worms from raw image data of C. elegans. Worm-align is a simple and user-friendly workflow that does not require prior training of either the user or the analysis algorithm. Montages generated with Worm-align can aid the visual inspection of worms, their classification and representation. In addition, the output of Worm-align can be used for subsequent quantification of fluorescence intensity in single worms, either in FIJI directly, or in other image analysis software platforms. We demonstrate this by importing the Worm-align output into Worm_CP, a pipeline that uses the open-source CellProfiler software. CellProfiler&#8217;s flexibility enables the incorporation of additional modules for high-content screening.&#160;As a practical example, we have used the pipeline on two datasets: the first dataset are images of heat shock reporter worms that express green fluorescent protein (GFP) under the control of the promoter of a heat shock inducible gene hsp-70, and the second dataset are images obtained from fixed worms, stained for fat-stores with a fluorescent dye.

Worm-align and Worm_CP, Two Open-Source Pipelines for Straightening and Quantification of Fluorescence Image Data Obtained from Caenorhabditis elegans

Worm-align/Worm_CP is a simple FIJI/CellProfiler workflow that can be used to straighten and align Caenorhabditis elegans samples and to score whole-worm image-based assays without the need for prior training steps. We have applied Worm-align/Worm_CP to the quantification of&#160;heat-shock induced expression in live animals or lipid droplets&#160;in fixed samples.

벌레 정렬 및 Worm_CP, Caenorhabditis elegans에서 얻은 형광 이미지 데이터의 스트레이트 및 정량화를 위한 두 개의 오픈 소스 파이프라인

An issue often encountered when acquiring image data from fixed or anesthetized C. elegans is that worms cross and cluster with their neighbors. This ...

높은 콘텐츠, 오픈 소스 소프트웨어에 의해 지원되는 범용 현미경 데이터에서 형광 마커, 개별 셀 정량화를위한​​ 워크 플로우

높은 콘텐츠, 오픈 소스 소프트웨어에 의해 지원되는 범용 현미경 데이터에서 형광 마커, 개별 셀 정량화를위한 워크 플로우