이 작품은 과학의 승진 [부여 번호 16 K 15860 T.M. 15 K 15777 햄프셔를]에 대 한 일본 사회에 의해 지원 되었다.

1. 뇌관 디자인 <ol><li>뇌관 2 단계 융합 PCR 및 유전자 장애의 확인에 대 한 준비. 
	주: 표 1이 프로토콜에 사용 되는 뇌관 시퀀스를 보여 줍니다. 그림 1 S. mutans Δ gtfC를 생성 하는 데 사용 하는 2 단계 융합 PCR 방법의 개요 그림을 보여준다.
	<li>디자인 뇌관 spectinomycin 저항 유전자 (spc r) 7 게놈에 대상 영역의 교체에 대 한 <ol>. 이 프로토콜 spc r gtfC 유전자의 코딩 지역 전체 바꿉니다.</li>
		<li>5에서 15 기지 spc r의 위쪽과 아래쪽 끝에 보완을 포함 &#39; 최대 역의 지역 및 다운-앞으로 뇌관, 각각. 마찬가지로, 5에서 15 베이스 gtfC의 업스트림 측면에 서 영역의 아래쪽 끝 및 gtfC의 다운스트림 측면에 서 영역의 위쪽 끝에 보완을 포함 &#39; spc r의 지역-앞으로 및 spc r -반전 뇌관, 각각 ( 그림 1A). 
		참고: 시퀀스의 최대 반전, 아래-앞으로, spc r-앞으로, 및 spc r-반전 뇌관 중단 구성의 사이트에 따라 자동으로 결정 됩니다.</li>
		<li>구성에 최대-앞으로 및 다운 반전 뇌관 디자인 &#62; 1 kb 업스트림 및 다운스트림 측면 gtfC 유전자의 지역 각각. 최대-앞으로의 녹는 온도 (T m)을 설정 하 고 다운-반전 뇌관 최대 반전 및 다운-앞으로 뇌관의 녹는 온도 따라 각각 ( 그림 1A). 
		참고: T m을 결정 하는 다음 수식에 참조: T m (° C) 2 = (* 나 + * NT) + 4 (* 노스캐롤라이나 + * NG)-5, 어디 * N (A, T, C, 또는 G) 지정 된 id 가진 뇌관 뉴클레오티드의 수를 나타냅니다.</li>
		<li>디자인 2 차 PCR ( 그림 1B)에 대 한 중첩 된 뇌관 (N_up-앞으로 및 N_up 역). 
		참고: 바깥쪽 뇌관 쌍 (최대-앞으로 및 역방향 다운) 2 차 PCR 뇌관으로 사용 될 수 있습니다, 있지만 중첩 된 뇌관 (N_up-앞으로 및 N_up 역)이이 프로토콜에 설계 되었습니다. 중첩 된 뇌관은 자주 필요 2 차 PCR, 대표 결과에 설명된대로.</li>
		<li>디자인 뇌관 spc r에 대 한 특정. GtfC 장애에 대 한 화면으로 식민지 PCR에 사용 되는 뇌관.</li>
		<li>GtfC의 확인에 대 한 디자인 뇌관 중단. 
		참고: 이러한 뇌관을 사용 하 여 증폭 PCR 제품 gtfC 또는 spc r 상류 또는 하류 측면 gtfC의 지역 사이 국경에 걸쳐져. 뇌관 세트 &#39; gtfC 최대-앞으로 및 gtfC 최대 역 &#39;와 &#39; gtfC 다운-앞으로 및 gtfC 다운 역 &#39; gtfC에 대 한 특정 및 &#39; gtfC 최대-앞으로 및 spc r 2 -역 &#39;와 &#39; spc r 2-앞으로 및 gtfC 다운 역 &#39; spc r에 대 한 특정 있다.</li>
	</ol></li></ol> 2. S. mutans에서 게놈 DNA 추출 <ol><li>행진 주식 S. 뮤턴트의 UA159 두뇌 심 혼 주입 (BHI) 한 접시에. 혐 기성 조건 하에서 37 ° C에서 하룻밤 접시를 품 어.</li>
	<li>소독된 이쑤시개를 사용 하 여 단일 식민지를 데리 고 BHI 국물의 5 mL에 접종. 혐 기성 조건 하에서 37 ° C에서 하룻밤 S. 뮤턴트의 문화를 품 어.</li>
	<li>2000 × g.에서 15 분 동안 원심 분리기 세균성 세포 배양의 인산 염 버퍼 식 염 수 (PBS) 5 mL에 셀 펠 릿 Resuspend.</li>
	<li>2000 × g.에서 15 분 동안 원심 분리기 PBS의 200 µ L에서 셀 펠 릿 Resuspend.</li>
	<li>제조업체에서 제공 하는 지침에 따라 비드 박동 베이스 게놈 DNA 추출 키트를 사용 하 여 정지에서 게놈 DNA를 추출.
	유리 구슬 (키트에 포함)를 포함 하는 <ol><li>전송 현 탁 액 2.0 mL 샘플 튜브. 세포 현 탁 액을 세포 솔루션 (키트에 포함)의 750 µ L을 추가.</li>
		<li>단단히 뚜껑과 구슬 박동 장애 기구의 튜브 홀더에 대칭으로 튜브를 놓습니다. 5 분에 대 한 최대 속도에서 프로세스입니다. 10000 × g.에 1 분 동안 구슬 구타 원심 분리기 샘플 2.0 mL 컬렉션 튜브 및 7000 × g .에서 1 분 동안 원심 분리기에서 회전 필터 (키트에 포함)에 상쾌한 전송</li>
		<li>추가 1200 µ L의 DNA 바인딩 버퍼 (키트에 포함)는 여과 액입니다. 10000 × g.에 1 분 동안 원심 분리기를 2.0 mL 컬렉션 튜브 (키트에 포함) 스핀 열에 혼합물의 800 µ L를 전송</li>
		<li>흐름을 통해 삭제 열 매트릭스를 세척 하 고 10000 × g. 흐름 통해 삭제에서 1 분 동안 원심, 스핀에 500 µ L 워시 버퍼 (키트에 포함)의 추가 스핀 열 미리 세척 버퍼 (키트에 포함)의 200 µ L을 추가 열 열 매트릭스를 세척 하 고 10000 × g.에 1 분 동안 원심을</li>
		<li>스핀 열 새로운 microcentrifuge 1.5 mL 튜브에 놓고 열 매트릭스를 100 µ L 차입 버퍼 (키트에 포함)의 추가.</li>
		<li>30 대 분리기 elute 게놈 DNA를 10000 × g에서 s. 260에서 흡 광도 측정 하 여 DNA의 농도 및 순도 추정 nm 및 280 nmusing 분 광 광도 계는 A 260 /A 280 비율이 1.8 보다 크면 확인 하십시오.</li>
	</ol></li></ol> 3. PCR 증폭 <ol><li>수행 1 세인트 PCR PCR 템플릿 (표 1 참조)으로 미 뮤턴트의 WT 게놈 및 합성 spc r 유전자를 사용 하 여. GtfC 유전자의 측면에 서 상류 지역, gtfC 유전자와 뇌관 당로 ( 그림 1A), 위에서 설명한의 3 세트를 사용 하 여 spc r 유전자의 측면에 서 하류 지역 증폭 표 2 및 표 3. 
	참고: PCR 뇌관, 시 약, 및 증폭 사이클에서 요약 된다 표 1, 표 2 및 표 3, 각각.</li>
	<li>1 %agarose 젤에 PCR 제품 각 충분치 고 젤 밴드 커터를 사용 하 여 해당 밴드 소비 세.</li>
	<li>스핀 열 및 실리 카 멤브레인 기반 젤 추출 키트를 사용 하 여 젤에서 각 증폭된 DNA 제품을 정화.
	<ol><li>전송 깨끗 한 microcentrifuge에 젤 조각 튜브와 500 µ L 바인딩 버퍼 (키트에 포함)와 혼합. 젤 조각 완전히 해산 될 때까지 15 분 동안 55 ° C에 혼합물을 품 어.</li>
		<li>(키트에 포함) 스핀 열 컬렉션 튜브 (키트에 포함)로, 스핀 열에 샘플 로드 놓고 30 원심 11000 × g에서 s. 통해 흐름, 워시 버퍼 (키트에 포함)의 600 µ L를 실리 카 막 씻어 30 원심 회전 열 추가 11000 × g에서 s.</li>
		<li>흐름을 통해 및 실리 카 막 건조 11000 × g에서 2 분 동안 원심 분리기 삭제.</li>
		<li>스핀 열 새로운 1.5 mL microcentrifuge 튜브로, 50 µ L을 추가 차입 버퍼 (키트에 포함), 2 분에 대 한 실 온에서 품 어와</li>
		<li>11000에서 2 분 동안 원심 분리기 × g elute 증폭 된 DNA를. 260에서 흡 광도 측정 하 여 DNA의 농도 및 순도 추정 nm 및 280 nmusing 분 광 광도 계는 A 260 /A 280 비율이 1.8 보다 크면 확인 하십시오.</li>
	</ol></li> <li>수행 2 nd 2 단계 융합 표 2에 의하여 PCR 템플릿으로 세 약 아데닌 파편을 사용 하 여 PCR PCR < /st룽 > 및 표 3. 
	참고: 이러한 증폭 된 조각과 중첩 된 뇌관을 사용 하 여 접합 &#39; N_up-N_down-리버스와 &#39; 또는 바깥쪽 뇌관 &#39; 최대-앞으로 및 역방향 다운 &#39; ( 그림 1B). PCR 뇌관, 시 약, 및 증폭 주기 각각 표 1, 표 2 및 표 3에 요약 됩니다.</li>
	<li>0.8 %agarose 젤에 PCR 반응 혼합물 (5 µ L)의 1/10을 로드 하 고 적절 한 amplicon ( 그림 1C)의 생성을 확인 하려면 예상된 밴드 크기와 증폭된 밴드 크기 비교.</li>
	<li>정화 없이 에탄올 강 수에 의해 나머지 최종 PCR 제품 집중.
	<ol><li>추가 55 µ L의 울트라 순수 물 100 µL.Add에 총 볼륨을 조정 하려면 남은 PCR 혼합물에 3m 나트륨 아세테이트 (10 µ L), pH 5.2, 뒤에 100% 에탄올 (250 µ L)의 2.5 볼륨의 1/10 볼륨. 혼합 하 고 30 분-80에 대 한 동결 ° c.</li>
		<li>4 ° C에서 15000 × g에서 20 분 동안 원심 분리기 튜브의 하단에 펠 릿에 대 한 확인 하 고 삭제는 상쾌한. 70% 에탄올, 4 ° C에서 15000 × g에서 5 분 동안 원심 분리기의 1 mL와 펠 릿을 세척 하 고는 상쾌한 삭제. 약 30 분 동안 펠 릿 건조 및 매우 순수한 물 10 µ L로 분해.</li>
	</ol></li></ol> 4. 유능한 세포 준비 및 셀 변환 <ol><li>행진 주식 S. 뮤턴트의 UA159 BHI 한 천 격판덮개에. 혐 기성 조건 하에서 37 ° C에서 하룻밤 접시를 품 어.</li>
	<li>소독된 이쑤시개를 사용 하 여 단일 식민지를 데리 고 BHI 국물의 5 mL에 접종. 혐 기성 조건 하에서 37 ° C에서 하룻밤 S. 뮤턴트의 문화를 품 어.</li>
	<li>뮤턴트 S. s 문화 2 mL 50 mL BHI 국물의 전송 및 6-8 h 600에서 광학 밀도를 37 ° C에서 품 어 혐 기성 조건 하에서 0.2-0.4 nm (OD 600).</li>
	<li>4 ° C에서 2000 × g에서 15 분 동안 세포를 원심, 상쾌한, 폐기 및 40 mL 40 mL 10% 글리세롤의 뒤 차가운 물로 두 번 셀 세척. 
	참고: 잔여 물질에 영향을 미칠 후속 electroporation.</li>
	<li>발음 파스퇴르 피 펫으로 신중 하 게 상쾌한 10% 글리세롤에 셀 펠 릿의 부착 감소. 신선한 10% 글리세롤의 1 mL에 셀 resuspend, 각 microcentrifuge 1.5 mL 튜브에 정지의 50 µ L를 분배 하 고 사용 직전까지-80 ° C에 저장.</li>
	<li>믹스 50 µ L 약 수 차가운 유능한 세포의 파괴의 5 µ L로 구성 섹션 3에에서 위에서 설명한. (전극 사이의 0.2 cm 거리)와 큐 벳 electroporation에 혼합물을 추가 합니다. 황색 포도상구균 모드 사용 (1.8 k v, 600 Ω, 10 µ F, 1 펄스)의 electroporate electroporation 기구.</li>
	<li>Electroporation 직후 BHI 국물의 500 µ L에서 세포를 일시 중단 하 고 spectinomycin 포함 된 BHI-한 천 배지를 현 탁 액의 50 µ L을 추가. 
	참고: 추가 보육 시간 후 electroporation 필요 하지 않습니다. 그러나, electroporation 후 1-2 h에 대 한 보육 변환 효율을 향상 시킬 수 있습니다.</li>
	<li>혐 기성 조건 하에서 37 ° C에서 2-6 일 동안 접시를 품 어. 
	참고: 위에서 설명한 대로 S. mutans Δ gtfB가 생성 됩니다. GtfB 유전자의 전체 코딩 영역이 S. mutans Δ에 리스로 마이 신 저항 유전자 8 대체 gtfB. 각 S. mutans 긴장은 혐 기성 조건 하에서 37 ° C에서 BHI 국물에 교양.</li>
</ol> 5. 유전자 장애 및 스토리지의 확인 <ol><li>임의의 식민지를 선택 하 고 식민지 PCR 표 2와 표 3을 수행을 PCR 혼합에 그들을 예방. PCR 뇌관, 시 약, 및 증폭 주기 각각 표 1, 표 2 및 표 3에 요약 됩니다.</li>
	<li>Spc r 것인지 1 %agarose 젤에 PCR 반응 혼합물을 로드-특정 DNA 밴드.</li>
	<li>혐 기성 조건 하에서 37 ° C에서 2 일 동안 소독된 이쑤시개와 spectinomycin 포함 된 BHI의 10 mL에 2 차 배양 세포를 사용 하 여 긍정적인 식민지 국물 선택.</li>
	<li>S. mutans Δ의 생성을 확인 gtfC.
	<ol><li>세포 현 탁 액을 동등 하 게 분할. 위에서 설명한 세포에서 게놈 DNA를 추출 (2.3 단계. 2.5.5에.). GtfC 장애 표 2와 표 3 (표 1)의 확인에 대 한 프라이 머를 사용 하 여 PCR 템플릿으로 게놈 dna는 PCR을 수행. 
		참고: PCR 뇌관, 시 약, 및 증폭 사이클에서 요약 된다 표 1, 표 2 및 표 3, 각각.</li>
		<li>2 %agarose 젤에 PCR 혼합물을 로드 하 고 적절 한 amplicon .의 생성을 확인 하려면 예상된 밴드 크기와 증폭된 밴드 크기 비교</li>
		<li>4 2000 × g에서 15 분 동안 나머지 세포 현 탁 액을 원심 ° C. PBS의 5 mL에 셀 펠 릿 Resuspend.</li>
		<li>4 2000 × g에서 15 분 동안 원심 분리기 ° C. Resuspend 셀 포함 하는 25% 글리세롤 BHI 국물 1.5 mL에 작은 고-80 ° 오호-20 ° C에에서 저장</li>
	</ol></li></ol> 6. Phenotypic 분석 BHI 천 배지에 <ol><li>행진 각 S. 뮤턴트의 스트레인. 혐 기성 조건 하에서 37 ° C에서 하룻밤 접시를 품 어.</li>
	<li>소독된 이쑤시개를 사용 하 여 단일 콜로 니를 선택 하 고 적절 한 항생제 없이 BHI 국물의 2 개 mL에 접종. 혐 기성 조건 하에서 37 ° C에서 밤새 품 어.</li>
	<li>하룻밤 문화 서 스 펜 션의 20 µ L 유리 시험관에 항생제 없이 1% 또는 5% 자당을 포함 된 BHI 국물의 2 개 mL에 접종, 혐 기성 조건 하에서 37 ° C에서 하룻밤 경사 위치에 테스트 튜브 셀 문화.</li>
	<li>소용돌이 유리 시험관 10 s 및 문화 현 탁 액을 가만히 따르다. 시험관 증류수로 세 번 세척. 0.25 %Coomassie 화려한 튜브 벽에 있는 biofilms 얼룩 (CBB) 블루 하 고 다음 1 분에 대 한 품 어의 1 mL을 추가</li>
	<li>얼룩 솔루션을 가만히 따르다, 증류수와 세 번 시험관을 세척 하 고 건조 테스트 튜브.</li>
	<li>색상 밀도 CBB 스테인드-biofilm phenotypic 분석에서 biofilm을 형성 하는 능력을 결정 하는 시각의 확장을 모두 평가.</li>
</ol>

<ol>
	<li>Horton, R. M., Hunt, H. D., Ho, S. N., Pullen, J. K., Pease, L. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Engineering+hybrid+genes+without+the+use+of+restriction+enzymes:+gene+splicing+by+overlap+extension.">Engineering hybrid genes without the use of restriction enzymes: gene splicing by overlap extension.</a> Gene. 77 (1), 61-68 (1989).</li><li>Horton, R. M., Cai, Z., Ho, S. M., Pease, L. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Gene+splicing+by+overlap+extension:+tailor-made+genes+using+the+polymerase+chain+reaction.">Gene splicing by overlap extension: tailor-made genes using the polymerase chain reaction.</a> BioTechniques. 54 (3), 129-133 (2013).</li><li>Kuwayama, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=PCR-mediated+generation+of+a+gene+disruption+construct+without+the+use+of+DNA+ligase+and+plasmid+vectors.">PCR-mediated generation of a gene disruption construct without the use of DNA ligase and plasmid vectors.</a> Nucleic Acids Res. 30 (2), E2 (2002).</li><li>Sakurai, I., Mizusawa, N., Wada, H., Sato, N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Digalactosyldiacylglycerol+is+required+for+stabilization+of+the+oxygen-evolving+complex+in+photosystem+II.">Digalactosyldiacylglycerol is required for stabilization of the oxygen-evolving complex in photosystem II.</a> Plant Physiol. 145 (4), 1361-1370 (2007).</li><li>Aoki, H., Shiroza, T., Hayakawa, M., Sato, S., Kuramitsu, H. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cloning+of+a+Streptococcus+mutans+glucosyltransferase+gene+coding+for+insoluble+glucan+synthesis.">Cloning of a Streptococcus mutans glucosyltransferase gene coding for insoluble glucan synthesis.</a> Infect Immun. 53 (3), 587-594 (1986).</li><li>Hanada, N., Kuramitsu, H. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Isolation+and+characterization+of+the+Streptococcus+mutans+gtfC+gene,+coding+for+synthesis+of+both+soluble+and+insoluble+glucans.">Isolation and characterization of the Streptococcus mutans gtfC gene, coding for synthesis of both soluble and insoluble glucans.</a> Infect Immun. 56 (8), 1999-2005 (1988).</li><li>LeBlanc, D. J., Lee, L. N., Inamine, J. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cloning+and+nucleotide+base+sequence+analysis+of+a+spectinomycin+adenyltransferase+AAD(9)+determinant+from+Enterococcus+faecalis.">Cloning and nucleotide base sequence analysis of a spectinomycin adenyltransferase AAD(9) determinant from Enterococcus faecalis.</a> Antimicrob Agents Chemother. 35 (9), 1804-1810 (1991).</li><li>Macrina, F. L., Tobian, J. A., Jones, K. R., Evans, R. P., Clewell, D. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+cloning+vector+able+to+replicate+in+Escherichia+coli+and+Streptococcus+sanguis.">A cloning vector able to replicate in Escherichia coli and Streptococcus sanguis.</a> Gene. 19 (3), 345-353 (1982).</li><li>Murata, T., Hanada, N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Contribution+of+chloride+channel+permease+to+fluoride+resistance+in+Streptococcus+mutans.">Contribution of chloride channel permease to fluoride resistance in Streptococcus mutans.</a> FEMS Microbiol Lett. 363 (11), (2016).</li><li>Perry, D., Wondrack, L. M., Kuramitsu, H. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genetic+transformation+of+putative+cariogenic+properties+in+Streptococcus+mutans.">Genetic transformation of putative cariogenic properties in Streptococcus mutans.</a> Infect Immun. 41 (2), 722-727 (1983).</li><li>Lau, P. C., Sung, C. K., Lee, J. H., Morrison, D. A., Cvitkovitch, D. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=PCR+ligation+mutagenesis+in+transformable+streptococci:+application+and+efficiency.">PCR ligation mutagenesis in transformable streptococci: application and efficiency.</a> J Microbiol Methods. 49 (2), 193-205 (2002).</li><li>Ge, X., Xu, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genome-wide+gene+deletions+in+Streptococcus+sanguinis+by+high+throughput+PCR.">Genome-wide gene deletions in Streptococcus sanguinis by high throughput PCR.</a> J Vis Exp. (69), (2012).</li></ol>

저자는 공개 없다.

현재 프로토콜 1세인트 PCR 뇌관 상류와 하류 측면 게놈에서 대상 영역의 영역 약 1kb를 증폭 설계 되어야 합니다. 이러한 긴 측면에 서 시퀀스는 동종 재결합의 효율성을 개선 하는 데 필요한.
뇌관의 시퀀스 (최대 반전, 아래-앞으로, spcr-앞으로, 및 spcr-리버스)이이 프로토콜에서 자동으로 결정 되었다 중단 구성의 사이트에 따라. 각 뇌관 15 기초 5' 영역에서 2차 PCR 서식 파일의 끝에 보완을 포함 되어 있습니다. 더 이상 바인딩 사이트 중단 건설의 보다 효율적인 생산을 수 있습니다. 각 뇌관의 5' 영역에서 적어도 10 보완 기지의 포함9것이 좋습니다.
중첩 된 뇌관 (N_up-앞으로 및 N_up 역) 바깥쪽 뇌관 (최대-앞으로 및 다운 역) 보다는 2차 PCR, 사용 되었다. 2차 PCR 바깥쪽 뇌관의 사용은 어떤 경우에는;에 유용 S. mutans ΔgtfB 에 대 한 중단 구성의 성공적인 증폭 바깥쪽 뇌관 (데이터 표시 되지 않음)를 사용 하 여 달성 되었다. 그러나, 부족 한 PCR 증폭, 그림 3에서 같이 2차 PCR 단계 바깥쪽 프라이 머를 사용 하 여 자주 발생합니다. 중첩 된 뇌관의 사용은9이 문제 해결 하기 위해 발견 되었다. 그러나 때 중단 구조는 실질적으로 중첩 된 뇌관을 사용 하 여 증폭 하지은,, 1 PCR에 사용 되는 뇌관의 재설계 해야 합니다.
식민지 PCR 유전자 교란 스트레인의 편리한 검사 수 있습니다. 알려진된 시퀀스의 뇌관은 spcr를 사용 하 여 유전자 교란 스트레인의 세대에 대 한 적용할 수 있습니다. Electroporation은 S. mutans WT, 중단 구문의 도입 electroporation를 사용 하 여 달성 변환 효율은 일반적으로 다른 프로시저에서 사용할 수 이상으로 사용 되었다. 능력을 자극 펩 티 드와 말 혈 청, 또는 말 혈 청을 사용 하 여 변환은 구10,,1112에 널리 허용 됩니다. Electroporation 기구 필요 하지만 유능한 세포 준비 등 관련된 절차는 다른 방법10,11에 비해 훨씬 간단 하 게. 또한, electroporation 동물 복지의 관점에서 것이 좋습니다.
현재 프로토콜 번호 ofantibiotic 표식에 따라 여러 유전자 장애에 적용 됩니다. GtfC-및 gtfB를 생성 하기 위해- S. mutans 긴장, 예를 들어 gtfC에 대 한 DNA 구조를 중단-중단 2 단계 PCR에 의해 건설 S. mutans Δ로 변형 될 수 있습니다gtfB. GtfC 및 gtfB 는 경우에 인접 한, S. mutans ΔgtfC 과 S. mutans ΔgtfB 유전자 사용 해야 합니다 2 단계 PCR에 대 한 템플릿으로 동종 시퀀스를 유지 하기 위해 동종 재결합입니다. 사실, 이중 유전자 교란 S. mutans 긴장 이전이 프로토콜9에 의해 건설 되었다.
S. mutans 에 유전자 장애에 대 한 현재의 프로토콜은 다양 한 종의 유전자 교란 종자의 생성에 대 한 적응 수 있습니다. 이 프로토콜은 기존의 프로토콜에 관련 된 유전자 복제 단계를 필요 하지 않습니다. 또한, PCR는 유일한 필수 효소 반응; 따라서, 플라스 미드 벡터, 대장균, 리가, 그리고 제한 효소 필요 하지 않습니다. 또한, 현재 프로토콜 구문 디자인 대상 유전자의 금지 효소 사이트를 독립적으로 중단 구축의 디자인 측면에서 더 큰 유연성을 제공 합니다. 연구원은 삭제 또는 업스트림 측면에 서 영역의 확대를 위한 역방향 뇌관 및 다운스트림 측면에 서 영역의 확대를 위한 앞으로 뇌관 디자인 게놈에서 보존 하는 영역을 결정할 수 있습니다. 지역 측면에 서는 이들은 즉시 업스트림 그리고 즉시 다운스트림 DNA의 영역의 각각 삭제, 원하는. 이러한 유연성 proximate 유전자의 표현에 극 효과 등 외부의 영향을 감소를 사용할 수 있습니다.

유전자 기능 분석은 일반적으로 야생-타입 긴장과 긴장에 관심사의 특정 유전자 중단 되었습니다 phenotypic 비교를 포함 한다. 이 유전자-중단 기술은 다양 한 포유 동물에 박테리아에서 taxa에에서 유전자 기능 분석에 대 한 활용 되었습니다. 유전자 장애 개념은 유전자 교란 스트레인;의 생성에 필요한 이 deoxyribonucleic 산 (DNA) 구문 업스트림 및 다운스트림 영역 대상 유전자의 측면에 융합 항생제 내성 표시 유전자의 구성 되어 있으며 동종 재결합을 통해 게놈으로 통합 됩니다. 유전자 교란 스트레인 항생제를 포함 하는 선택적 미디어를 사용 하 여 격리 될 수 있습니다. 유전자 교란 스트레인의 건설에 사용 되는 기존의 방법 중 합 효소 연쇄 반응 (PCR), 적당 한 플라스 미드, 제한 된 소화에 유전자의 결 찰에 의해 대상 유전자의 증폭 등의 복잡 한 단계 필요 효소, 그리고 항생제-저항 마커 유전자 삽입을 religation. 이 과정은 시간이 많이 걸리는, 각 단계의 성공에 따라 몇 주 몇 일 복용. 또한, 장애 구문 디자인 대상 유전자의 금지 효소 사이트에 따라 달라 집니다. 이러한 문제를 해결 하려면 DNA PCR 기반 접합 방법1,2 Dictyostelium discoideum3 , Synechocystis sp. PCC68034 의 돌연변이 유전자 교란의 디자인에 대 한 보고 되었습니다. 현재 연구에서 메서드는 상대적으로 손쉬운, 신속 하 고 저렴 한 방식으로, 파괴의 건설에 대 한 수정 된 PCR 기반 방법 (지정 2 단계 융합 PCR)을 이용 하 여 유전자 교란 연쇄 구 균 긴장을 생성 하 개발 되었다 구문 및 electroporation 유전자 변환에 대 한입니다.
PCR는 적절 하 게 genomic DNA, PCR 템플릿으로 항생제 내성 표시 유전자 및 4 쌍의 필요 2 단계 융합 oligonucleotide 뇌관 설계 되었습니다. 첫 번째 단계 (1세인트 PCR), 1 kb 업스트림 측면에 서 지역 1 kb 다운스트림 측면에 서 지역 대상의 대상 유전자의 유전자, 그리고 항생제-저항 마커 유전자 PCR에 의해 증폭 됩니다. 역방향 뇌관 및 증폭의 상류와 하류에 대 한 앞으로 뇌관의 5' 지역 지역, 각각, 측면 15 기지 마커 유전자의 끝에 보완을 포함 됩니다. 5' 영역 마커 유전자 증폭에 대 한 정방향 및 역방향 뇌관의 비슷하게 포함 15 기초 대상 유전자의 상류 측면에 서 영역의 아래쪽 끝 고 대상 유전자의 하류 측면에 서 영역의 위쪽 끝을 보완 각각. 따라서, 3 개의 증폭 된 파편 퓨전 사이트에서 겹치는 30-기본적인 쌍 지역 포함. 두 번째 단계 (2차 PCR), 1세인트 PCR 템플릿으로 의해 증폭 3 조각을 사용 하 여 중첩된 한 PCR 뇌관으로 PCR 수행 됩니다. 서식 파일의 상호 보완적인 영역 또한 2차 PCR을 통해 서로 연결 됩니다. 마지막으로, 동종 재결합에 대 한 구문 electroporation 야생-타입 스트레인에 소개 된다. 성공적인 유전자 장애 특정 뇌관을 사용 하 여 PCR에 의해 확인 될 수 있습니다. 중단 구조는 고 충실도 DNA 중 합 효소를 사용 하 여 증폭, 비록 추가 효소 반응, DNA 결 찰 등 DNA 소화, 구조를 생성 하기 위해 필요 하지 않습니다. 또한, 게놈에 삭제 또는 보존 지역 뇌관 디자인에 따라 유연 하 게 선택할 수 있습니다.
현재 작업에서 glucosyltransferase mutans 연쇄 상 구 균에에서 인코딩하는 gtfC 유전자의 전체 코딩 영역의 삭제 연쇄 구 균 종에서 신속 하 고 쉽게 유전자 장애 메서드를 보여 주기 위해 수행 되었다. 또한, gtfB-방해 스트레인 같은 방식으로 생성 된. GtfC 와 gtfB 에 의해 glucosyltransferases cariogenic 치과 biofilm 개발5,6에 기여 한다. 야생-타입의 biofilm 형성 능력 스트레인 (S. mutans WT), gtfC-스트레인 (S. mutans ΔgtfC), 및 gtfB중단-방해 스트레인 (S. mutans ΔgtfB) 평가 했다 대 한 비교 phenotypic 분석. 이 프로토콜 추가 종 유전자 장애에 대 한 2 단계 방법의 응용 프로그램을 확장 하 고 taxa의 넓은 범위에서 유전자 기능 연구에 대 한 수정할 수 있습니다.

<table>
	<tbody>
		<tr>
			<td>Streptococus mutans</td>
			<td>Stock strain in the lab.</td>
			<td></td>
			<td>Wild-type strain (Strain UA159)</td>
		</tr>
		<tr>
			<td>Genomic DNA extraction kit</td>
			<td>Zymo Research</td>
			<td>D6005</td>
			<td></td>
		</tr>
		<tr>
			<td>Bead-beating disruption apparatus</td>
			<td>Taitec</td>
			<td>GM-01</td>
			<td></td>
		</tr>
		<tr>
			<td>Synthetic genes</td>
			<td>Eurofins Genomics</td>
			<td>Custom-ordered</td>
			<td>Spectinomycin- and erythromycin-resistance gene</td>
		</tr>
		<tr>
			<td>Thermal cycler</td>
			<td>Astec</td>
			<td>PC-708</td>
			<td></td>
		</tr>
		<tr>
			<td>PCR primers</td>
			<td>Eurofins Genomics</td>
			<td>Custom-ordered</td>
			<td>35 bases in length</td>
		</tr>
		<tr>
			<td>DNA polymerase</td>
			<td>Takara</td>
			<td>R045A</td>
			<td>High-fidelity DNA polymerase</td>
		</tr>
		<tr>
			<td>Gel extraction kit</td>
			<td>Nippon Genetics</td>
			<td>FG-91202</td>
			<td>DNA extraction from agarose gel</td>
		</tr>
		<tr>
			<td>Gel band cutter</td>
			<td>Nippon Genetics</td>
			<td>FG-830</td>
			<td></td>
		</tr>
		<tr>
			<td>Spectrophotometer</td>
			<td>Beckman Coulter</td>
			<td>DU 800</td>
			<td></td>
		</tr>
		<tr>
			<td>Electroporator</td>
			<td>Bio-rad</td>
			<td>1652100</td>
			<td></td>
		</tr>
		<tr>
			<td>Electroporation cuvette</td>
			<td>Bio-rad</td>
			<td>1652086</td>
			<td>0.2-cm gap</td>
		</tr>
		<tr>
			<td>Anaeropack</td>
			<td>Mitsubishi Gas Chemical</td>
			<td>A-03</td>
			<td>Anaerobic culture system</td>
		</tr>
		<tr>
			<td>Brain heart infusion broth</td>
			<td>Becton, Dickinson</td>
			<td>237500</td>
			<td>Bacterial culture media</td>
		</tr>
		<tr>
			<td>Spectinomycin</td>
			<td>Wako</td>
			<td>195-11531</td>
			<td>Antibiotics</td>
		</tr>
		<tr>
			<td>Erythromycin</td>
			<td>Wako</td>
			<td>057-07151</td>
			<td>Antibiotics</td>
		</tr>
		<tr>
			<td>Sucrose</td>
			<td>Wako</td>
			<td>196-00015</td>
			<td>For biofilm development</td>
		</tr>
		<tr>
			<td>CBB R-250</td>
			<td>Wako</td>
			<td>031-17922</td>
			<td>For biofilm staining</td>
		</tr>
	</tbody>
</table>

generation of a gene-disrupted streptococcus mutans strain without gene cloning

특정 유전자의 기능 설명에 대 한 일반적인 방법을 야생-타입 스트레인 및 관심사의 유전자 교란 되었습니다 했다 긴장의 비교 phenotypic 분석을 포함 한다. 유전자 장애 DNA 구조 적당 한 항생제 내성 표시 유전자를 포함 하는 박테리아의 변종 유전자 교란의 세대에 대 한 유용 합니다. 그러나, 전통적인 건축 방법, 유전자 복제 단계를 필요로 하는 복잡 하 고 시간이 걸리는 프로토콜을 포함 한다. 여기, 타겟된 유전자 장애 mutans 연쇄 상 구 균에 에서 대 한 상대적으로 손쉬운, 빠르고 비용 효율적인 방법을 설명 합니다. 메서드는 2 단계 융합 연쇄 반응 (PCR) 중단 구조 및 유전자 변환 위한 electroporation 생성 하 이용 한다. 이 메서드는 효소 반응, PCR, 이외의 필요 하지 않습니다 그리고 또한 중단 구성의 디자인 측면에서 더 큰 유연성을 제공 합니다. 고용 electroporation의 유능한 세포 준비를 용이 하 게 하 고 변환 효율을 향상 시킵니다. 현재 메서드는 다양 한 종의 유전자 교란 종자의 생성에 대 한 적응 수 있습니다.

그림 2 는 그 1세인트 PCR, 각 제품의 크기, 1 %agarose 젤에 관찰 했다 약 1 kb의 예상된 크기와 좋은 계약에. 그림 3 의 2차 PCR 제품의 젤 전기 이동 법 분석을 보여준다. 그림 4 는 S. mutans 식민지 붕괴 구조와 식민지 PCR 제품의 젤 전기 이동 법 분석 변환. 모든 식민지에서 amplicons 예측된 크기의 이었다. 그림 5 는 gtfC 중단 및 젤 전기 이동 법의 PCR 제품의 확인에 대 한 입문서-바인딩 사이트. GtfC-특정 뇌관 세트를 사용 하 여 증폭 하 여 얻은 PCR 제품 확인 되었다 S. mutans WT, S. mutans ΔgtfC에 PCR 제품 spcr를 사용 하 여 얻은 반면-특정 뇌관 세트 S. mutans ΔgtfC 에 확인 되었다 그러나 하지 S. mutans WT. 각 S. mutans 긴장의 자당 파생 biofilm 형성 능력 보여준다 그림 6 . S. mutans WT 자당;의 존재에 의해 부착 biofilm 형성 되었다 S. mutans ΔgtfB 의 부착 biofilm 형성 능력 있던 보다 S. mutans WT.의 S. mutans ΔgtfC 전시 자당의 매우 낮은 부착 biofilm 형성.
<img alt="Figure 1" class="xfigimg" src="/files/ftp_upload/56319/56319fig1.jpg"> 
2 단계 융해 PCR 1:Strategy 그림. S의 도식 적인 그림입니다. mutans ΔgtfC 건설 표시 됩니다. 유전자 길이 규모. (A) 상류와 하류 지역 gtfC 및 spcr 의 측면 loci PCR에 의해 증폭 되었다. 뇌관 바인딩 사이트 서식 파일에는 동일한 패턴으로 표시 됩니다. (B) 두 번째 PCR 단계 중첩 된 뇌관으로 PCR 첫걸음에서 증폭 된 3 조각 (서식 파일)로 사용 하 여 수행 되었다. (C) 붕괴 구조 세균성 긴장에 동종 재결합에 대 한 얻은 했다. <a href="//ecsource.jove.com/files/ftp_upload/56319/56319fig1large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭 하십시오.</a>
<img alt="Figure 2" class="xfigimg" src="/files/ftp_upload/56319/56319fig2.jpg"> 
1세인트 PCR 제품의 그림 2: 대표적인 젤 전기 이동 법. GtfC 의 업스트림 측면에 서 지역 및 gtfC 및 spcr 의 다운스트림 측면에 서 지역의 Amplicons 표시 됩니다. M: 분자 감 적입니다. <a href="//ecsource.jove.com/files/ftp_upload/56319/56319fig2large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭 하십시오.</a>
<img alt="Figure 3" class="xfigimg" src="/files/ftp_upload/56319/56319fig3.jpg"> 
그림 3: 2노스다코타 PCR 제품의 대표적인 젤 전기 이동 법. 중첩 된 뇌관으로 증폭 제품 고 바깥쪽 뇌관 표시 됩니다. 단단한 화살표 중단 구축의 예상된 크기를 나타냅니다. M: 분자 감 적입니다.
<img alt="Figure 4" class="xfigimg" src="/files/ftp_upload/56319/56319fig4.jpg"> 
그림 4: 식민지 PCR (A). 로 gtfC 장애에 대 한 심사 S. mutans 식민지에 spectinomycin 포함 된 BHI 천 배지; 각 동그라미 숫자가 나타냅니다 식민지 id입니다. (B) 대표 젤 전기 이동 법의 식민지 PCR 제품; 각 동그라미 레인 번호 그림 4A에서 해당 식민지 ID를 나타냅니다. M: 분자 마커, WT: 야생-타입 게놈 DNA 템플릿으로 사용. <a href="//ecsource.jove.com/files/ftp_upload/56319/56319fig4large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭 하십시오.</a>
<img alt="Figure 5" class="xfigimg" src="/files/ftp_upload/56319/56319fig5.jpg"> 
그림 5: 확인 PCR에 의해 gtfC 장애의. (A) 뇌관 바인딩 사이트; 유전자 길이 아니다 규모. PCR은 S. mutans 게놈 DNA를 템플릿으로 사용 하 여 수행 되었다. 뇌관 세트: gtfC 최대-앞으로 및 gtfC 최대 역 ( gtfC에 대 한 특정); gtfC 다운-앞으로 및 gtfC 다운-리버스 ( gtfC에 대 한 특정); gtfC 최대-앞으로 및 spcr2-리버스 ( spcr에 대 한 특정); spcr2-앞으로 하 고 gtfC 다운 역 ( spcr에 대 한 특정). (B) 대표 젤 전기 이동 법의 PCR 제품; 각 원된 레인 번호 그림 5A에 해당 뇌관을 나타냅니다. 하나의 전기 이동 이미지 마커 밴드를 분할 된다. M: 분자 감 적 (100 기본적인 쌍 사다리). <a href="//ecsource.jove.com/files/ftp_upload/56319/56319fig5large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭 하십시오.</a>
<img alt="Figure 6" class="xfigimg" src="/files/ftp_upload/56319/56319fig6.jpg"> 
그림 6: Phenotypic 분석 기반 biofilm 개발. 자당 파생 biofilms 각 S. mutans 긴장에 의해 형성 되었다 Coomassie 화려한 파란 얼룩이 진다. WT: S. mutans WT, ΔgtfB: S. mutans ΔgtfB, ΔgtfC: S. mutans ΔgtfC. <a href="//ecsource.jove.com/files/ftp_upload/56319/56319fig6large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭 하십시오.</a>
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>뇌관 쌍</td>
			<td colspan="2">시퀀스 (5' 3')</td>
			<td>예상된 밴드 크기 (bp)</td>
		</tr>
		<tr>
			<td>gtfC 장애에 대 한 2 단계 PCR</td>
			<td colspan="2"></td>
			<td></td>
		</tr>
		<tr>
			<td>1 PCR</td>
			<td colspan="2"></td>
			<td></td>
		</tr>
		<tr>
			<td>최대-앞으로 최대 역</td>
			<td colspan="2">AAGATATTTTGATAAGCAATCTGGGAACATGTATC 
			CGAACGAAAATCGA TATTTCCTCCAAAAAT AGTTA</td>
			<td>1,036</td>
		</tr>
		<tr>
			<td>spcr-앞으로 
			spcr-리버스</td>
			<td colspan="2">ATTTTTGGAGGAAATA TCGATTTTCGTTCG TGAAT 
			CTTCTAAGATAAGTA CATATGCAAGGGTTT ATTGT</td>
			<td>1,188</td>
		</tr>
		<tr>
			<td>다운-앞으로 다운 역</td>
			<td colspan="2">AAACCCTTGCATATG TACTTATCTTAGAAG AATAG TTAAGAGCAAGTTTAAGATAGAACATGTTACTCAC</td>
			<td>1,059</td>
		</tr>
		<tr>
			<td>2 PCR</td>
			<td colspan="2"></td>
			<td></td>
		</tr>
		<tr>
			<td>N_up-앞으로 N_down-역</td>
			<td colspan="2">TTTTATTGAAAACGAAGAAGGTAAATGGCTGTATC GCCATACTTAGAGAAATTTCTTTGCTAAATTCTTG</td>
			<td>3,132</td>
		</tr>
		<tr>
			<td>GtfC 장애의 확인</td>
			<td colspan="2"></td>
			<td></td>
		</tr>
		<tr>
			<td>식민지 PCR 검사</td>
			<td colspan="2"></td>
			<td></td>
		</tr>
		<tr>
			<td>S_spcr-앞으로 S_spcr-리버스</td>
			<td colspan="2 colspan=""></td colspan="2></tr></tbody></table>"> GGATCAGGAGTTGAGAGTGGACTAAAACCAAATAG CAGCCACTGCATTTCCCGCAATATCTTTTGGTATG
			<td>535</td>
		
		<tr>
			<td>최종 확인</td>
			<td colspan="2"></td>
			<td></td>
		</tr>
		<tr>
			<td>gtfC 최대-앞으로 
			gtfC 최대 역</td>
			<td colspan="2">TACGGCCGTATCAGTTATTACGATGCTAACTCTGG GGTTGGTTGAGATGTTGCTGAAGTTGCTGTACTTG</td>
			<td>498</td>
		</tr>
		<tr>
			<td>gtfC 다운-앞으로 
			gtfC 다운 역</td>
			<td colspan="2">GCCTTAATTGGTTGGCATGTTGTTGAAGGAAGACG TTGTCCACTTTGAAGTCAACGTCTTGCAAGGCATG</td>
			<td>557</td>
		</tr>
		<tr>
			<td>gtfC 최대-앞으로 
			spcr2 역</td>
			<td colspan="2">위에서 설명한 CCACTCTCAACTCCTGATCCAAACATGTAAGTACC</td>
			<td>641</td>
		</tr>
		<tr>
			<td>spcr2 앞으로 
			gtfC 다운 역</td>
			<td colspan="2">GTGGCTGAATCTTCTCCATTAGAACATAGGGAGAG 위에서 설명한</td>
			<td>623</td>
		</tr>
	

표 1:이 프로토콜에 사용 되는 뇌관. 밑줄이 시퀀스 ' 최대 반전 및 spcr-앞으로 '와 'spcr-리버스 및 다운-앞으로 ' 무료. 대담한 형식의 시퀀스 ' 최대 반전 및 spcr-앞으로 '와 'spcr-r 다운-앞으로 ' 보완.
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>시 약</td>
			<td>재고 솔루션의 농도</td>
			<td>볼륨</td>
			<td>최종 농도</td>
		</tr>
		<tr>
			<td>Dna 중 합 효소 프리 믹스</td>
			<td>2 ×</td>
			<td>25 Μ</td>
			<td>1 ×</td>
		</tr>
		<tr>
			<td>앞으로 뇌관</td>
			<td>5 Μ M</td>
			<td>2 Μ</td>
			<td>0.2 Μ M</td>
		</tr>
		<tr>
			<td>반전 뇌관</td>
			<td>5 Μ M</td>
			<td>2 Μ</td>
			<td>0.2 Μ M</td>
		</tr>
		<tr>
			<td>템플릿 DNA</td>
			<td>변수</td>
			<td>변수</td>
			<td>변수 * * * * * *</td>
		</tr>
		<tr>
			<td>이온된 수</td>
			<td>-</td>
			<td>최대 50 μ</td>
			<td>-</td>
		</tr>
	</tbody>
</table>
표 2: PCR 시 약. * 1세인트 단계 PCR;에 대 한 100 ng. * * 대 한 2차 PCR; 1세인트 단계 PCR amplicon의 각 30-50 ng. 식민지 PCR; 반응 혼합물을 세균성 세포의 직접적인 추가.
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>사이클 단계</td>
			<td>온도</td>
			<td>시간</td>
			<td>사이클 수</td>
		</tr>
		<tr>
			<td>초기 변성</td>
			<td>98 ° C</td>
			<td>2 분</td>
			<td>1</td>
		</tr>
		<tr>
			<td>변성 어 닐 링 확장</td>
			<td>98 ° C 55 ° C 72 ° C</td>
			<td>10 s 5 s Amplicon 종속 (1 분/1 kbp)</td>
			<td>35</td>
		</tr>
		<tr>
			<td>마지막 확장</td>
			<td>72 ° C</td>
			<td>Amplicon 종속 (1 분/1 kbp)</td>
			<td>1</td>
		</tr>
	</tbody>
</table>
표 3: PCR 확대 주기.

Watch this Scientific Journal Video about Generation of a Gene-disrupted Streptococcus mutans Strain Without Gene Cloning at JoVE.com

Generation of a Gene-disrupted Streptococcus mutans Strain Without Gene Cloning

우리 유전자 교란 구 mutans 의 생성에 대 한 손쉬운, 신속한, 그리고 상대적으로 저렴 한 방법 설명 변종; 이 기술은 다양 한 종의 유전자 교란 종자의 생성에 대 한 적용할 수 있습니다.

유전자 교란 mutans 연쇄 상 구 균 긴장 없이 유전자 복제의 생성

Typical methods for the elucidation of the function of a particular gene involve comparative phenotypic analyses of the wild-type strain and a strain in ...

generation-gene-disrupted-streptococcus-mutans-strain-without-gene

Nanyang Technological University

Research

JoVE Journal

Genetics

Generation of a Gene-disrupted Streptococcus mutans Strain Without Gene Cloning

7.6K 조회수.  Tsurumi University School of Dental Medicine. 우리 유전자 교란 구 mutans 의 생성에 대 한 손쉬운, 신속한, 그리고 상대적으로 저렴 한 방법 설명 변종; 이 기술은 다양 한 종의 유전자 교란 종자의 생성에 대 한 적용할 수 있습니다.

비디오: Generation of a Gene-disrupted Streptococcus mutans Strain Without Gene Cloning

Generation of Fluorescent Protein Fusions in Candida Species

Candida species, prevalent colonizers of the intestinal and genitourinary tracts, are the cause of the majority of invasive fungal infections in humans. Thus, molecular and genetic tools are needed to facilitate the study of their pathogenesis mechanisms. PCR-mediated gene modification is a straightforward and quick approach to generate epitope-tagged proteins to facilitate their detection. In particular, fluorescent protein (FP) fusions are powerful tools that allow visualization and quantitation of both yeast cells and proteins by fluorescence microscopy and immunoblotting, respectively. Plasmids containing FP encoding sequences, along with nutritional marker genes that facilitate the transformation of Candida species, have been generated for the purpose of FP construction and expression in Candida. Herein, we present a strategy for constructing a FP fusion in a Candida species. Plasmids containing the nourseothricin resistance transformation marker gene (NAT1) along with sequences for either green, yellow, or cherry FPs (GFP, YFP, mCherry) are used along with primers that include gene-specific sequences in a polymerase chain reaction (PCR) to generate a FP cassette. This gene-specific cassette has the ability to integrate into the 3'-end of the corresponding gene locus via homologous recombination. Successful in-frame fusion of the FP sequence into the gene locus of interest is verified genetically, followed by analysis of fusion protein expression by microscopy and/or immuno-detection methods. In addition, for the case of highly expressed proteins, successful fusions can be screened for primarily by fluorescence imaging techniques.

Generation of Fluorescent Protein Fusions in Candida Species

PCR-mediated gene modification can be used to generate fluorescent protein fusions in Candida species, which facilitates visualization and quantitation of yeast cells and proteins. Herein, we present a strategy for constructing a fluorescent protein fusion (Eno1-FP) in Candida parapsilosis.

에 형광 단백질 융합의 시대<em&gt; 칸디다</em&gt; 종

Candida species, prevalent colonizers of the intestinal and genitourinary tracts, are the cause of the majority of invasive fungal infections in humans. ...

연구

유전학

Selection-dependent and Independent Generation of CRISPR/Cas9-mediated Gene Knockouts in Mammalian Cells

The CRISPR/Cas9 genome engineering system has revolutionized biology by allowing for precise genome editing with little effort. Guided by a single guide RNA (sgRNA) that confers specificity, the Cas9 protein cleaves both DNA strands at the targeted locus. The DNA break can trigger either non-homologous end joining (NHEJ) or homology directed repair (HDR). NHEJ can introduce small deletions or insertions which lead to frame-shift mutations, while HDR allows for larger and more precise perturbations. Here, we present protocols for generating knockout cell lines by coupling established CRISPR/Cas9 methods with two options for downstream selection/screening. The NHEJ approach uses a single sgRNA cut site and selection-independent screening, where protein production is assessed by dot immunoblot in a high-throughput manner. The HDR approach uses two sgRNA cut sites that span the gene of interest. Together with a provided HDR template, this method can achieve deletion of tens of kb, aided by the inserted selectable resistance marker. The appropriate applications and advantages of each method are discussed.

Recent advances in the ability to genetically manipulate somatic cell lines hold great potential for basic and applied research. Here, we present two approaches for CRISPR/Cas9 generated knockout production and screening in mammalian cell lines, with and without the use of selectable markers.

포유류 세포에서 CRISPR / Cas9 매개 유전자 knockouts의 선택 의존 및 독립적 생성

The CRISPR/Cas9 genome engineering system has revolutionized biology by allowing for precise genome editing with little effort. Guided by a single guide ...

Sample Preparation and Analysis of RNASeq-based Gene Expression Data from Zebrafish

The analysis of global gene expression changes is a valuable tool for identifying novel pathways underlying observed phenotypes. The zebrafish is an excellent model for rapid assessment of whole transcriptome from whole animal or individual cell populations due to the ease of isolation of RNA from large numbers of animals. Here a protocol for global gene expression analysis in zebrafish embryos using RNA sequencing (RNASeq) is presented. We describe preparation of RNA from whole embryos or from cell populations obtained using cell sorting in transgenic animals. We also describe an approach for analysis of RNASeq data to identify enriched pathways and Gene Ontology (GO) terms in global gene expression data sets. Finally, we provide a protocol for validation of gene expression changes using quantitative reverse transcriptase PCR (qRT-PCR). These protocols can be used for comparative analysis of control and experimental sets of zebrafish to identify novel gene expression changes, and provide molecular insight into phenotypes of interest.

This protocol presents an approach for whole transcriptome analysis from zebrafish embryos, larvae, or sorted cells. We include isolation of RNA, pathway analysis of RNASeq data, and qRT-PCR-based validation of gene expression changes.

샘플 준비 및 제 브라에서 RNASeq 기반 유전자 표현 데이터의 분석

The analysis of global gene expression changes is a valuable tool for identifying novel pathways underlying observed phenotypes. The zebrafish is an ...

A Standard Methodology to Examine On-site Mutagenicity As a Function of Point Mutation Repair Catalyzed by CRISPR/Cas9 and SsODN in Human Cells

Combinatorial gene editing using CRISPR/Cas9 and single-stranded oligonucleotides is an effective strategy for the correction of single-base point mutations, which often are responsible for a variety of human inherited disorders. Using a well-established cell-based model system, the point mutation of a single-copy mutant eGFP gene integrated into HCT116 cells has been repaired using this combinatorial approach. The analysis of corrected and uncorrected cells reveals both the precision of gene editing and the development of genetic lesions, when indels are created in uncorrected cells in the DNA sequence surrounding the target site. Here, the specific methodology used to analyze this combinatorial approach to the gene editing of a point mutation, coupled with a detailed experimental strategy to measuring indel formation at the target site, is outlined. This protocol outlines a foundational approach and workflow for investigations aimed at developing CRISPR/Cas9-based gene editing for human therapy. The conclusion of this work is that on-site mutagenesis takes place as a result of CRISPR/Cas9 activity during the process of point mutation repair. This work puts in place a standardized methodology to identify the degree of mutagenesis, which should be an important and critical aspect of any approach destined for clinical implementation.

This protocol outlines the workflow of a CRISPR/Cas9-based gene editing system for the repair of point mutations in mammalian cells. Here, we use a combinatorial approach to gene editing with a detailed follow-on experimental strategy for measuring indel formation at the target site&#8212;in essence, analyzing onsite mutagenesis.

점 돌연변이 수리 CRISPR/Cas9 및 SsODN 인간 세포에 의해 촉매의 기능으로 현지 변이 검사 하는 표준 방법론

Combinatorial gene editing using CRISPR/Cas9 and single-stranded oligonucleotides is an effective strategy for the correction of single-base point ...

Efficient Production and Identification of CRISPR/Cas9-generated Gene Knockouts in the Model System Danio rerio

Characterization of the clustered, regularly interspaced, short, palindromic repeat (CRISPR) system of Streptococcus pyogenes has enabled the development of a customizable platform to rapidly generate gene modifications in a wide variety of organisms, including zebrafish. CRISPR-based genome editing uses a single guide RNA (sgRNA) to target a CRISPR-associated (Cas) endonuclease to a genomic DNA (gDNA) target of interest, where the Cas endonuclease generates a double-strand break (DSB). Repair of DSBs by error-prone mechanisms lead to insertions and/or deletions (indels). This can cause frameshift mutations that often introduce a premature stop codon within the coding sequence, thus creating a protein-null allele. CRISPR-based genome engineering requires only a few molecular components and is easily introduced into zebrafish embryos by microinjection. This protocol describes the methods used to generate CRISPR reagents for zebrafish microinjection and to identify fish exhibiting germline transmission of CRISPR-modified genes. These methods include in vitro transcription of sgRNAs, microinjection of CRISPR reagents, identification of indels induced at the target site using a PCR-based method called a heteroduplex mobility assay (HMA), and characterization of the indels using both a low throughput and a powerful next-generation sequencing (NGS)-based approach that can analyze multiple PCR products collected from heterozygous fish. This protocol is streamlined to minimize both the number of fish required and the types of equipment needed to perform the analyses. Furthermore, this protocol is designed to be amenable for use by laboratory personal of all levels of experience including undergraduates, enabling this powerful tool to be economically employed by any research group interested in performing CRISPR-based genomic modification in zebrafish.

Efficient Production and Identification of CRISPR/Cas9-generated Gene Knockouts in the Model System Danio rerio

Targeted genome editing in the model system Danio rerio (zebrafish) has been greatly facilitated by the emergence of CRISPR-based approaches. Herein, we describe a streamlined, robust protocol for generation and identification of CRISPR-derived nonsense alleles that incorporates the heteroduplex mobility assay and identification of mutations using next-generation sequencing.

효율적인 생산 및 모델 시스템 Danio rerio 에 유전자 녹아웃 식별의 CRISPR/Cas9 생성

Characterization of the clustered, regularly interspaced, short, palindromic repeat (CRISPR) system of Streptococcus pyogenes has enabled the development ...

Candidate Gene Testing in Clinical Cohort Studies with Multiplexed Genotyping and Mass Spectrometry

Complex diseases are often underpinned by multiple common genetic variants that contribute to disease susceptibility. Here, we describe a cost-effective tag single nucleotide polymorphism (SNP) approach using a multiplexed genotyping assay with mass spectrometry, to investigate gene pathway associations in clinical cohorts. We investigate the food allergy candidate locus Interleukin13 (IL13) as an example. This method efficiently maximizes the coverage by taking advantage of shared linkage disequilibrium (LD) within a region. Selected LD SNPs are then designed into a multiplexed assay, enabling up to 40 different SNPs to be analyzed simultaneously, boosting cost-effectiveness. Polymerase chain reaction (PCR) is used to amplify the target loci, followed by single nucleotide extension, and the amplicons are then measured using matrix-assisted laser desorption/ionization-time of flight(MALDI-TOF) mass spectrometry. The raw output is analyzed with the genotype calling software, using stringent quality control definitions and cut-offs, and high probability genotypes are determined and output for data analysis.

Identification of genetic variants contributing to complex human disease allows us to identify novel mechanisms. Here, we demonstrate a multiplex genotyping approach to candidate genes or gene pathway analysis that maximizes the coverage at low cost and is amenable to cohort-based studies.

후보 유전자 다중화 유전형과 질량 분석 임상 코 호트 연구에서 테스트

Complex diseases are often underpinned by multiple common genetic variants that contribute to disease susceptibility. Here, we describe a cost-effective ...

CRISPR Guide RNA Cloning for Mammalian Systems

The outlined protocol describes streamlined methods for the efficient and cost-effective generation of Cas9-associated guide RNAs. Two alternative strategies for guide RNA (gRNA) cloning are outlined based on the usage of the Type IIS restriction enzyme BsmBI in combination with a set of compatible vectors. Outside of the access to Sanger sequencing services to validate the generated vectors, no special equipment or reagents are required aside from those that are standard to modern molecular biology laboratories. The outlined method is primarily intended for cloning one single gRNA or one paired gRNA-expressing vector at a time. This procedure does not scale well for the generation of libraries containing thousands of gRNAs. For those purposes, alternative sources of oligonucleotide synthesis such as oligo-chip synthesis are recommended. Finally, while this protocol focuses on a set of mammalian vectors, the general strategy is plastic and is applicable to any organism if the appropriate gRNA vector is available.

Here, a simple, efficient, and cost-effective method of sgRNA cloning is outlined.

CRISPR 가이드 RNA 포유류 시스템 복제

The outlined protocol describes streamlined methods for the efficient and cost-effective generation of Cas9-associated guide RNAs. Two alternative ...

Amplification of Near Full-length HIV-1 Proviruses for Next-Generation Sequencing

The Full-Length Individual Proviral Sequencing (FLIPS) assay is an efficient and high-throughput method designed to amplify and sequence single, near full-length (intact and defective), HIV-1 proviruses. FLIPS allows determination of the genetic composition of integrated HIV-1 within a cell population. Through identifying defects within HIV-1 proviral sequences that arise during reverse transcription, such as large internal deletions, deleterious stop codons/hypermutation, frameshift mutations, and mutations/deletions in cis acting elements required for virion maturation, FLIPS can identify integrated proviruses incapable of replication. The FLIPS assay can be utilized to identify HIV-1 proviruses that lack these defects and are&#160;therefore potentially replication-competent. The FLIPS protocol involves: lysis of HIV-1 infected cells, nested PCR of near full-length HIV-1 proviruses (using primers targeted to the HIV-1 5&#39; and 3&#39; LTR), DNA purification and quantification, library preparation for Next-generation Sequencing (NGS), NGS, de novo assembly of proviral contigs, and a simple process of elimination for identifying replication-competent proviruses. FLIPS provides advantages over traditional methods designed to sequence integrated HIV-1 proviruses, such as single-proviral sequencing. FLIPS amplifies and sequences near full-length proviruses enabling replication competency to be determined, and also uses fewer amplification primers, preventing the consequences of primer mismatches. FLIPS is a useful tool for understanding the genetic landscape of integrated HIV-1 proviruses, especially within the latent reservoir, however, its utilization can extend to any application in which the genetic composition of integrated HIV-1 is required.

Full-length individual proviral sequencing (FLIPS) provides an efficient and high-throughput method for the amplification and sequencing of single, near full-length (intact and defective) HIV-1 proviruses and allows for determination of their potential replication-competency. FLIPS overcomes limitations of previous assays designed to sequence the latent HIV-1 reservoir.

다음-세대 시퀀싱에 대 한 전체 길이 HIV-1 Proviruses 근처의 증폭

The Full-Length Individual Proviral Sequencing (FLIPS) assay is an efficient and high-throughput method designed to amplify and sequence single, near ...

High-throughput Identification of Gene Regulatory Sequences Using Next-generation Sequencing of Circular Chromosome Conformation Capture (4C-seq)

The identification of regulatory elements for a given target gene poses a significant technical challenge owing to the variability in the positioning and effect sizes of regulatory elements to a target gene. Some progress has been made with the bioinformatic prediction of the existence and function of proximal epigenetic modifications associated with activated gene expression using conserved transcription factor binding sites. Chromatin conformation capture studies have revolutionized our ability to discover physical chromatin contacts between sequences and even within an entire genome. Circular chromatin conformation capture coupled with next-generation sequencing (4C-seq), in particular, is designed to discover all possible physical chromatin interactions for a given sequence of interest (viewpoint), such as a target gene or a regulatory enhancer. Current 4C-seq strategies directly sequence from within the viewpoint but require numerous and diverse viewpoints to be simultaneously sequenced to avoid the technical challenges of uniform base calling (imaging) with next generation sequencing platforms. This volume of experiments may not be practical for many laboratories. Here, we report a modified approach to the 4C-seq protocol that incorporates both an additional restriction enzyme digest and qPCR-based amplification steps that are designed to facilitate a greater capture of diverse sequence reads and mitigate the potential for PCR bias, respectively. Our modified 4C method is amenable to the standard molecular biology lab for assessing chromatin architecture.

High-throughput Identification of Gene Regulatory Sequences Using Next-generation Sequencing of Circular Chromosome Conformation Capture 4C-seq

The identification of physical interactions between genes and regulatory elements is challenging but has been facilitated by chromosome conformation capture methods. This modification to the 4C-seq protocol mitigates PCR bias by minimizing over-amplification of PCR templates and maximizes the mappability of reads by incorporating an addition restriction enzyme digest step.

차세대 시퀀싱의 원형 염색체 구조를 사용 하 여 유전자 규제 시퀀스의 높은 처리량 Id (4 C-seq)를 캡처

The identification of regulatory elements for a given target gene poses a significant technical challenge owing to the variability in the positioning and ...

A Customizable Protocol for String Assembly gRNA Cloning (STAgR)

The bacterial CRISPR/Cas9 system has substantially increased methodological options for life scientists. Due to its utilization, genetic and genomic engineering became applicable to a large range of systems. Moreover, many transcriptional and epigenomic engineering approaches are now generally feasible for the first time. One reason for the broad applicability of CRISPR lies in its bipartite nature. Small gRNAs determine the genomic targets of the complex, variants of the protein Cas9, and the local molecular consequences. However, many CRISPR approaches depend on the simultaneous delivery of multiple gRNAs into individual cells. Here, we present a customizable protocol for string assembly gRNA cloning (STAgR), a method that allows the simple, fast and efficient generation of multiplexed gRNA expression vectors in a single cloning step. STAgR is cost-effective, since (in this protocol) the individual targeting sequences are introduced by short overhang primers while the long DNA templates of the gRNA expression cassettes can be re-used multiple times. Moreover, STAgR allows single step incorporation of a large number of gRNAs, as well as combinations of different gRNA variants, vectors and promoters.

A Customizable Protocol for String Assembly gRNA Cloning STAgR

Here, we present string assembly gRNA cloning (STAgR), a method to easily multiplex gRNA vectors for CRISPR/Cas9 approaches. STAgR makes gRNA multiplexing simple, efficient and customizable.

사용자 정의 프로토콜 문자열 어셈블리 gRNA에 대 한 복제 (STAgR)

The bacterial CRISPR/Cas9 system has substantially increased methodological options for life scientists. Due to its utilization, genetic and genomic ...