Name: generation of a gene-disrupted streptococcus mutans strain without gene cloning
Uploaded: 2017-10-23T14:00:00.000+00:00
Duration: 12 min 6 s
Description: Watch this Scientific Journal Video about Generation of a Gene-disrupted Streptococcus mutans Strain Without Gene Cloning at JoVE.com

이 작품은 과학의 승진 [부여 번호 16 K 15860 T.M. 15 K 15777 햄프셔를]에 대 한 일본 사회에 의해 지원 되었다.

1. 뇌관 디자인 <ol><li>뇌관 2 단계 융합 PCR 및 유전자 장애의 확인에 대 한 준비. 
	주: 표 1이 프로토콜에 사용 되는 뇌관 시퀀스를 보여 줍니다. 그림 1 S. mutans Δ gtfC를 생성 하는 데 사용 하는 2 단계 융합 PCR 방법의 개요 그림을 보여준다.
	<li>디자인 뇌관 spectinomycin 저항 유전자 (spc r) 7 게놈에 대상 영역의 교체에 대 한 <ol>. 이 프로토콜 spc r gtfC 유전자의 코딩 지역 전체 바꿉니다.</li>
		<li>5에서 15 기지 spc r의 위쪽과 아래쪽 끝에 보완을 포함 &#39; 최대 역의 지역 및 다운-앞으로 뇌관, 각각. 마찬가지로, 5에서 15 베이스 gtfC의 업스트림 측면에 서 영역의 아래쪽 끝 및 gtfC의 다운스트림 측면에 서 영역의 위쪽 끝에 보완을 포함 &#39; spc r의 지역-앞으로 및 spc r -반전 뇌관, 각각 ( 그림 1A). 
		참고: 시퀀스의 최대 반전, 아래-앞으로, spc r-앞으로, 및 spc r-반전 뇌관 중단 구성의 사이트에 따라 자동으로 결정 됩니다.</li>
		<li>구성에 최대-앞으로 및 다운 반전 뇌관 디자인 &#62; 1 kb 업스트림 및 다운스트림 측면 gtfC 유전자의 지역 각각. 최대-앞으로의 녹는 온도 (T m)을 설정 하 고 다운-반전 뇌관 최대 반전 및 다운-앞으로 뇌관의 녹는 온도 따라 각각 ( 그림 1A). 
		참고: T m을 결정 하는 다음 수식에 참조: T m (° C) 2 = (* 나 + * NT) + 4 (* 노스캐롤라이나 + * NG)-5, 어디 * N (A, T, C, 또는 G) 지정 된 id 가진 뇌관 뉴클레오티드의 수를 나타냅니다.</li>
		<li>디자인 2 차 PCR ( 그림 1B)에 대 한 중첩 된 뇌관 (N_up-앞으로 및 N_up 역). 
		참고: 바깥쪽 뇌관 쌍 (최대-앞으로 및 역방향 다운) 2 차 PCR 뇌관으로 사용 될 수 있습니다, 있지만 중첩 된 뇌관 (N_up-앞으로 및 N_up 역)이이 프로토콜에 설계 되었습니다. 중첩 된 뇌관은 자주 필요 2 차 PCR, 대표 결과에 설명된대로.</li>
		<li>디자인 뇌관 spc r에 대 한 특정. GtfC 장애에 대 한 화면으로 식민지 PCR에 사용 되는 뇌관.</li>
		<li>GtfC의 확인에 대 한 디자인 뇌관 중단. 
		참고: 이러한 뇌관을 사용 하 여 증폭 PCR 제품 gtfC 또는 spc r 상류 또는 하류 측면 gtfC의 지역 사이 국경에 걸쳐져. 뇌관 세트 &#39; gtfC 최대-앞으로 및 gtfC 최대 역 &#39;와 &#39; gtfC 다운-앞으로 및 gtfC 다운 역 &#39; gtfC에 대 한 특정 및 &#39; gtfC 최대-앞으로 및 spc r 2 -역 &#39;와 &#39; spc r 2-앞으로 및 gtfC 다운 역 &#39; spc r에 대 한 특정 있다.</li>
	</ol></li></ol> 2. S. mutans에서 게놈 DNA 추출 <ol><li>행진 주식 S. 뮤턴트의 UA159 두뇌 심 혼 주입 (BHI) 한 접시에. 혐 기성 조건 하에서 37 ° C에서 하룻밤 접시를 품 어.</li>
	<li>소독된 이쑤시개를 사용 하 여 단일 식민지를 데리 고 BHI 국물의 5 mL에 접종. 혐 기성 조건 하에서 37 ° C에서 하룻밤 S. 뮤턴트의 문화를 품 어.</li>
	<li>2000 × g.에서 15 분 동안 원심 분리기 세균성 세포 배양의 인산 염 버퍼 식 염 수 (PBS) 5 mL에 셀 펠 릿 Resuspend.</li>
	<li>2000 × g.에서 15 분 동안 원심 분리기 PBS의 200 µ L에서 셀 펠 릿 Resuspend.</li>
	<li>제조업체에서 제공 하는 지침에 따라 비드 박동 베이스 게놈 DNA 추출 키트를 사용 하 여 정지에서 게놈 DNA를 추출.
	유리 구슬 (키트에 포함)를 포함 하는 <ol><li>전송 현 탁 액 2.0 mL 샘플 튜브. 세포 현 탁 액을 세포 솔루션 (키트에 포함)의 750 µ L을 추가.</li>
		<li>단단히 뚜껑과 구슬 박동 장애 기구의 튜브 홀더에 대칭으로 튜브를 놓습니다. 5 분에 대 한 최대 속도에서 프로세스입니다. 10000 × g.에 1 분 동안 구슬 구타 원심 분리기 샘플 2.0 mL 컬렉션 튜브 및 7000 × g .에서 1 분 동안 원심 분리기에서 회전 필터 (키트에 포함)에 상쾌한 전송</li>
		<li>추가 1200 µ L의 DNA 바인딩 버퍼 (키트에 포함)는 여과 액입니다. 10000 × g.에 1 분 동안 원심 분리기를 2.0 mL 컬렉션 튜브 (키트에 포함) 스핀 열에 혼합물의 800 µ L를 전송</li>
		<li>흐름을 통해 삭제 열 매트릭스를 세척 하 고 10000 × g. 흐름 통해 삭제에서 1 분 동안 원심, 스핀에 500 µ L 워시 버퍼 (키트에 포함)의 추가 스핀 열 미리 세척 버퍼 (키트에 포함)의 200 µ L을 추가 열 열 매트릭스를 세척 하 고 10000 × g.에 1 분 동안 원심을</li>
		<li>스핀 열 새로운 microcentrifuge 1.5 mL 튜브에 놓고 열 매트릭스를 100 µ L 차입 버퍼 (키트에 포함)의 추가.</li>
		<li>30 대 분리기 elute 게놈 DNA를 10000 × g에서 s. 260에서 흡 광도 측정 하 여 DNA의 농도 및 순도 추정 nm 및 280 nmusing 분 광 광도 계는 A 260 /A 280 비율이 1.8 보다 크면 확인 하십시오.</li>
	</ol></li></ol> 3. PCR 증폭 <ol><li>수행 1 세인트 PCR PCR 템플릿 (표 1 참조)으로 미 뮤턴트의 WT 게놈 및 합성 spc r 유전자를 사용 하 여. GtfC 유전자의 측면에 서 상류 지역, gtfC 유전자와 뇌관 당로 ( 그림 1A), 위에서 설명한의 3 세트를 사용 하 여 spc r 유전자의 측면에 서 하류 지역 증폭 표 2 및 표 3. 
	참고: PCR 뇌관, 시 약, 및 증폭 사이클에서 요약 된다 표 1, 표 2 및 표 3, 각각.</li>
	<li>1 %agarose 젤에 PCR 제품 각 충분치 고 젤 밴드 커터를 사용 하 여 해당 밴드 소비 세.</li>
	<li>스핀 열 및 실리 카 멤브레인 기반 젤 추출 키트를 사용 하 여 젤에서 각 증폭된 DNA 제품을 정화.
	<ol><li>전송 깨끗 한 microcentrifuge에 젤 조각 튜브와 500 µ L 바인딩 버퍼 (키트에 포함)와 혼합. 젤 조각 완전히 해산 될 때까지 15 분 동안 55 ° C에 혼합물을 품 어.</li>
		<li>(키트에 포함) 스핀 열 컬렉션 튜브 (키트에 포함)로, 스핀 열에 샘플 로드 놓고 30 원심 11000 × g에서 s. 통해 흐름, 워시 버퍼 (키트에 포함)의 600 µ L를 실리 카 막 씻어 30 원심 회전 열 추가 11000 × g에서 s.</li>
		<li>흐름을 통해 및 실리 카 막 건조 11000 × g에서 2 분 동안 원심 분리기 삭제.</li>
		<li>스핀 열 새로운 1.5 mL microcentrifuge 튜브로, 50 µ L을 추가 차입 버퍼 (키트에 포함), 2 분에 대 한 실 온에서 품 어와</li>
		<li>11000에서 2 분 동안 원심 분리기 × g elute 증폭 된 DNA를. 260에서 흡 광도 측정 하 여 DNA의 농도 및 순도 추정 nm 및 280 nmusing 분 광 광도 계는 A 260 /A 280 비율이 1.8 보다 크면 확인 하십시오.</li>
	</ol></li> <li>수행 2 nd 2 단계 융합 표 2에 의하여 PCR 템플릿으로 세 약 아데닌 파편을 사용 하 여 PCR PCR < /st룽 > 및 표 3. 
	참고: 이러한 증폭 된 조각과 중첩 된 뇌관을 사용 하 여 접합 &#39; N_up-N_down-리버스와 &#39; 또는 바깥쪽 뇌관 &#39; 최대-앞으로 및 역방향 다운 &#39; ( 그림 1B). PCR 뇌관, 시 약, 및 증폭 주기 각각 표 1, 표 2 및 표 3에 요약 됩니다.</li>
	<li>0.8 %agarose 젤에 PCR 반응 혼합물 (5 µ L)의 1/10을 로드 하 고 적절 한 amplicon ( 그림 1C)의 생성을 확인 하려면 예상된 밴드 크기와 증폭된 밴드 크기 비교.</li>
	<li>정화 없이 에탄올 강 수에 의해 나머지 최종 PCR 제품 집중.
	<ol><li>추가 55 µ L의 울트라 순수 물 100 µL.Add에 총 볼륨을 조정 하려면 남은 PCR 혼합물에 3m 나트륨 아세테이트 (10 µ L), pH 5.2, 뒤에 100% 에탄올 (250 µ L)의 2.5 볼륨의 1/10 볼륨. 혼합 하 고 30 분-80에 대 한 동결 ° c.</li>
		<li>4 ° C에서 15000 × g에서 20 분 동안 원심 분리기 튜브의 하단에 펠 릿에 대 한 확인 하 고 삭제는 상쾌한. 70% 에탄올, 4 ° C에서 15000 × g에서 5 분 동안 원심 분리기의 1 mL와 펠 릿을 세척 하 고는 상쾌한 삭제. 약 30 분 동안 펠 릿 건조 및 매우 순수한 물 10 µ L로 분해.</li>
	</ol></li></ol> 4. 유능한 세포 준비 및 셀 변환 <ol><li>행진 주식 S. 뮤턴트의 UA159 BHI 한 천 격판덮개에. 혐 기성 조건 하에서 37 ° C에서 하룻밤 접시를 품 어.</li>
	<li>소독된 이쑤시개를 사용 하 여 단일 식민지를 데리 고 BHI 국물의 5 mL에 접종. 혐 기성 조건 하에서 37 ° C에서 하룻밤 S. 뮤턴트의 문화를 품 어.</li>
	<li>뮤턴트 S. s 문화 2 mL 50 mL BHI 국물의 전송 및 6-8 h 600에서 광학 밀도를 37 ° C에서 품 어 혐 기성 조건 하에서 0.2-0.4 nm (OD 600).</li>
	<li>4 ° C에서 2000 × g에서 15 분 동안 세포를 원심, 상쾌한, 폐기 및 40 mL 40 mL 10% 글리세롤의 뒤 차가운 물로 두 번 셀 세척. 
	참고: 잔여 물질에 영향을 미칠 후속 electroporation.</li>
	<li>발음 파스퇴르 피 펫으로 신중 하 게 상쾌한 10% 글리세롤에 셀 펠 릿의 부착 감소. 신선한 10% 글리세롤의 1 mL에 셀 resuspend, 각 microcentrifuge 1.5 mL 튜브에 정지의 50 µ L를 분배 하 고 사용 직전까지-80 ° C에 저장.</li>
	<li>믹스 50 µ L 약 수 차가운 유능한 세포의 파괴의 5 µ L로 구성 섹션 3에에서 위에서 설명한. (전극 사이의 0.2 cm 거리)와 큐 벳 electroporation에 혼합물을 추가 합니다. 황색 포도상구균 모드 사용 (1.8 k v, 600 Ω, 10 µ F, 1 펄스)의 electroporate electroporation 기구.</li>
	<li>Electroporation 직후 BHI 국물의 500 µ L에서 세포를 일시 중단 하 고 spectinomycin 포함 된 BHI-한 천 배지를 현 탁 액의 50 µ L을 추가. 
	참고: 추가 보육 시간 후 electroporation 필요 하지 않습니다. 그러나, electroporation 후 1-2 h에 대 한 보육 변환 효율을 향상 시킬 수 있습니다.</li>
	<li>혐 기성 조건 하에서 37 ° C에서 2-6 일 동안 접시를 품 어. 
	참고: 위에서 설명한 대로 S. mutans Δ gtfB가 생성 됩니다. GtfB 유전자의 전체 코딩 영역이 S. mutans Δ에 리스로 마이 신 저항 유전자 8 대체 gtfB. 각 S. mutans 긴장은 혐 기성 조건 하에서 37 ° C에서 BHI 국물에 교양.</li>
</ol> 5. 유전자 장애 및 스토리지의 확인 <ol><li>임의의 식민지를 선택 하 고 식민지 PCR 표 2와 표 3을 수행을 PCR 혼합에 그들을 예방. PCR 뇌관, 시 약, 및 증폭 주기 각각 표 1, 표 2 및 표 3에 요약 됩니다.</li>
	<li>Spc r 것인지 1 %agarose 젤에 PCR 반응 혼합물을 로드-특정 DNA 밴드.</li>
	<li>혐 기성 조건 하에서 37 ° C에서 2 일 동안 소독된 이쑤시개와 spectinomycin 포함 된 BHI의 10 mL에 2 차 배양 세포를 사용 하 여 긍정적인 식민지 국물 선택.</li>
	<li>S. mutans Δ의 생성을 확인 gtfC.
	<ol><li>세포 현 탁 액을 동등 하 게 분할. 위에서 설명한 세포에서 게놈 DNA를 추출 (2.3 단계. 2.5.5에.). GtfC 장애 표 2와 표 3 (표 1)의 확인에 대 한 프라이 머를 사용 하 여 PCR 템플릿으로 게놈 dna는 PCR을 수행. 
		참고: PCR 뇌관, 시 약, 및 증폭 사이클에서 요약 된다 표 1, 표 2 및 표 3, 각각.</li>
		<li>2 %agarose 젤에 PCR 혼합물을 로드 하 고 적절 한 amplicon .의 생성을 확인 하려면 예상된 밴드 크기와 증폭된 밴드 크기 비교</li>
		<li>4 2000 × g에서 15 분 동안 나머지 세포 현 탁 액을 원심 ° C. PBS의 5 mL에 셀 펠 릿 Resuspend.</li>
		<li>4 2000 × g에서 15 분 동안 원심 분리기 ° C. Resuspend 셀 포함 하는 25% 글리세롤 BHI 국물 1.5 mL에 작은 고-80 ° 오호-20 ° C에에서 저장</li>
	</ol></li></ol> 6. Phenotypic 분석 BHI 천 배지에 <ol><li>행진 각 S. 뮤턴트의 스트레인. 혐 기성 조건 하에서 37 ° C에서 하룻밤 접시를 품 어.</li>
	<li>소독된 이쑤시개를 사용 하 여 단일 콜로 니를 선택 하 고 적절 한 항생제 없이 BHI 국물의 2 개 mL에 접종. 혐 기성 조건 하에서 37 ° C에서 밤새 품 어.</li>
	<li>하룻밤 문화 서 스 펜 션의 20 µ L 유리 시험관에 항생제 없이 1% 또는 5% 자당을 포함 된 BHI 국물의 2 개 mL에 접종, 혐 기성 조건 하에서 37 ° C에서 하룻밤 경사 위치에 테스트 튜브 셀 문화.</li>
	<li>소용돌이 유리 시험관 10 s 및 문화 현 탁 액을 가만히 따르다. 시험관 증류수로 세 번 세척. 0.25 %Coomassie 화려한 튜브 벽에 있는 biofilms 얼룩 (CBB) 블루 하 고 다음 1 분에 대 한 품 어의 1 mL을 추가</li>
	<li>얼룩 솔루션을 가만히 따르다, 증류수와 세 번 시험관을 세척 하 고 건조 테스트 튜브.</li>
	<li>색상 밀도 CBB 스테인드-biofilm phenotypic 분석에서 biofilm을 형성 하는 능력을 결정 하는 시각의 확장을 모두 평가.</li>
</ol>

<ol>
	<li>Horton, R. M., Hunt, H. D., Ho, S. N., Pullen, J. K., Pease, L. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Engineering+hybrid+genes+without+the+use+of+restriction+enzymes:+gene+splicing+by+overlap+extension.">Engineering hybrid genes without the use of restriction enzymes: gene splicing by overlap extension.</a> Gene. 77 (1), 61-68 (1989).</li><li>Horton, R. M., Cai, Z., Ho, S. M., Pease, L. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Gene+splicing+by+overlap+extension:+tailor-made+genes+using+the+polymerase+chain+reaction.">Gene splicing by overlap extension: tailor-made genes using the polymerase chain reaction.</a> BioTechniques. 54 (3), 129-133 (2013).</li><li>Kuwayama, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=PCR-mediated+generation+of+a+gene+disruption+construct+without+the+use+of+DNA+ligase+and+plasmid+vectors.">PCR-mediated generation of a gene disruption construct without the use of DNA ligase and plasmid vectors.</a> Nucleic Acids Res. 30 (2), E2 (2002).</li><li>Sakurai, I., Mizusawa, N., Wada, H., Sato, N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Digalactosyldiacylglycerol+is+required+for+stabilization+of+the+oxygen-evolving+complex+in+photosystem+II.">Digalactosyldiacylglycerol is required for stabilization of the oxygen-evolving complex in photosystem II.</a> Plant Physiol. 145 (4), 1361-1370 (2007).</li><li>Aoki, H., Shiroza, T., Hayakawa, M., Sato, S., Kuramitsu, H. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cloning+of+a+Streptococcus+mutans+glucosyltransferase+gene+coding+for+insoluble+glucan+synthesis.">Cloning of a Streptococcus mutans glucosyltransferase gene coding for insoluble glucan synthesis.</a> Infect Immun. 53 (3), 587-594 (1986).</li><li>Hanada, N., Kuramitsu, H. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Isolation+and+characterization+of+the+Streptococcus+mutans+gtfC+gene,+coding+for+synthesis+of+both+soluble+and+insoluble+glucans.">Isolation and characterization of the Streptococcus mutans gtfC gene, coding for synthesis of both soluble and insoluble glucans.</a> Infect Immun. 56 (8), 1999-2005 (1988).</li><li>LeBlanc, D. J., Lee, L. N., Inamine, J. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cloning+and+nucleotide+base+sequence+analysis+of+a+spectinomycin+adenyltransferase+AAD(9)+determinant+from+Enterococcus+faecalis.">Cloning and nucleotide base sequence analysis of a spectinomycin adenyltransferase AAD(9) determinant from Enterococcus faecalis.</a> Antimicrob Agents Chemother. 35 (9), 1804-1810 (1991).</li><li>Macrina, F. L., Tobian, J. A., Jones, K. R., Evans, R. P., Clewell, D. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+cloning+vector+able+to+replicate+in+Escherichia+coli+and+Streptococcus+sanguis.">A cloning vector able to replicate in Escherichia coli and Streptococcus sanguis.</a> Gene. 19 (3), 345-353 (1982).</li><li>Murata, T., Hanada, N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Contribution+of+chloride+channel+permease+to+fluoride+resistance+in+Streptococcus+mutans.">Contribution of chloride channel permease to fluoride resistance in Streptococcus mutans.</a> FEMS Microbiol Lett. 363 (11), (2016).</li><li>Perry, D., Wondrack, L. M., Kuramitsu, H. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genetic+transformation+of+putative+cariogenic+properties+in+Streptococcus+mutans.">Genetic transformation of putative cariogenic properties in Streptococcus mutans.</a> Infect Immun. 41 (2), 722-727 (1983).</li><li>Lau, P. C., Sung, C. K., Lee, J. H., Morrison, D. A., Cvitkovitch, D. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=PCR+ligation+mutagenesis+in+transformable+streptococci:+application+and+efficiency.">PCR ligation mutagenesis in transformable streptococci: application and efficiency.</a> J Microbiol Methods. 49 (2), 193-205 (2002).</li><li>Ge, X., Xu, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genome-wide+gene+deletions+in+Streptococcus+sanguinis+by+high+throughput+PCR.">Genome-wide gene deletions in Streptococcus sanguinis by high throughput PCR.</a> J Vis Exp. (69), (2012).</li></ol>

저자는 공개 없다.

현재 프로토콜 1세인트 PCR 뇌관 상류와 하류 측면 게놈에서 대상 영역의 영역 약 1kb를 증폭 설계 되어야 합니다. 이러한 긴 측면에 서 시퀀스는 동종 재결합의 효율성을 개선 하는 데 필요한.
뇌관의 시퀀스 (최대 반전, 아래-앞으로, spcr-앞으로, 및 spcr-리버스)이이 프로토콜에서 자동으로 결정 되었다 중단 구성의 사이트에 따라. 각 뇌관 15 기초 5' 영역에서 2차 PCR 서식 파일의 끝에 보완을 포함 되어 있습니다. 더 이상 바인딩 사이트 중단 건설의 보다 효율적인 생산을 수 있습니다. 각 뇌관의 5' 영역에서 적어도 10 보완 기지의 포함9것이 좋습니다.
중첩 된 뇌관 (N_up-앞으로 및 N_up 역) 바깥쪽 뇌관 (최대-앞으로 및 다운 역) 보다는 2차 PCR, 사용 되었다. 2차 PCR 바깥쪽 뇌관의 사용은 어떤 경우에는;에 유용 S. mutans ΔgtfB 에 대 한 중단 구성의 성공적인 증폭 바깥쪽 뇌관 (데이터 표시 되지 않음)를 사용 하 여 달성 되었다. 그러나, 부족 한 PCR 증폭, 그림 3에서 같이 2차 PCR 단계 바깥쪽 프라이 머를 사용 하 여 자주 발생합니다. 중첩 된 뇌관의 사용은9이 문제 해결 하기 위해 발견 되었다. 그러나 때 중단 구조는 실질적으로 중첩 된 뇌관을 사용 하 여 증폭 하지은,, 1 PCR에 사용 되는 뇌관의 재설계 해야 합니다.
식민지 PCR 유전자 교란 스트레인의 편리한 검사 수 있습니다. 알려진된 시퀀스의 뇌관은 spcr를 사용 하 여 유전자 교란 스트레인의 세대에 대 한 적용할 수 있습니다. Electroporation은 S. mutans WT, 중단 구문의 도입 electroporation를 사용 하 여 달성 변환 효율은 일반적으로 다른 프로시저에서 사용할 수 이상으로 사용 되었다. 능력을 자극 펩 티 드와 말 혈 청, 또는 말 혈 청을 사용 하 여 변환은 구10,,1112에 널리 허용 됩니다. Electroporation 기구 필요 하지만 유능한 세포 준비 등 관련된 절차는 다른 방법10,11에 비해 훨씬 간단 하 게. 또한, electroporation 동물 복지의 관점에서 것이 좋습니다.
현재 프로토콜 번호 ofantibiotic 표식에 따라 여러 유전자 장애에 적용 됩니다. GtfC-및 gtfB를 생성 하기 위해- S. mutans 긴장, 예를 들어 gtfC에 대 한 DNA 구조를 중단-중단 2 단계 PCR에 의해 건설 S. mutans Δ로 변형 될 수 있습니다gtfB. GtfC 및 gtfB 는 경우에 인접 한, S. mutans ΔgtfC 과 S. mutans ΔgtfB 유전자 사용 해야 합니다 2 단계 PCR에 대 한 템플릿으로 동종 시퀀스를 유지 하기 위해 동종 재결합입니다. 사실, 이중 유전자 교란 S. mutans 긴장 이전이 프로토콜9에 의해 건설 되었다.
S. mutans 에 유전자 장애에 대 한 현재의 프로토콜은 다양 한 종의 유전자 교란 종자의 생성에 대 한 적응 수 있습니다. 이 프로토콜은 기존의 프로토콜에 관련 된 유전자 복제 단계를 필요 하지 않습니다. 또한, PCR는 유일한 필수 효소 반응; 따라서, 플라스 미드 벡터, 대장균, 리가, 그리고 제한 효소 필요 하지 않습니다. 또한, 현재 프로토콜 구문 디자인 대상 유전자의 금지 효소 사이트를 독립적으로 중단 구축의 디자인 측면에서 더 큰 유연성을 제공 합니다. 연구원은 삭제 또는 업스트림 측면에 서 영역의 확대를 위한 역방향 뇌관 및 다운스트림 측면에 서 영역의 확대를 위한 앞으로 뇌관 디자인 게놈에서 보존 하는 영역을 결정할 수 있습니다. 지역 측면에 서는 이들은 즉시 업스트림 그리고 즉시 다운스트림 DNA의 영역의 각각 삭제, 원하는. 이러한 유연성 proximate 유전자의 표현에 극 효과 등 외부의 영향을 감소를 사용할 수 있습니다.

유전자 기능 분석은 일반적으로 야생-타입 긴장과 긴장에 관심사의 특정 유전자 중단 되었습니다 phenotypic 비교를 포함 한다. 이 유전자-중단 기술은 다양 한 포유 동물에 박테리아에서 taxa에에서 유전자 기능 분석에 대 한 활용 되었습니다. 유전자 장애 개념은 유전자 교란 스트레인;의 생성에 필요한 이 deoxyribonucleic 산 (DNA) 구문 업스트림 및 다운스트림 영역 대상 유전자의 측면에 융합 항생제 내성 표시 유전자의 구성 되어 있으며 동종 재결합을 통해 게놈으로 통합 됩니다. 유전자 교란 스트레인 항생제를 포함 하는 선택적 미디어를 사용 하 여 격리 될 수 있습니다. 유전자 교란 스트레인의 건설에 사용 되는 기존의 방법 중 합 효소 연쇄 반응 (PCR), 적당 한 플라스 미드, 제한 된 소화에 유전자의 결 찰에 의해 대상 유전자의 증폭 등의 복잡 한 단계 필요 효소, 그리고 항생제-저항 마커 유전자 삽입을 religation. 이 과정은 시간이 많이 걸리는, 각 단계의 성공에 따라 몇 주 몇 일 복용. 또한, 장애 구문 디자인 대상 유전자의 금지 효소 사이트에 따라 달라 집니다. 이러한 문제를 해결 하려면 DNA PCR 기반 접합 방법1,2 Dictyostelium discoideum3 , Synechocystis sp. PCC68034 의 돌연변이 유전자 교란의 디자인에 대 한 보고 되었습니다. 현재 연구에서 메서드는 상대적으로 손쉬운, 신속 하 고 저렴 한 방식으로, 파괴의 건설에 대 한 수정 된 PCR 기반 방법 (지정 2 단계 융합 PCR)을 이용 하 여 유전자 교란 연쇄 구 균 긴장을 생성 하 개발 되었다 구문 및 electroporation 유전자 변환에 대 한입니다.
PCR는 적절 하 게 genomic DNA, PCR 템플릿으로 항생제 내성 표시 유전자 및 4 쌍의 필요 2 단계 융합 oligonucleotide 뇌관 설계 되었습니다. 첫 번째 단계 (1세인트 PCR), 1 kb 업스트림 측면에 서 지역 1 kb 다운스트림 측면에 서 지역 대상의 대상 유전자의 유전자, 그리고 항생제-저항 마커 유전자 PCR에 의해 증폭 됩니다. 역방향 뇌관 및 증폭의 상류와 하류에 대 한 앞으로 뇌관의 5' 지역 지역, 각각, 측면 15 기지 마커 유전자의 끝에 보완을 포함 됩니다. 5' 영역 마커 유전자 증폭에 대 한 정방향 및 역방향 뇌관의 비슷하게 포함 15 기초 대상 유전자의 상류 측면에 서 영역의 아래쪽 끝 고 대상 유전자의 하류 측면에 서 영역의 위쪽 끝을 보완 각각. 따라서, 3 개의 증폭 된 파편 퓨전 사이트에서 겹치는 30-기본적인 쌍 지역 포함. 두 번째 단계 (2차 PCR), 1세인트 PCR 템플릿으로 의해 증폭 3 조각을 사용 하 여 중첩된 한 PCR 뇌관으로 PCR 수행 됩니다. 서식 파일의 상호 보완적인 영역 또한 2차 PCR을 통해 서로 연결 됩니다. 마지막으로, 동종 재결합에 대 한 구문 electroporation 야생-타입 스트레인에 소개 된다. 성공적인 유전자 장애 특정 뇌관을 사용 하 여 PCR에 의해 확인 될 수 있습니다. 중단 구조는 고 충실도 DNA 중 합 효소를 사용 하 여 증폭, 비록 추가 효소 반응, DNA 결 찰 등 DNA 소화, 구조를 생성 하기 위해 필요 하지 않습니다. 또한, 게놈에 삭제 또는 보존 지역 뇌관 디자인에 따라 유연 하 게 선택할 수 있습니다.
현재 작업에서 glucosyltransferase mutans 연쇄 상 구 균에에서 인코딩하는 gtfC 유전자의 전체 코딩 영역의 삭제 연쇄 구 균 종에서 신속 하 고 쉽게 유전자 장애 메서드를 보여 주기 위해 수행 되었다. 또한, gtfB-방해 스트레인 같은 방식으로 생성 된. GtfC 와 gtfB 에 의해 glucosyltransferases cariogenic 치과 biofilm 개발5,6에 기여 한다. 야생-타입의 biofilm 형성 능력 스트레인 (S. mutans WT), gtfC-스트레인 (S. mutans ΔgtfC), 및 gtfB중단-방해 스트레인 (S. mutans ΔgtfB) 평가 했다 대 한 비교 phenotypic 분석. 이 프로토콜 추가 종 유전자 장애에 대 한 2 단계 방법의 응용 프로그램을 확장 하 고 taxa의 넓은 범위에서 유전자 기능 연구에 대 한 수정할 수 있습니다.

<table><tbody><tr><td>&lt;em&gt;Streptococus mutans&lt;/em&gt;</td><td>Stock strain in the lab.</td><td></td><td>Wild-type strain (Strain UA159)</td></tr><tr><td>Genomic DNA extraction kit</td><td>Zymo Research</td><td>D6005</td><td></td></tr><tr><td>Bead-beating disruption apparatus</td><td>Taitec</td><td>GM-01</td><td></td></tr><tr><td>Synthetic genes</td><td>Eurofins Genomics</td><td>Custom-ordered</td><td>Spectinomycin- and erythromycin-resistance gene</td></tr><tr><td>Thermal cycler</td><td>Astec</td><td>PC-708</td><td></td></tr><tr><td>PCR primers</td><td>Eurofins Genomics</td><td>Custom-ordered</td><td>35 bases in length</td></tr><tr><td>DNA polymerase</td><td>Takara</td><td>R045A</td><td>High-fidelity DNA polymerase</td></tr><tr><td>Gel extraction kit</td><td>Nippon Genetics</td><td>FG-91202</td><td>DNA extraction from agarose gel</td></tr><tr><td>Gel band cutter</td><td>Nippon Genetics</td><td>FG-830</td><td></td></tr><tr><td>Spectrophotometer</td><td>Beckman Coulter</td><td>DU 800</td><td></td></tr><tr><td>Electroporator</td><td>Bio-rad</td><td>1652100</td><td></td></tr><tr><td>Electroporation cuvette</td><td>Bio-rad</td><td>1652086</td><td>0.2-cm gap</td></tr><tr><td>Anaeropack</td><td>Mitsubishi Gas Chemical</td><td>A-03</td><td>Anaerobic culture system</td></tr><tr><td>Brain heart infusion broth</td><td>Becton, Dickinson</td><td>237500</td><td>Bacterial culture media</td></tr><tr><td>Spectinomycin</td><td>Wako</td><td>195-11531</td><td>Antibiotics</td></tr><tr><td>Erythromycin</td><td>Wako</td><td>057-07151</td><td>Antibiotics</td></tr><tr><td>Sucrose</td><td>Wako</td><td>196-00015</td><td>For biofilm development</td></tr><tr><td>CBB R-250</td><td>Wako</td><td>031-17922</td><td>For biofilm staining</td></tr></tbody></table>

generation of a gene-disrupted streptococcus mutans strain without gene cloning

특정 유전자의 기능 설명에 대 한 일반적인 방법을 야생-타입 스트레인 및 관심사의 유전자 교란 되었습니다 했다 긴장의 비교 phenotypic 분석을 포함 한다. 유전자 장애 DNA 구조 적당 한 항생제 내성 표시 유전자를 포함 하는 박테리아의 변종 유전자 교란의 세대에 대 한 유용 합니다. 그러나, 전통적인 건축 방법, 유전자 복제 단계를 필요로 하는 복잡 하 고 시간이 걸리는 프로토콜을 포함 한다. 여기, 타겟된 유전자 장애 mutans 연쇄 상 구 균에 에서 대 한 상대적으로 손쉬운, 빠르고 비용 효율적인 방법을 설명 합니다. 메서드는 2 단계 융합 연쇄 반응 (PCR) 중단 구조 및 유전자 변환 위한 electroporation 생성 하 이용 한다. 이 메서드는 효소 반응, PCR, 이외의 필요 하지 않습니다 그리고 또한 중단 구성의 디자인 측면에서 더 큰 유연성을 제공 합니다. 고용 electroporation의 유능한 세포 준비를 용이 하 게 하 고 변환 효율을 향상 시킵니다. 현재 메서드는 다양 한 종의 유전자 교란 종자의 생성에 대 한 적응 수 있습니다.

그림 2 는 그 1세인트 PCR, 각 제품의 크기, 1 %agarose 젤에 관찰 했다 약 1 kb의 예상된 크기와 좋은 계약에. 그림 3 의 2차 PCR 제품의 젤 전기 이동 법 분석을 보여준다. 그림 4 는 S. mutans 식민지 붕괴 구조와 식민지 PCR 제품의 젤 전기 이동 법 분석 변환. 모든 식민지에서 amplicons 예측된 크기의 이었다. 그림 5 는 gtfC 중단 및 젤 전기 이동 법의 PCR 제품의 확인에 대 한 입문서-바인딩 사이트. GtfC-특정 뇌관 세트를 사용 하 여 증폭 하 여 얻은 PCR 제품 확인 되었다 S. mutans WT, S. mutans ΔgtfC에 PCR 제품 spcr를 사용 하 여 얻은 반면-특정 뇌관 세트 S. mutans ΔgtfC 에 확인 되었다 그러나 하지 S. mutans WT. 각 S. mutans 긴장의 자당 파생 biofilm 형성 능력 보여준다 그림 6 . S. mutans WT 자당;의 존재에 의해 부착 biofilm 형성 되었다 S. mutans ΔgtfB 의 부착 biofilm 형성 능력 있던 보다 S. mutans WT.의 S. mutans ΔgtfC 전시 자당의 매우 낮은 부착 biofilm 형성.
<img alt="Figure 1" class="xfigimg" src="/files/ftp_upload/56319/56319fig1.jpg"> 
2 단계 융해 PCR 1:Strategy 그림. S의 도식 적인 그림입니다. mutans ΔgtfC 건설 표시 됩니다. 유전자 길이 규모. (A) 상류와 하류 지역 gtfC 및 spcr 의 측면 loci PCR에 의해 증폭 되었다. 뇌관 바인딩 사이트 서식 파일에는 동일한 패턴으로 표시 됩니다. (B) 두 번째 PCR 단계 중첩 된 뇌관으로 PCR 첫걸음에서 증폭 된 3 조각 (서식 파일)로 사용 하 여 수행 되었다. (C) 붕괴 구조 세균성 긴장에 동종 재결합에 대 한 얻은 했다. <a href="//ecsource.jove.com/files/ftp_upload/56319/56319fig1large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭 하십시오.</a>
<img alt="Figure 2" class="xfigimg" src="/files/ftp_upload/56319/56319fig2.jpg"> 
1세인트 PCR 제품의 그림 2: 대표적인 젤 전기 이동 법. GtfC 의 업스트림 측면에 서 지역 및 gtfC 및 spcr 의 다운스트림 측면에 서 지역의 Amplicons 표시 됩니다. M: 분자 감 적입니다. <a href="//ecsource.jove.com/files/ftp_upload/56319/56319fig2large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭 하십시오.</a>
<img alt="Figure 3" class="xfigimg" src="/files/ftp_upload/56319/56319fig3.jpg"> 
그림 3: 2노스다코타 PCR 제품의 대표적인 젤 전기 이동 법. 중첩 된 뇌관으로 증폭 제품 고 바깥쪽 뇌관 표시 됩니다. 단단한 화살표 중단 구축의 예상된 크기를 나타냅니다. M: 분자 감 적입니다.
<img alt="Figure 4" class="xfigimg" src="/files/ftp_upload/56319/56319fig4.jpg"> 
그림 4: 식민지 PCR (A). 로 gtfC 장애에 대 한 심사 S. mutans 식민지에 spectinomycin 포함 된 BHI 천 배지; 각 동그라미 숫자가 나타냅니다 식민지 id입니다. (B) 대표 젤 전기 이동 법의 식민지 PCR 제품; 각 동그라미 레인 번호 그림 4A에서 해당 식민지 ID를 나타냅니다. M: 분자 마커, WT: 야생-타입 게놈 DNA 템플릿으로 사용. <a href="//ecsource.jove.com/files/ftp_upload/56319/56319fig4large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭 하십시오.</a>
<img alt="Figure 5" class="xfigimg" src="/files/ftp_upload/56319/56319fig5.jpg"> 
그림 5: 확인 PCR에 의해 gtfC 장애의. (A) 뇌관 바인딩 사이트; 유전자 길이 아니다 규모. PCR은 S. mutans 게놈 DNA를 템플릿으로 사용 하 여 수행 되었다. 뇌관 세트: gtfC 최대-앞으로 및 gtfC 최대 역 ( gtfC에 대 한 특정); gtfC 다운-앞으로 및 gtfC 다운-리버스 ( gtfC에 대 한 특정); gtfC 최대-앞으로 및 spcr2-리버스 ( spcr에 대 한 특정); spcr2-앞으로 하 고 gtfC 다운 역 ( spcr에 대 한 특정). (B) 대표 젤 전기 이동 법의 PCR 제품; 각 원된 레인 번호 그림 5A에 해당 뇌관을 나타냅니다. 하나의 전기 이동 이미지 마커 밴드를 분할 된다. M: 분자 감 적 (100 기본적인 쌍 사다리). <a href="//ecsource.jove.com/files/ftp_upload/56319/56319fig5large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭 하십시오.</a>
<img alt="Figure 6" class="xfigimg" src="/files/ftp_upload/56319/56319fig6.jpg"> 
그림 6: Phenotypic 분석 기반 biofilm 개발. 자당 파생 biofilms 각 S. mutans 긴장에 의해 형성 되었다 Coomassie 화려한 파란 얼룩이 진다. WT: S. mutans WT, ΔgtfB: S. mutans ΔgtfB, ΔgtfC: S. mutans ΔgtfC. <a href="//ecsource.jove.com/files/ftp_upload/56319/56319fig6large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭 하십시오.</a>
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>뇌관 쌍</td>
			<td colspan="2">시퀀스 (5' 3')</td>
			<td>예상된 밴드 크기 (bp)</td>
		</tr>
		<tr>
			<td>gtfC 장애에 대 한 2 단계 PCR</td>
			<td colspan="2"></td>
			<td></td>
		</tr>
		<tr>
			<td>1 PCR</td>
			<td colspan="2"></td>
			<td></td>
		</tr>
		<tr>
			<td>최대-앞으로 최대 역</td>
			<td colspan="2">AAGATATTTTGATAAGCAATCTGGGAACATGTATC 
			CGAACGAAAATCGA TATTTCCTCCAAAAAT AGTTA</td>
			<td>1,036</td>
		</tr>
		<tr>
			<td>spcr-앞으로 
			spcr-리버스</td>
			<td colspan="2">ATTTTTGGAGGAAATA TCGATTTTCGTTCG TGAAT 
			CTTCTAAGATAAGTA CATATGCAAGGGTTT ATTGT</td>
			<td>1,188</td>
		</tr>
		<tr>
			<td>다운-앞으로 다운 역</td>
			<td colspan="2">AAACCCTTGCATATG TACTTATCTTAGAAG AATAG TTAAGAGCAAGTTTAAGATAGAACATGTTACTCAC</td>
			<td>1,059</td>
		</tr>
		<tr>
			<td>2 PCR</td>
			<td colspan="2"></td>
			<td></td>
		</tr>
		<tr>
			<td>N_up-앞으로 N_down-역</td>
			<td colspan="2">TTTTATTGAAAACGAAGAAGGTAAATGGCTGTATC GCCATACTTAGAGAAATTTCTTTGCTAAATTCTTG</td>
			<td>3,132</td>
		</tr>
		<tr>
			<td>GtfC 장애의 확인</td>
			<td colspan="2"></td>
			<td></td>
		</tr>
		<tr>
			<td>식민지 PCR 검사</td>
			<td colspan="2"></td>
			<td></td>
		</tr>
		<tr>
			<td>S_spcr-앞으로 S_spcr-리버스</td>
			<td colspan="2 colspan=""></td colspan="2></tr></tbody></table>"> GGATCAGGAGTTGAGAGTGGACTAAAACCAAATAG CAGCCACTGCATTTCCCGCAATATCTTTTGGTATG
			<td>535</td>
		
		<tr>
			<td>최종 확인</td>
			<td colspan="2"></td>
			<td></td>
		</tr>
		<tr>
			<td>gtfC 최대-앞으로 
			gtfC 최대 역</td>
			<td colspan="2">TACGGCCGTATCAGTTATTACGATGCTAACTCTGG GGTTGGTTGAGATGTTGCTGAAGTTGCTGTACTTG</td>
			<td>498</td>
		</tr>
		<tr>
			<td>gtfC 다운-앞으로 
			gtfC 다운 역</td>
			<td colspan="2">GCCTTAATTGGTTGGCATGTTGTTGAAGGAAGACG TTGTCCACTTTGAAGTCAACGTCTTGCAAGGCATG</td>
			<td>557</td>
		</tr>
		<tr>
			<td>gtfC 최대-앞으로 
			spcr2 역</td>
			<td colspan="2">위에서 설명한 CCACTCTCAACTCCTGATCCAAACATGTAAGTACC</td>
			<td>641</td>
		</tr>
		<tr>
			<td>spcr2 앞으로 
			gtfC 다운 역</td>
			<td colspan="2">GTGGCTGAATCTTCTCCATTAGAACATAGGGAGAG 위에서 설명한</td>
			<td>623</td>
		</tr>
	

표 1:이 프로토콜에 사용 되는 뇌관. 밑줄이 시퀀스 ' 최대 반전 및 spcr-앞으로 '와 'spcr-리버스 및 다운-앞으로 ' 무료. 대담한 형식의 시퀀스 ' 최대 반전 및 spcr-앞으로 '와 'spcr-r 다운-앞으로 ' 보완.
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>시 약</td>
			<td>재고 솔루션의 농도</td>
			<td>볼륨</td>
			<td>최종 농도</td>
		</tr>
		<tr>
			<td>Dna 중 합 효소 프리 믹스</td>
			<td>2 ×</td>
			<td>25 Μ</td>
			<td>1 ×</td>
		</tr>
		<tr>
			<td>앞으로 뇌관</td>
			<td>5 Μ M</td>
			<td>2 Μ</td>
			<td>0.2 Μ M</td>
		</tr>
		<tr>
			<td>반전 뇌관</td>
			<td>5 Μ M</td>
			<td>2 Μ</td>
			<td>0.2 Μ M</td>
		</tr>
		<tr>
			<td>템플릿 DNA</td>
			<td>변수</td>
			<td>변수</td>
			<td>변수 * * * * * *</td>
		</tr>
		<tr>
			<td>이온된 수</td>
			<td>-</td>
			<td>최대 50 μ</td>
			<td>-</td>
		</tr>
	</tbody>
</table>
표 2: PCR 시 약. * 1세인트 단계 PCR;에 대 한 100 ng. * * 대 한 2차 PCR; 1세인트 단계 PCR amplicon의 각 30-50 ng. 식민지 PCR; 반응 혼합물을 세균성 세포의 직접적인 추가.
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>사이클 단계</td>
			<td>온도</td>
			<td>시간</td>
			<td>사이클 수</td>
		</tr>
		<tr>
			<td>초기 변성</td>
			<td>98 ° C</td>
			<td>2 분</td>
			<td>1</td>
		</tr>
		<tr>
			<td>변성 어 닐 링 확장</td>
			<td>98 ° C 55 ° C 72 ° C</td>
			<td>10 s 5 s Amplicon 종속 (1 분/1 kbp)</td>
			<td>35</td>
		</tr>
		<tr>
			<td>마지막 확장</td>
			<td>72 ° C</td>
			<td>Amplicon 종속 (1 분/1 kbp)</td>
			<td>1</td>
		</tr>
	</tbody>
</table>
표 3: PCR 확대 주기.

Watch this Scientific Journal Video about Generation of a Gene-disrupted Streptococcus mutans Strain Without Gene Cloning at JoVE.com

Generation of a Gene-disrupted Streptococcus mutans Strain Without Gene Cloning

우리 유전자 교란 구 mutans 의 생성에 대 한 손쉬운, 신속한, 그리고 상대적으로 저렴 한 방법 설명 변종; 이 기술은 다양 한 종의 유전자 교란 종자의 생성에 대 한 적용할 수 있습니다.

유전자 교란 mutans 연쇄 상 구 균 긴장 없이 유전자 복제의 생성

Typical methods for the elucidation of the function of a particular gene involve comparative phenotypic analyses of the wild-type strain and a strain in ...

generation-gene-disrupted-streptococcus-mutans-strain-without-gene

Nanyang Technological University

Research

JoVE Journal

Genetics

Generation of a Gene-disrupted Streptococcus mutans Strain Without Gene Cloning

7.6K 조회수.  Tsurumi University School of Dental Medicine. 우리 유전자 교란 구 mutans 의 생성에 대 한 손쉬운, 신속한, 그리고 상대적으로 저렴 한 방법 설명 변종; 이 기술은 다양 한 종의 유전자 교란 종자의 생성에 대 한 적용할 수 있습니다.

비디오: Generation of a Gene-disrupted Streptococcus mutans Strain Without Gene Cloning

From a Natural Product to Its Biosynthetic Gene Cluster: A Demonstration Using Polyketomycin from Streptomyces diastatochromogenes T&#252;6028

Streptomyces strains are known for their capability to produce a lot of different compounds with various bioactivities. Cultivation under different conditions often leads to the production of new compounds. Therefore, production cultures of the strains are extracted with ethyl acetate and the crude extracts are analyzed by HPLC. Furthermore, the extracts are tested for their bioactivity by different assays. For structure elucidation the compound of interest is purified by a combination of different chromatography methods.
Genome sequencing coupled with genome mining allows the identification of a natural product biosynthetic gene cluster using different computer programs. To confirm that the correct gene cluster has been identified, gene inactivation experiments have to be performed. The resulting mutants are analyzed for the production of the particular natural product. Once the correct gene cluster has been inactivated, the strain should fail to produce the compound.
The workflow is shown for the antibacterial compound polyketomycin produced by Streptomyces diastatochromogenes T&#252;6028. Around ten years ago, when genome sequencing was still very expensive, the cloning and identification of a gene cluster was a very time-consuming process. Fast genome sequencing combined with genome mining accelerates the trial of cluster identification and opens up new ways to explore biosynthesis and to generate novel natural products by genetic methods. The protocol described in this paper can be assigned to any other compound derived from a Streptomyces strain or another microorganism.

Here we present a detailed protocol of (A) the identification of a natural product with antibiotic activity, (B) the purification of the compound, (C) the first model of its biosynthesis, (D) genome sequencing/-mining and the (E) verification of the biosynthetic gene cluster.

에서 Polyketomycin를 사용하여 데모 : 그 생합성 유전자 클러스터에 천연 제품에서<em&gt; 스트렙토 마이 세스 (Streptomyces)의 diastatochromogenes</em&gt; Tü6028

Streptomyces strains are known for their capability to produce a lot of different compounds with various bioactivities. Cultivation under different ...

연구

유전학

The Green Monster Process for the Generation of Yeast Strains Carrying Multiple Gene Deletions

Phenotypes for a gene deletion are often revealed only when the mutation is tested in a particular genetic background or environmental condition1,2. There are examples where many genes need to be deleted to unmask hidden gene functions3,4. Despite the potential for important discoveries, genetic interactions involving three or more genes are largely unexplored. Exhaustive searches of multi-mutant interactions would be impractical due to the sheer number of possible combinations of deletions. However, studies of selected sets of genes, such as sets of paralogs with a greater a priori chance of sharing a common function, would be informative.
In the yeast Saccharomyces cerevisiae, gene knockout is accomplished by replacing a gene with a selectable marker via homologous recombination. Because the number of markers is limited, methods have been developed for removing and reusing the same marker5,6,7,8,9,10. However, sequentially engineering multiple mutations using these methods is time-consuming because the time required scales linearly with the number of deletions to be generated.
Here we describe the Green Monster method for routinely engineering multiple deletions in yeast11. In this method, a green fluorescent protein (GFP) reporter integrated into deletions is used to quantitatively label strains according to the number of deletions contained in each strain (Figure 1). Repeated rounds of assortment of GFP-marked deletions via yeast mating and meiosis coupled with flow-cytometric enrichment of strains carrying more of these deletions lead to the accumulation of deletions in strains (Figure 2). Performing multiple processes in parallel, with each process incorporating one or more deletions per round, reduces the time required for strain construction.
The first step is to prepare haploid single-mutants termed 'ProMonsters,' each of which carries a GFP reporter in a deleted locus and one of the 'toolkit' loci&#x2014;either Green Monster GMToolkit-a or GMToolkit-&alpha; at the can1&Delta; locus (Figure 3). Using strains from the yeast deletion collection12, GFP-marked deletions can be conveniently generated by replacing the common KanMX4 cassette existing in these strains with a universal GFP-URA3 fragment. Each GMToolkit contains: either the a- or &alpha;-mating-type-specific haploid selection marker1 and exactly one of the two markers that, when both GMToolkits are present, collectively allow for selection of diploids.
The second step is to carry out the sexual cycling through which deletion loci can be combined within a single cell by the random assortment and/or meiotic recombination that accompanies each cycle of mating and sporulation.

The Green Monster method enables the rapid assembly of multiple deletions marked with a reporter gene encoding green fluorescent protein. This method is based on driving yeast strains through repeated cycles of sexual assortment of deletions and fluorescence-based enrichment of cells carrying more deletions.

여러 유전자 삭제를 운반 효모 종자의 생성에 대한 초록 괴물 프로세스

Phenotypes  for a gene deletion are often revealed only when the mutation is tested in a  particular genetic background or environmental condition1,2. ...

생물학

Purification of a High Molecular Mass Protein in Streptococcus mutans

Elucidation of a gene&#39;s function typically involves comparison of phenotypic traits of wild-type strains and strains in which the gene of interest has been disrupted. Loss of function following gene disruption is subsequently restored by exogenous addition of the product of the disrupted gene. This helps to determine the function of the gene. A method previously described involves generating a gtfC gene-disrupted Streptococcus mutans strain. Here, an undemanding method is described for purifying the gtfC gene product from the newly generated S. mutans strain following the gene disruption. It involves the addition of a polyhistidine-coding sequence at the 3&#8242; end of the gene of interest, which allows simple purification of the gene product using immobilized metal affinity chromatography. No enzymatic reactions other than PCR are required for the genetic modification in this method. The restoration of the gene product by exogenous addition after gene disruption is an efficient method for determining gene function, which may also be adapted to different species.

Purification of a High Molecular Mass Protein in Streptococcus mutans

Described here is a simple method for the purification of a gene product in Streptococcus mutans. This technique may be advantageous in the purification of proteins, especially membrane proteins and high molecular mass proteins, and can be used with various other bacterial species.

연쇄상 구균 뮤탄에서 높은 분자 질량 단백질의 정화

Elucidation of a gene&#39;s function typically involves comparison of phenotypic traits of wild-type strains and strains in which the gene of interest has ...

면역학 및 감염병학

Genome-wide Gene Deletions in Streptococcus sanguinis by High Throughput PCR

Transposon mutagenesis and single-gene deletion are two methods applied in genome-wide gene knockout in bacteria 1,2. Although transposon mutagenesis is less time consuming, less costly, and does not require completed genome information, there are two weaknesses in this method: (1) the possibility of a disparate mutants in the mixed mutant library that counter-selects mutants with decreased competition; and (2) the possibility of partial gene inactivation whereby genes do not entirely lose their function following the insertion of a transposon. Single-gene deletion analysis may compensate for the drawbacks associated with transposon mutagenesis. To improve the efficiency of genome-wide single gene deletion, we attempt to establish a high-throughput technique for genome-wide single gene deletion using Streptococcus sanguinis as a model organism. Each gene deletion construct in S. sanguinis genome is designed to comprise 1-kb upstream of the targeted gene, the aphA-3 gene, encoding kanamycin resistance protein, and 1-kb downstream of the targeted gene. Three sets of primers F1/R1, F2/R2, and F3/R3, respectively, are designed and synthesized in a 96-well plate format for PCR-amplifications of those three components of each deletion construct. Primers R1 and F3 contain 25-bp sequences that are complementary to regions of the aphA-3 gene at their 5' end. A large scale PCR amplification of the aphA-3 gene is performed once for creating all single-gene deletion constructs. The promoter of aphA-3 gene is initially excluded to minimize the potential polar effect of kanamycin cassette. To create the gene deletion constructs, high-throughput PCR amplification and purification are performed in a 96-well plate format. A linear recombinant PCR amplicon for each gene deletion will be made up through four PCR reactions using high-fidelity DNA polymerase. The initial exponential growth phase of S. sanguinis cultured in Todd Hewitt broth supplemented with 2.5% inactivated horse serum is used to increase competence for the transformation of PCR-recombinant constructs. Under this condition, up to 20% of S. sanguinis cells can be transformed using ~50 ng of DNA. Based on this approach, 2,048 mutants with single-gene deletion were ultimately obtained from the 2,270 genes in S. sanguinis excluding four gene ORFs contained entirely within other ORFs in S. sanguinis SK36 and 218 potential essential genes. The technique on creating gene deletion constructs is high throughput and could be easy to use in genome-wide single gene deletions for any transformable bacteria.

Genome-wide Gene Deletions in Streptococcus sanguinis by High Throughput PCR

An efficient genome-wide single gene mutation method has been established using Streptococcus sanguinis as a model organism. This method has achieved via high throughput recombinant PCRs and transformations.

게놈 전체 유전자 삭제할에<em&gt; 연쇄상 구균 sanguinis</em&gt; 높은 처리량 PCR에 의한

Transposon  mutagenesis and single-gene deletion are two methods applied in genome-wide  gene knockout in bacteria 1,2. Although transposon mutagenesis is ...

Generation of In-Frame Gene Deletion Mutants in Pseudomonas aeruginosa and Testing for Virulence Attenuation in a Simple Mouse Model of Infection

Microorganisms are genetically versatile and diverse and have become a major source of many commercial products and biopharmaceuticals. Though some of these products are naturally produced by the organisms, other products require genetic engineering of the organism to increase the yields of production. Avirulent strains of Escherichia coli have traditionally been the preferred bacterial species for producing biopharmaceuticals; however, some products are difficult for E. coli to produce. Thus, avirulent strains of other bacterial species could provide useful alternatives for production of some commercial products. Pseudomonas aeruginosa is a common and well-studied Gram-negative bacterium that could provide a suitable alternative to E. coli. However, P. aeruginosa is an opportunistic human pathogen. Here, we detail a procedure that can be used to generate nonpathogenic strains of P. aeruginosa through sequential genomic deletions using the pEX100T-NotI plasmid. The main advantage of this method is to produce a marker-free strain. This method may be used to generate highly attenuated P. aeruginosa strains for the production of commercial products, or to design strains for other specific uses. We also describe a simple and reproducible mouse model of bacterial systemic infection via intraperitoneal injection of validated test strains to test the attenuation of the genetically engineered strain in comparison to the FDA-approved BL21 strain of E. coli.

Generation of In-Frame Gene Deletion Mutants in Pseudomonas aeruginosa and Testing for Virulence Attenuation in a Simple Mouse Model of Infection

Here, we describe a simple and reproducible protocol of mouse model of infection to evaluate the attenuation of the genetically modified strains of Pseudomonas aeruginosa in comparison to the United States Food and Drug Administration (FDA)-approved Escherichia coli for commercial applications.

감염의 간단한 마우스 모델에서 녹농균 및 독성 감쇠에 대한 테스트에서 프레임 내 유전자 삭제 돌연변이의 생성

Microorganisms are genetically versatile and diverse and have become a major source of many commercial products and biopharmaceuticals. Though some of ...

Markerless Gene Deletion by Floxed Cassette Allelic Exchange Mutagenesis in Chlamydia trachomatis

Chlamydia trachomatis is an obligate intracellular pathogen that has been historically difficult to genetically manipulate. Definitive progress in elucidating the mechanisms that C. trachomatis use to create and maintain a privileged intracellular niche has been limited due to a lack of genetic tools. Fortunately, there have recently been several new advances in genetic manipulation techniques. Among these is the development of fluorescence-reported allelic exchange mutagenesis (FRAEM). This method allows targeted gene deletion coupled with insertion of a selection cassette encoding antibiotic resistance and green fluorescent protein (GFP). Reliance on this strategy can be complicated when targeting genes within polycistronic operons due to the potential of polar effects on downstream genes. Floxed cassette allelic exchange mutagenesis (FLAEM), the protocol for which is described here, was developed to alleviate cassette-induced polar effects. FLAEM utilizes Cre-loxP genome editing to remove the selection cassette after targeted deletion by allelic exchange. The resulting strains contain markerless gene deletions of one or more coding sequences. This technique facilitates direct assessment of gene function and expands the repertoire of tools for genetic manipulation in C. trachomatis.

Markerless Gene Deletion by Floxed Cassette Allelic Exchange Mutagenesis in Chlamydia trachomatis

Described here is a method for targeted, markerless gene deletion in Chlamydia trachomatis using floxed cassette allelic exchange mutagenesis, FLAEM.

클라미디아 트라코마티스의 플록세드 카세트 알레릭 교환 돌연변이에 의한 마커리스 유전자 결실

Chlamydia trachomatis is an obligate intracellular pathogen that has been historically difficult to genetically manipulate. Definitive progress in ...

Constructing Mutants in Serotype 1 Streptococcus pneumoniae strain 519/43

Streptococcus pneumoniae serotype 1 remains a huge problem in low-and-middle income countries, particularly in sub-Saharan Africa. Despite its importance, studies in this serotype have been hindered by the lack of genetic tools to modify it. In this study, we describe a method to genetically modify a serotype 1 clinical isolate (strain 519/43). Interestingly, this was achieved by exploiting the Pneumococcus&#8217; ability to naturally acquire DNA. However, unlike most pneumococci, the use of linear DNA was not successful; to mutate this important strain, a suicide plasmid had to be used. This methodology has provided the means for a deeper understanding of this elusive serotype, both in terms of its biology and pathogenicity. To validate the method, the major known pneumococcal toxin, pneumolysin, was mutated because it has a well-known and easy to follow phenotype. We showed that the mutant, as expected, lost its ability to lyse red blood cells. By being able to mutate an important gene in the serotype of interest, we were able to observe different phenotypes for loss of function mutants upon intraperitoneal and intranasal infections from the ones observed for other serotypes. In summary, this study proves that strain 519/43 (serotype 1) can be genetically modified.

Constructing Mutants in Serotype 1 Streptococcus pneumoniae strain 519/43

Here, we describe a S. pneumoniae serotype 1 strain 519/43 that can be genetically modified by using its ability to naturally acquire DNA and a suicide-plasmid. As proof of principle, an isogenic mutant in the pneumolysin (ply) gene was made.

혈청형 1 Streptococcus pneumoniae 균주 519/43에서 돌연변이 구성

Streptococcus pneumoniae serotype 1 remains a huge problem in low-and-middle income countries, particularly in sub-Saharan Africa. Despite its importance, ...

Generation of Null Mutants to Elucidate the Role of Bacterial Glycosyltransferases in Bacterial Motility

The study of glycosylation in prokaryotes is a rapidly growing area. Bacteria harbor different glycosylated structures on their surface whose glycans constitute a strain-specific barcode. The associated glycans show higher diversity in sugar composition and structure than those of eukaryotes and are important in bacterial-host recognition processes and interaction with the environment. In pathogenic bacteria, glycoproteins have been involved in different stages of the infectious process, and glycan modifications can interfere with specific functions of glycoproteins. However, despite the advances made in the understanding of glycan composition, structure, and biosynthesis pathways, understanding of the role of glycoproteins in pathogenicity or interaction with the environment remains very limited. Furthermore, in some bacteria, the enzymes required for protein glycosylation are shared with other polysaccharide biosynthetic pathways, such as lipopolysaccharide and capsule biosynthetic pathways. The functional importance of glycosylation has been elucidated in several bacteria through mutation of specific genes thought to be involved in the glycosylation process and the study of its impact on the expression of the target glycoprotein and the modifying glycan. Mesophilic Aeromonas have a single and O-glycosylated polar flagellum. Flagellar glycans show diversity in carbohydrate composition and chain length between Aeromonas strains. However, all strains analyzed to date show a pseudaminic acid derivative as the linking sugar that modifies serine or threonine residues. The pseudaminic acid derivative is required for polar flagella assembly, and its loss has an impact on adhesion, biofilm formation, and colonization. The protocol detailed in this article describes how the construction of null mutants can be used to understand the involvement of genes or genome regions containing putative glycosyltransferases in the biosynthesis of a flagellar glycan. This includes the potential to understand the function of the glycosyltransferases involved and the role of the glycan. This will be achieved by comparing the glycan deficient mutant to the wild-type strain.

Here, we describe the construction of null mutants of Aeromonas in specific glycosyltransferases or regions containing glycosyltransferases, the motility assays, and flagella purification performed to establish the involvement and function of their encoded enzymes in the biosynthesis of a glycan, as well as the role of this glycan in bacterial pathogenesis.

박테리아 운동성에서 박테리아 글리코실트랜스퍼라제의 역할을 밝히기 위한 Null 돌연변이체의 생성

The study of glycosylation in prokaryotes is a rapidly growing area. Bacteria harbor different glycosylated structures on their surface whose glycans ...

Generation of Enterobacter sp. YSU Auxotrophs Using Transposon Mutagenesis

Prototrophic bacteria grow on M-9 minimal salts medium supplemented with glucose (M-9 medium), which is used as a carbon and energy source. Auxotrophs can be generated using a transposome. The commercially available, Tn5-derived transposome used in this protocol consists of a linear segment of DNA containing an R6K&#947; replication origin, a gene for kanamycin resistance and two mosaic sequence ends, which serve as transposase binding sites. The transposome, provided as a DNA/transposase protein complex, is introduced by electroporation into the prototrophic strain, Enterobacter sp. YSU, and randomly incorporates itself into this host&#8217;s genome. Transformants are replica plated onto Luria-Bertani agar plates containing kanamycin, (LB-kan) and onto M-9 medium agar plates containing kanamycin (M-9-kan). The transformants that grow on LB-kan plates but not on M-9-kan plates are considered to be auxotrophs. Purified genomic DNA from an auxotroph is partially digested, ligated and transformed into a pir+ Escherichia coli (E. coli) strain. The R6K&#947; replication origin allows the plasmid to replicate in pir+ E. coli strains, and the kanamycin resistance marker allows for plasmid selection. Each transformant possesses a new plasmid containing the transposon flanked by the interrupted chromosomal region. Sanger sequencing and the Basic Local Alignment Search Tool (BLAST) suggest a putative identity of the interrupted gene. There are three advantages to using this transposome mutagenesis strategy. First, it does not rely on the expression of a transposase gene by the host. Second, the transposome is introduced into the target host by electroporation, rather than by conjugation or by transduction and therefore is more efficient. Third, the R6K&#947; replication origin makes it easy to identify the mutated gene which is partially recovered in a recombinant plasmid. This technique can be used to investigate the genes involved in other characteristics of Enterobacter sp. YSU or of a wider variety of bacterial strains.

Generation of Enterobacter sp. YSU Auxotrophs Using Transposon Mutagenesis

Enterobacter sp. YSU grows in glucose minimal salts medium. Auxotrophs are generated by transforming it with a transposome which randomly inserts itself into the host genome. Mutants are found by replica plating from complex medium to minimal medium. Interrupted genes are identified by gene rescue and sequencing.

생성<em&gt; 엔테로 박터</em&gt; SP. YSU 영양 요구는 트랜스포존 돌연변이 유발을 사용하여

Prototrophic bacteria grow on M-9 minimal salts medium supplemented with glucose (M-9 medium), which is used as a carbon and energy source. Auxotrophs can ...

Generation of Marked and Markerless Mutants in Model Cyanobacterial Species

Cyanobacteria are ecologically important organisms and potential platforms for production of biofuels and useful industrial products. Genetic manipulation of cyanobacteria, especially model organisms such as Synechocystis sp. PCC6803 and Synechococcus sp. PCC7002, is a key tool for both basic and applied research. Generation of unmarked mutants, whereby chromosomal alterations are introduced into a strain via insertion of an antibiotic resistance cassette (a manipulatable fragment of DNA containing one or more genes), followed by subsequent removal of this cassette using a negative selectable marker, is a particularly powerful technique. Unmarked mutants can be repeatedly genetically manipulated, allowing as many alterations to be introduced into a strain as desired. In addition, the absence of genes encoding antibiotic resistance proteins in the mutated strain is desirable, as it avoids the possibility of 'escape' of antibiotic resistant organisms into the environment. However, detailed methods for repeated rounds of genetic manipulation of cyanobacteria are not well described in the scientific literature. Here we provide a comprehensive description of this technique, which we have successfully used to generate mutants with multiple deletions, single point mutations within a gene of interest and insertion of novel gene cassettes.

Introducing multiple genomic alterations into cyanobacteria is an essential tool in the development of strains for industrial and basic research purposes. We describe a system for generating unmarked mutants in the model cyanobacterial species Synechocystis sp. PCC6803 and marked mutants in Synechococcus sp. PCC7002.

모델 시아 노 박테리아 종의 표시 및 Markerless 돌연변이의 생성

Cyanobacteria are ecologically important organisms and potential platforms for production of biofuels and useful industrial products. Genetic manipulation ...

유전자 교란 mutans 연쇄 상 구 균 긴장 없이 유전자 복제의 생성

요약

더 많은 비디오 탐색

이 비디오의 챕터

에서 Polyketomycin를 사용하여 데모 : 그 생합성 유전자 클러스터에 천연 제품에서