우리는 데모와 도움에 대 한 지원 및 카멜 Vitale F. Benfenati (Istituto 이탈리아 디 기술, IIT)을 감사 합니다. 이 작품은 IIT와 Compagnia 산 파올로 (부여 번호 9734 락)에 의해 투자 되었다.

<ol>
	<li>Lam, J. K., Chow, M. Y., Zhang, Y., Leung, S. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=siRNA+Versus+miRNA+as+Therapeutics+for+Gene+Silencing.">siRNA Versus miRNA as Therapeutics for Gene Silencing.</a> Mol Ther-Nucl Acids. 4, e252 (2015).</li><li>Kohl, M. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Hemisphere-specific+optogenetic+stimulation+reveals+left-right+asymmetry+of+hippocampal+plasticity.">Hemisphere-specific optogenetic stimulation reveals left-right asymmetry of hippocampal plasticity.</a> Nat Neurosci. 14 (11), 1413-1415 (2011).</li><li>Maejima, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Postnatal+loss+of+P/Q-type+channels+confined+to+rhombic-lip-derived+neurons+alters+synaptic+transmission+at+the+parallel+fiber+to+purkinje+cell+synapse+and+replicates+genomic+Cacna1a+mutation+phenotype+of+ataxia+and+seizures+in+mice.">Postnatal loss of P/Q-type channels confined to rhombic-lip-derived neurons alters synaptic transmission at the parallel fiber to purkinje cell synapse and replicates genomic Cacna1a mutation phenotype of ataxia and seizures in mice.</a> J Neurosci. 33 (12), 5162-5174 (2013).</li><li>Mark, M. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Delayed+postnatal+loss+of+P/Q-type+calcium+channels+recapitulates+the+absence+epilepsy,+dyskinesia,+and+ataxia+phenotypes+of+genomic+Cacna1a+mutations.">Delayed postnatal loss of P/Q-type calcium channels recapitulates the absence epilepsy, dyskinesia, and ataxia phenotypes of genomic Cacna1a mutations.</a> J Neurosci. 31 (11), 4311-4326 (2011).</li><li>Thalhammer, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Alternative+Splicing+of+P/Q-Type+Ca2++Channels+Shapes+Presynaptic+Plasticity.">Alternative Splicing of P/Q-Type Ca2+ Channels Shapes Presynaptic Plasticity.</a> Cell Rep. 20 (2), 333-343 (2017).</li><li>Sambrook, J., Russell, D. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Calcium-phosphate-mediated+Transfection+of+Eukaryotic+Cells+with+Plasmid+DNAs.">Calcium-phosphate-mediated Transfection of Eukaryotic Cells with Plasmid DNAs.</a> CSH Protoc. 2006 (1), (2006).</li><li>Chung, K. H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Polycistronic+RNA+polymerase+II+expression+vectors+for+RNA+interference+based+on+BIC/miR-155.">Polycistronic RNA polymerase II expression vectors for RNA interference based on BIC/miR-155.</a> Nucleic Acids Res. 34 (7), e53 (2006).</li><li>McClure, C., Cole, K. L., Wulff, P., Klugmann, M., Murray, A. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Production+and+titering+of+recombinant+adeno-associated+viral+vectors.">Production and titering of recombinant adeno-associated viral vectors.</a> J Vis Exp. (57), e3348 (2011).</li><li>Cingolani, L. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Activity-dependent+regulation+of+synaptic+AMPA+receptor+composition+and+abundance+by+beta3+integrins.">Activity-dependent regulation of synaptic AMPA receptor composition and abundance by beta3 integrins.</a> Neuron. 58 (5), 749-762 (2008).</li><li>Huang, H., Xu, Y., Cheng, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Detection+of+alternative+splicing+during+epithelial-mesenchymal+transition.">Detection of alternative splicing during epithelial-mesenchymal transition.</a> J Vis Exp. (92), e51845 (2014).</li><li>Vandesompele, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Accurate+normalization+of+real-time+quantitative+RT-PCR+data+by+geometric+averaging+of+multiple+internal+control+genes.">Accurate normalization of real-time quantitative RT-PCR data by geometric averaging of multiple internal control genes.</a> Genome Biol. 3 (7), (2002).</li><li>Cetin, A., Komai, S., Eliava, M., Seeburg, P. H., Osten, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Stereotaxic+gene+delivery+in+the+rodent+brain.">Stereotaxic gene delivery in the rodent brain.</a> Nat Protoc. 1 (6), 3166-3173 (2006).</li><li>Paxinos, G., Franklin, K. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> The Mouse Brain in Stereotaxic Coordinates. , (2012).</li><li>Paxinos, G., Watson, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> The Rat Brain in Stereotaxic Coordinates. , (2013).</li><li>Gunaydin, L. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Ultrafast+optogenetic+control.">Ultrafast optogenetic control.</a> Nat Neurosci. 13 (3), 387-392 (2010).</li><li>Bourinet, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Splicing+of+alpha+1A+subunit+gene+generates+phenotypic+variants+of+P-+and+Q-type+calcium+channels.">Splicing of alpha 1A subunit gene generates phenotypic variants of P- and Q-type calcium channels.</a> Nat Neurosci. 2 (5), 407-415 (1999).</li><li>Chaudhuri, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Alternative+splicing+as+a+molecular+switch+for+Ca2+/calmodulin-dependent+facilitation+of+P/Q-type+Ca2++channels.">Alternative splicing as a molecular switch for Ca2+/calmodulin-dependent facilitation of P/Q-type Ca2+ channels.</a> J Neurosci. 24 (28), 6334-6342 (2004).</li><li>Soong, T. W., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Systematic+identification+of+splice+variants+in+human+P/Q-type+channel+alpha1(2.1)+subunits:+implications+for+current+density+and+Ca2+-dependent+inactivation.">Systematic identification of splice variants in human P/Q-type channel alpha1(2.1) subunits: implications for current density and Ca2+-dependent inactivation.</a> J Neurosci. 22 (23), 10142-10152 (2002).</li><li>Berndt, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High-efficiency+channelrhodopsins+for+fast+neuronal+stimulation+at+low+light+levels.">High-efficiency channelrhodopsins for fast neuronal stimulation at low light levels.</a> P Natl Acad Sci USA. 108 (18), 7595-7600 (2011).</li><li>Klapoetke, N. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Independent+optical+excitation+of+distinct+neural+populations.">Independent optical excitation of distinct neural populations.</a> Nat Methods. 11 (3), 338-346 (2014).</li><li>Lin, J. Y., Lin, M. Z., Steinbach, P., Tsien, R. Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Characterization+of+engineered+channelrhodopsin+variants+with+improved+properties+and+kinetics.">Characterization of engineered channelrhodopsin variants with improved properties and kinetics.</a> Biophys J. 96 (5), 1803-1814 (2009).</li><li>Zhang, Y. P., Oertner, T. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Optical+induction+of+synaptic+plasticity+using+a+light-sensitive+channel.">Optical induction of synaptic plasticity using a light-sensitive channel.</a> Nat Methods. 4 (2), 139-141 (2007).</li><li>Fowler, D. K., Williams, C., Gerritsen, A. T., Washbourne, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Improved+knockdown+from+artificial+microRNAs+in+an+enhanced+miR-155+backbone:+a+designer's+guide+to+potent+multi-target+RNAi.">Improved knockdown from artificial microRNAs in an enhanced miR-155 backbone: a designer's guide to potent multi-target RNAi.</a> Nucleic Acids Res. 44 (5), e48 (2016).</li></ol>

저자는 공개 없다.

Optogenetic 프로브와 관심의 연 접 유전자에 대 한 미르의 공동 식 연 접 기능 그대로 신경 회로 내에 유전자 최저의 효과 하 강력한 방식을 제공 합니다. 이 실험적인 접근에 대 한 확인 하 고는 매우 효율적이 고 선택적 네이티브 시스템에 관심사의 유전자를 노크에 미르의 특성 중요 하다. 가능 하면 최종 대상에서 효과 대 한 관심의 동일한 mRNA에 대해 두 개 이상의 독립적인 미르 제어에 사용 되어야 한다. 구조 실험, 미르 저항 유전자는 시스템에 재는 특이성에 대 한 제어로 사용할 수 있습니다.
optogenetic 표현 하 동일한 구문을 사용 하 여 프로브와 한 미르 광학 조작 되어 연 접 신경만을 자극에 대 한 수 있습니다. 이건 전기 stimulations 가능 때문에 그들은 감염 되 고 감염 되지 않은 신경, 따라서 생산 하는 혼합과 희석 결과 구분 하지 않습니다. 광 stimulations 여러 활동 전위15일으킬 수 있다, 때문에 가장 빠른 optogenetic 프로브는 확장 팔레트15,19,,2021중에서 선택 하는 것 중요 하다. 또한, 광 자극 연 접 boutons의 직접 도발은 유도 하지 않습니다, 하나22를 조사 하고자 하는 시 냅 시스 전송의 단계 중 일부를 무시 하지 않으려면를 위해 필수적입니다.
우리가 여기, 설명 실험적인 접근 (4-6 개월) 제한 된 기간 내 동시에 관심의 여러 연 접 유전자의 생리 적인 관련성을 평가 하 가능 하 게. 그러나, 그것은 명심 knockdowns 거의 100% 도달 하는 것이 중요입니다. 또한, rAAVs 초기 발달 과정을 조사 하는 경우 시간 제약 조건을 나타내는 optogenetic 조사의 최대 최저의 전체 표현에 대 한 수 있도록 최소한 2 주 동안 표현 될 필요가 있다. 비록 더 많은 시간이 소요, 조건부 녹아웃 쥐 연 접 신경에 제한 일반적으로 결과 관심사의 유전자의 제거를 완료 하 고 따라서 유효한 상호 보완적인 접근 방식을 제공.
미르 기술의 특정 장점은 같은 발기인에서 여러 미르의 식을 것 이다. 주로이 속성 같은 미르 또는 동일한 대상 유전자에 대 한 다른 미르의 여러 복사본을 삽입 하 여 최저 효율을 높이기 위해 사용 되었습니다. 그러나 그것은 수 하는 데 사용 또한 최저 여러 유전자 표현에 대 한 다른 대상 유전자7,23미르. 이 속성은 여러 연 접 단백질 신호 통로 연 접 부에 침묵 하 사용할 수 있습니다.
여기, 우리는 급성 hippocampal 조각에 연 접 기능에 유전자 최저의 효과 특성 인공 미르와 optogenetics를 결합 했다. 비슷한 접근 방식은 조작 하 고 신경 회로 vivo에서조사 또한 사용 될 수 있습니다. 또한, chemogenetic 인공 미르 결합 접근 것 가능 하나가 더 긴 시간의 척도에 신경 회로

이 프로토콜에는 연 접 기능 그대로 신경 회로 내에 유전자 최저의 효과 특성화 하는 새로운 접근 방식을 설명 합니다. 그대로 신경 회로에 연 접 기능을 조사 하는 것은 많은 연 접 boutons 너무 작기 때문에 및 멀리 결합된 분자와 electrophysiological 개입 있도록 소마에서 도전적 이다. RNA 간섭 최저의 시 냅 스 단백질1을 강력 하 고 유연한 방법을 제공 합니다, 하지만이 방법은 사용 되었습니다 아껴 서 최저 전통적인 사용의 효과 검출 하기 어렵기 때문에 연 접 기능을 조사 하 구분 하지 않는 전기 stimulations 조작 및 순진한 연 접 boutons2. 여기, 우리가 인공 예측에 관한 (미르)를 결합 하는 방법에 설명-급성 뇌 조각에 조작된 연 접 boutons의 선택적 자극을 달성 하기 위해 최근에 개발 된 optogenetic 기술로 RNA 간섭 중재.
전기 생리학 함께에서 조건부 녹아웃 쥐 연 접 단백질3,4의 기능을 조사 하기 위해 사용 될 수도, 하는 동안 우리의 전략 필요 하지 않은 개발 및 유지 보수의 유전자 마우스 라인을 수정 하 고 유전자의 특정 isoforms를 허물고 또한 쉽게 채택 될 수 있다. 더 일반적으로 상대적 사용된 짧은 헤어핀 RNAs (shRNAs), 우리 여기 사용 하 고, 인공 미르 뉴런에 최저에 대 한 주요 이점을 제공 합니다. ShRNAs, 달리는 중 합 효소 II 발기인1의 제어에서 표현할 수 있습니다. 따라서, 단일 발기인 미르의 형광 기자와 함께 optogenetic 프로브 식 드라이브를 사용할 수 있습니다. 이 방법에서는, 포장의 한계 내에서 재조합 형 adeno 관련 바이러스 (rAAV, 그림 1A)는 구조물의 크기를 보관할 수 있습니다. 또한, 단일 구조와 단일 발기인의 사용은 미르, optogenetic 프로브 및 고정된 비율에 형광 리포터의 표현에 대 한 허용 하기 때문에 실험적인 변화를 감소.
우리는 최근 마5연 접 칼슘 채널의 양자 택일로 접합된 isoforms의 역할을 검토 하는이 기술을 적용 했습니다. 이러한 전략의 어떤 두뇌 회로에 다른 presynaptically 표현한 단백질의 생리 적인 관련성을 공부에 일반적으로 적용 됩니다.

<table>
	<tbody>
		<tr>
			<td>Acrylamide</td>
			<td>Sigma</td>
			<td>Acrylamide/Bis-acrylamide, 30% solution</td>
			<td>Toxic</td>
		</tr>
		<tr>
			<td>Animal Temperature Controller with heat pad</td>
			<td>WPI</td>
			<td>ATC2000</td>
			<td></td>
		</tr>
		<tr>
			<td>BCA protein assay kit</td>
			<td>ThermoFisher Scientific</td>
			<td>23225</td>
			<td></td>
		</tr>
		<tr>
			<td>BLOCK-iT Pol II miR RNAi Expression Vector kit</td>
			<td>ThermoFisher Scientific</td>
			<td>K4936-00</td>
			<td></td>
		</tr>
		<tr>
			<td>Brain slices Prechamber</td>
			<td>Harvard Apparatus</td>
			<td>BSC-PC</td>
			<td></td>
		</tr>
		<tr>
			<td>CCD camera-based imager</td>
			<td>Bio-Rad</td>
			<td>ChemiDoc&#8482; MP</td>
			<td></td>
		</tr>
		<tr>
			<td>Cell Culture reagents</td>
			<td>Life Technologies</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Chemiluminescent substrate</td>
			<td>GE Helthcare</td>
			<td>ECL Western Blotting Reagents, RPN2106</td>
			<td></td>
		</tr>
		<tr>
			<td>Chloroform</td>
			<td>Sigma</td>
			<td>C2432</td>
			<td>Toxic</td>
		</tr>
		<tr>
			<td>Cytosine &#946;-D-arabinofuranoside</td>
			<td>Sigma</td>
			<td>C6645</td>
			<td></td>
		</tr>
		<tr>
			<td>Drill</td>
			<td>Foredom</td>
			<td>K.1030</td>
			<td></td>
		</tr>
		<tr>
			<td>EGTA</td>
			<td>Sigma</td>
			<td>E4378</td>
			<td></td>
		</tr>
		<tr>
			<td>Gentamicin ointment</td>
			<td>Local pharmacy</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Glucose</td>
			<td>Sigma</td>
			<td>G7021</td>
			<td></td>
		</tr>
		<tr>
			<td>Hepes</td>
			<td>Sigma</td>
			<td>54459</td>
			<td></td>
		</tr>
		<tr>
			<td>Injection micropipettes</td>
			<td>Narishige</td>
			<td>GD1</td>
			<td></td>
		</tr>
		<tr>
			<td>Inorganic salts &#38; detergents</td>
			<td>Sigma</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>K2-creatine phosphate</td>
			<td>Calbiochem</td>
			<td>237911</td>
			<td></td>
		</tr>
		<tr>
			<td>KGluconate</td>
			<td>Fluka</td>
			<td>60245</td>
			<td></td>
		</tr>
		<tr>
			<td>Laser</td>
			<td>Laserglow Technologies</td>
			<td>LRS-0473-GFM-00100-03</td>
			<td></td>
		</tr>
		<tr>
			<td>Membrane</td>
			<td>Amersham</td>
			<td>Protran&#8482; 0.2 &#181;m NC</td>
			<td></td>
		</tr>
		<tr>
			<td>MgATP</td>
			<td>Sigma</td>
			<td>A9187</td>
			<td></td>
		</tr>
		<tr>
			<td>Micropipette holder</td>
			<td>Narishige</td>
			<td>IM-H1</td>
			<td></td>
		</tr>
		<tr>
			<td>Micropipette puller</td>
			<td>Narishige</td>
			<td>PC-100</td>
			<td></td>
		</tr>
		<tr>
			<td>Na3GTP</td>
			<td>Sigma</td>
			<td>G8877</td>
			<td></td>
		</tr>
		<tr>
			<td>NaPyruvate</td>
			<td>Sigma</td>
			<td>P5280</td>
			<td></td>
		</tr>
		<tr>
			<td>Ocular lubricant</td>
			<td>Local pharmacy</td>
			<td>Lacrigel</td>
			<td></td>
		</tr>
		<tr>
			<td>Phosphate inhibitors</td>
			<td>Sigma</td>
			<td>P0044, P5726</td>
			<td></td>
		</tr>
		<tr>
			<td>Protease inhibitors</td>
			<td>Sigma</td>
			<td>cOmplete&#8482;, EDTA-free Protease Inhibitor Cocktail</td>
			<td></td>
		</tr>
		<tr>
			<td>Protein gel electrophoresis and blotting devices</td>
			<td>Bio-Rad</td>
			<td>Mini-Protean III Cell</td>
			<td></td>
		</tr>
		<tr>
			<td>Providone iodine</td>
			<td>Local pharmacy</td>
			<td>Betadine</td>
			<td></td>
		</tr>
		<tr>
			<td>Qiazol Lysis Reagent</td>
			<td>Qiagen</td>
			<td>79306</td>
			<td>Toxic</td>
		</tr>
		<tr>
			<td>QuantiTect Reverse 
			Transcription Kit</td>
			<td>Qiagen</td>
			<td>205311</td>
			<td></td>
		</tr>
		<tr>
			<td>RNeasy Micro Kit</td>
			<td>Qiagen</td>
			<td>74004</td>
			<td></td>
		</tr>
		<tr>
			<td>Spectrophotometer</td>
			<td>ThermoFisher Scientific</td>
			<td>Nanodrop 2000</td>
			<td></td>
		</tr>
		<tr>
			<td>Stereotactic apparatus</td>
			<td>WPI</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Tetrodotoxin</td>
			<td>Tocris</td>
			<td>1069</td>
			<td>Toxic</td>
		</tr>
		<tr>
			<td>Vibratome</td>
			<td>Leica</td>
			<td>VT1200S</td>
			<td></td>
		</tr>
	</tbody>
</table>

combining optogenetics with artificial micrornas to characterize the effects of gene knockdown on presynaptic function within intact neuronal circuits

이 프로토콜의 목적은 그대로 신경 회로 내에서 연 접 기능에 유전자 최저의 효과 특성 이다. 우리 인공 예측에 관한 (미르)를 결합 하는 방법에 대 한 워크플로 설명-급성 뇌 조각에 조작된 연 접 boutons의 선택적 자극을 달성 하기 위해 optogenetics RNA 간섭 중재. 실험 방법은 단일 바이러스 성 구조 및 드라이브는 optogenetic 프로브 및 연 접 gene(s)에 대 한 인공 miR(s)의 식 단일 신경 특정 발기인의 사용을 포함. Stereotactically 관심 뇌 영역에 주입 때 표현된 구문 수 있습니다 빛 조사 gene(s)의 감소 식이 독점적으로 뉴런을 자극 하. 이 전략 개발 및 유전자 변형된 마우스 라인의 유지 관리를 필요로 하지 않습니다 하 고 적용할 수 있는 원리에 다른 유기 체 및 선택의 모든 신경 진. 우리는 최근 연 접 P/Q 유형 전압 개폐 칼슘 채널 (VGCCs)의 대체 스플라이스 isoforms의 최저 급성 hippocampal 조각에서 CA1 흥분 성의 시 냅 스에 CA3에서 단기 시 냅 스가 소성을 조절 하는 방법을 조사를 적용 했습니다. 비슷한 접근 방식은 조작 하 고 신경 회로 비보프로브 사용 될 수 있습니다.

위에서 설명한 절차 평가 방법 시 냅 스 전송 하는 강력한 방법을 연 접 신경에서 시 냅 스 단백질의 분해에 의해 영향을 제공 합니다. 대안의 최저 연 접 Cav2.1의 isoforms를 결합 하는 방법에 대 한 대표적인 결과 (P/Q 타입) VGCCs CA3 CA1 흥분 성의 시 냅 스는 예를 들어 아래에 주어진 하에서 단기 시 냅 스가 소성을 조절.
Cav2.1 (P/Q 유형) 채널은 중앙 신 경계에서 가장 빠른 시 냅 스에서 우세 연 접 VGCCs. 대체 상호 배타적인 exons의 접합 37a와 37b는 기 공 형성 α1 소 단위 Cav2.1 (α1A)의, 생산 하 고 2 개의 주요 이체 Cav2.1 [EFa] Cav2.1 [EFb]16,17 18. 확인 하려면 여부 Cav2.1 [EFa] 및 Cav2.1 [EFb] 차동 조절 시 냅 스 전송 및 쥐 hippocampal 피라미드 신경이 소성, 우리가 먼저 개발 isoform 특정 미르 최저를 선택적으로 Cav 2.1 [EFa] 또는 Cav2.1 [EFb]5. 짧은 크기에도 불구 하 고 (97 bp)와 높은 유사성 (뉴클레오티드 수준에서 61.86% 정체성) exons 사이 37a와 37b, 우리에 대 한 세 미르 시퀀스 디자인 수 Cav2.1 [EFa] 쥐 (미르 EFa1: TCCTTATAGTGAATGCGGCCG; 미르 EFa2: ATGTCCTTATAGTGAATGCGG; 미르 EFa3: TTGCAAGCAACCCTATGAGGA) 2 쥐 Cav2.1 [EFb]에 대 한 (미르 EFb1: ATACATGTCCGGGTAAGGCAT; 미르 EFb2: ATCTGATACATGTCCGGGTAA) 예측 높은 최저 효율. 부정적인 제어 (미르 제어), 우리는 어떤 알려진된 척 추가 있는 유전자를 대상 하지 않는 시퀀스를 포함 하는 pcDNA6.2-GW/EmGFP-미르-neg 플라스 미드를 사용 합니다. 우리 미르 EFa1 EFa3 미르, 미르 EFb2 선택 하 고 그들의 식 카세트에는 3' UTR rAAVs의 생산을 위해 설계 된 pAAV-Syn-ChETA-TdT-miR-X, 벡터의 복제 HEK 293 세포 분리 채널에 대 한 첫 번째 화면을 바탕으로, 어디에 synapsin 모터 드라이브 초고속 channelrhodopsin ChETA, 빨간색 형광 단백질 TdTomato 및 삽입 된 미르 (그림 1)의 표현. 우리는 또한 미르가이 미르의 때 려 눕 힘 효율성을 증가 하는 EFb2의 식 카세트를 중복.
다음으로, 우리 위의 4 구문에 대 한 rAAV1/2를 준비 하 고 계량 그들의 최저 효율 및 기본 쥐 신경 문화 isoform 특정 qRT-PCR를 사용 하 여 선택. EFa1 미르와 미르 EFa3 감소 기본 Cav2.1 [EFa] ~ 70%의 mRNA만 하지의 Cav2.1 [EFb] 미르 EFb 네이티브 캘리포니아v2.1 [EFb] ~ 60%의 mRNA만 하지 Cav2.1 [EFa] (그림 2)의 감소 하는 동안.
우리 다음 stereotactically 4 rAAV1/2의 각에 주입 (그림 3A-C), P18 쥐의 해 마의 CA3 영역 (A P/M-L/D-V Bregma에서) −2.6의 좌표 / ± 2.9 / −2.9. 15 ~ 20-4 일 후 주입, 우리 rAAV1/2 주입 쥐에서 급성 hippocampal 슬라이스를 준비 하 고 식 (그림 3B) rAAVs의 지역화를 확인 하려면 TdTomato 형광을 사용. CA1 시 냅 스에 CA3에서 단기 시 냅 스가 소성 연 접 최저 Cav2.1 [EFa] 또는 Cav2.1의 [EFb]에 영향을 받는지 조사, 우리 간단한 473 nm 레이저 광 펄스 (2 ms 동안에와 함께 선택적으로 감염된 CA3 신경 자극 ; 그림 3C) 패치 피라미드 뉴런 (그림 3C) CA1 영역의 중간 지 대에 인접 하 여 결과 EPSCs를 기록 했다. 우리는 Cav2.1 스플라이스 isoforms의 최저 영향 반대 방향으로 결합 펄스 자극에 응답을 발견: 최저 Cav2.1의 [EFa] 미르 EFa1 (미르 EFa3) 쌍 펄스 촉진 (PPF) 증가 반면 Ca의 최저 v2.1 [EFb] (미르 EFb2) 그것은 (그림 3D, E) 폐지.
<img alt="Figure 1" class="xfigimg" src="/files/ftp_upload/57223/57223fig1.jpg"> 그림 1: 체계는 초고속 optogenetic 프로브 ChETA 및 Cav2.1 [EFa] 및 Cav2.1 [EFb]에 대 한 isoform 특정 미르의 결합 된 표현에 대 한 구문입니다. (A) 는 rAAV의 지도 구성 pAAV-Syn-ChETA-TdT-miR-X, synapsin 발기인 (Syn)을 포함, 초고속 channelrhodopsin ChETA 융합 TdTomato 하 고에 근 3' UTR, Cav2.1 스플라이스 isoform 특정 미르. 표시 된 제한 효소는 단일 커터. (B) 식 카세트의 상단, 체계. Synapsin 모터 드라이브 ChETA TdTomato와 isoform 특정 미르의 표정. 하단, 미르 카세트의 일부를 구성 하는 21-뉴클레오티드 대상 시퀀스의 반전 보수. 미르 EFb2에 대 한 두 개의 동일한 미르 카세트는 다른 후 하나에 표현 되었다. <a href="//cloudflare.jove.com/files/ftp_upload/57223/57223fig1large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭 하십시오.</a>
<img alt="Figure 2" class="xfigimg" src="/files/ftp_upload/57223/57223fig2.jpg"> 그림 2입니다. 최저 효율 및 Cav2.1 [EFa] 및 Cav2.1 [EFb] isoform 특정 미르의 선택의 평가. 17-18 DIV 기본 문화 중 Cav2.1 [EFa] (EFa1 미르와 미르 EFa3)을 대상으로 하는 미르를 표현 하는 rAAVs 6 DIV에 감염에서 분리 된 RNA에 Isoform 특정 qRT-PCR 분석 또는 Cav2.1 [EFb] (미르 EFb2). 데이터는 부정적인 제어 (미르 제어)로 정규화 됩니다. EFa1 미르와 미르 EFa3 크게 하 고 선택적으로 mRNA Cav2.1의 [EFa] 감소 (n = 8 및 7 문화, 각각), 미르 EFb 크게 하 고 선택적으로 감소 [EFb] 캘리포니아v2.1의 mRNA (n = 4 문화; * * * p < 0.001; 단방향의 분석 분산 테스트 테스트 후 Tukey Kramer에 의해 다음). 데이터는 ± SEM.를 의미 하는 대로 표시 됩니다. 이 그림에서 Thalhammer, A. 외 적응 되었습니다. 5. <a href="//cloudflare.jove.com/files/ftp_upload/57223/57223fig2large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭 하십시오.</a>
<img alt="Figure 3" class="xfigimg" src="/files/ftp_upload/57223/57223fig3.jpg"> 그림 3입니다. Optogenetics와 노크 다운 신경의 자극을 대상으로 평가의 역할 Cav2.1 [EFa] 및 Cav2.1 [EFb] 여 기본 마. (A) 체계의 vivo에서 감염에 사용 되는 rAAV 구문 식 카세트입니다. ((B)) Hippocampal 섹션 TdTomato 형광 CA3 영역 및 그것의 계획을 보여주는. (C) 실험 구성: 레이저 빔 CA3 somata에 지시 했다 및 패치 클램프 기록 CA1 피라미드 뉴런에서 수행 했다. (D) 2 ms 동안 블루 (473 nm) 레이저 광 펄스 20 Hz에서 났는 데 연상 EPSCs 누구의 PPF 미르 Cav2.1 [EFa]을 대상으로 하 여 증가 하며 Cav2.1에 대 한 미르 [EFb]에 의해 폐지. (E) 요약 (D)에서 실험에 대 한 대응 펄스 비율의 증가에서 보여주는 PPF 미르 EFa1 EFa3 미르와 미르 EFb2에 대 한 감소에 대 한 미르 컨트롤에 상대적인 (n = 9-11 녹음; * p = 0.02; * * p = 0.01; * * * p < 0.0004, 공분산 분석). 데이터는 ± SEM.를 의미 하는 대로 표시 됩니다. 이 그림에서 Thalhammer, A. 외 적응 되었습니다. 5. <a href="//cloudflare.jove.com/files/ftp_upload/57223/57223fig3large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭 하십시오.</a>

Watch this Scientific Journal Video about Combining Optogenetics with Artificial microRNAs to Characterize the Effects of Gene Knockdown on Presynaptic Function within Intact Neuronal Circuits at JoVE

Combining Optogenetics with Artificial microRNAs to Characterize the Effects of Gene Knockdown on Presynaptic Function within Intact Neuronal Circuits

이 프로토콜은 인공 예측에 관한 중재 RNA 간섭 그대로 신경 회로 내에서 선택적 gene(s)의 감소 식이 구체적으로 연 접 boutons를 자극 하는 optogenetics와 결합 하는 방법에 대 한 워크플로우를 제공 합니다.

연 접 기능 그대로 신경 회로 내에 유전자 최저 효과 특성 인공 microRNAs Optogenetics 결합

The purpose of this protocol is to characterize the effect of gene knockdown on presynaptic function within intact neuronal circuits. We describe a ...

combining-optogenetics-with-artificial-micrornas-to-characterize

Research

JoVE Journal

Neuroscience

10.1K 조회수.  Istituto Italiano di Tecnologia. 이 프로토콜은 인공 예측에 관한 중재 RNA 간섭 그대로 신경 회로 내에서 선택적 gene(s)의 감소 식이 구체적으로 연 접 boutons를 자극 하는 optogenetics와 결합 하는 방법에 대 한 워크플로우를 제공 합니다.

비디오: Combining Optogenetics with Artificial microRNAs to Characterize the Effects of Gene Knockdown on Presynaptic Function within Intact Neuronal Circuits

Vibrodissociation of Neurons from Rodent Brain Slices to Study Synaptic Transmission and Image Presynaptic Terminals

Mechanical dissociation of neurons from the central nervous system has the advantage that presynaptic boutons remain attached to the isolated neuron of interest. This allows for examination of synaptic transmission under conditions where the extracellular and postsynaptic intracellular environments can be well controlled. A vibration-based technique without the use of proteases, known as vibrodissociation, is the most popular technique for mechanical isolation. A micropipette, with the tip fire-polished to the shape of a small ball, is placed into a brain slice made from a P1-P21 rodent. The micropipette is vibrated parallel to the slice surface and lowered through the slice thickness resulting in the liberation of isolated neurons. The isolated neurons are ready for study within a few minutes of vibrodissociation. This technique has advantages over the use of primary neuronal cultures, brain slices and enzymatically isolated neurons including: rapid production of viable, relatively mature neurons suitable for electrophysiological and imaging studies; superior control of the extracellular environment free from the influence of neighboring cells; suitability for well-controlled pharmacological experiments using rapid drug application and total cell superfusion; and improved space-clamp in whole-cell recordings relative to neurons in slice or cell culture preparations. This preparation can be used to examine synaptic physiology, pharmacology, modulation and plasticity. Real-time imaging of both pre- and postsynaptic elements in the living cells and boutons is also possible using vibrodissociated neurons. Characterization of the molecular constituents of pre- and postsynaptic elements can also be achieved with immunological and imaging-based approaches.

This report demonstrates a technique for mechanical isolation of individual viable neurons retaining attached presynaptic boutons. Vibrodissociated neurons have the advantages of rapid production, excellent pharmacological control and improved space-clamp without influence from neighboring cells. This method can be used for imaging of synaptic elements and patch-clamp recording.

쥐 뇌 조각에서 뉴런의 Vibrodissociation는 시냅틱 전송 및 이미지 Presynaptic 터미널 공부

Mechanical dissociation of neurons from the central nervous system has the advantage that presynaptic boutons remain attached to the isolated neuron of ...

연구

신경과학

Mapping Inhibitory Neuronal Circuits by Laser Scanning Photostimulation

Inhibitory neurons are crucial to cortical function. They comprise about 20% of the entire cortical neuronal population and can be further subdivided into diverse subtypes based on their immunochemical, morphological, and physiological properties1-4. Although previous research has revealed much about intrinsic properties of individual types of inhibitory neurons, knowledge about their local circuit connections is still relatively limited3,5,6. Given that each individual neuron's function is shaped by its excitatory and inhibitory synaptic input within cortical circuits, we have been using laser scanning photostimulation (LSPS) to map local circuit connections to specific inhibitory cell types. Compared to conventional electrical stimulation or glutamate puff stimulation, LSPS has unique advantages allowing for extensive mapping and quantitative analysis of local functional inputs to individually recorded neurons3,7-9. Laser photostimulation via glutamate uncaging selectively activates neurons perisomatically, without activating axons of passage or distal dendrites, which ensures a sub-laminar mapping resolution. The sensitivity and efficiency of LSPS for mapping inputs from many stimulation sites over a large region are well suited for cortical circuit analysis.
Here we introduce the technique of LSPS combined with whole-cell patch clamping for local inhibitory circuit mapping. Targeted recordings of specific inhibitory cell types are facilitated by use of transgenic mice expressing green fluorescent proteins (GFP) in limited inhibitory neuron populations in the cortex3,10, which enables consistent sampling of the targeted cell types and unambiguous identification of the cell types recorded. As for LSPS mapping, we outline the system instrumentation, describe the experimental procedure and data acquisition, and present examples of circuit mapping in mouse primary somatosensory cortex. As illustrated in our experiments, caged glutamate is activated in a spatially restricted region of the brain slice by UV laser photolysis; simultaneous voltage-clamp recordings allow detection of photostimulation-evoked synaptic responses. Maps of either excitatory or inhibitory synaptic input to the targeted neuron are generated by scanning the laser beam to stimulate hundreds of potential presynaptic sites. Thus, LSPS enables the construction of detailed maps of synaptic inputs impinging onto specific types of inhibitory neurons through repeated experiments. Taken together, the photostimulation-based technique offers neuroscientists a powerful tool for determining the functional organization of local cortical circuits.

This paper introduces an approach of combining laser scanning photostimulation with whole cell recordings in transgenic mice expressing GFP in limited inhibitory neuron populations. The technique allows for extensive mapping and quantitative analysis of local synaptic circuits of specific inhibitory cortical neurons.

레이저 스캐닝 Photostimulation에 의해 억제 Neuronal 회로를 매핑

Inhibitory neurons are crucial to cortical function. They comprise about 20% of the entire cortical neuronal population and can be further subdivided into ...

Multi-unit Recording Methods to Characterize Neural Activity in the Locust (Schistocerca Americana) Olfactory Circuits

Detection and interpretation of olfactory cues are critical for the survival of many organisms. Remarkably, species across phyla have strikingly similar olfactory systems suggesting that the biological approach to chemical sensing has been optimized over evolutionary time1. In the insect olfactory system, odorants are transduced by olfactory receptor neurons (ORN) in the antenna, which convert chemical stimuli into trains of action potentials. Sensory input from the ORNs is then relayed to the antennal lobe (AL; a structure analogous to the vertebrate olfactory bulb). In the AL, neural representations for odors take the form of spatiotemporal firing patterns distributed across ensembles of principal neurons (PNs; also referred to as projection neurons)2,3. The AL output is subsequently processed by Kenyon cells (KCs) in the downstream mushroom body (MB), a structure associated with olfactory memory and learning4,5. Here, we present electrophysiological recording techniques to monitor odor-evoked neural responses in these olfactory circuits.
First, we present a single sensillum recording method to study odor-evoked responses at the level of populations of ORNs6,7. We discuss the use of saline filled sharpened glass pipettes as electrodes to extracellularly monitor ORN responses. Next, we present a method to extracellularly monitor PN responses using a commercial 16-channel electrode3. A similar approach using a custom-made 8-channel twisted wire tetrode is demonstrated for Kenyon cell recordings8. We provide details of our experimental setup and present representative recording traces for each of these techniques.

Multi-unit Recording Methods to Characterize Neural Activity in the Locust Schistocerca Americana Olfactory Circuits

We demonstrate variations of the extracellular multi-unit recording technique to characterize odor-evoked responses in the first three stages of the invertebrate olfactory pathway. These techniques can easily be adapted to examine ensemble activity in other neural systems as well.

메뚜기에 신경 활동을 특성화하기 위해 다중 단위 기록 방법 (<em&gt; Schistocerca 아메리카나</em&gt;) 강한 회로

Detection and interpretation of olfactory cues are critical for the survival  of many organisms. Remarkably, species across phyla have strikingly similar ...

In Vivo Two-photon Imaging Of Experience-dependent Molecular Changes In Cortical Neurons

The brain's ability to change in response to experience is essential for healthy brain function, and abnormalities in this process contribute to a variety of brain disorders1,2. To better understand the mechanisms by which brain circuits react to an animal's experience requires the ability to monitor the experience-dependent molecular changes in a given set of neurons, over a prolonged period of time, in the live animal. While experience and associated neural activity is known to trigger gene expression changes in neurons1,2, most of the methods to detect such changes do not allow repeated observation of the same neurons over multiple days or do not have sufficient resolution to observe individual neurons3,4. Here, we describe a method that combines in vivo two-photon microscopy with a genetically encoded fluorescent reporter to track experience-dependent gene expression changes in individual cortical neurons over the course of day-to-day experience. 
One of the well-established experience-dependent genes is Activity-regulated cytoskeletal associated protein (Arc)5,6. The transcription of Arc is rapidly and highly induced by intensified neuronal activity3, and its protein product regulates the endocytosis of glutamate receptors and long-term synaptic plasticity7. The expression of Arc has been widely used as a molecular marker to map neuronal circuits involved in specific behaviors3. In most of those studies, Arc expression was detected by in situ hybridization or immunohistochemistry in fixed brain sections. Although those methods revealed that the expression of Arc was localized to a subset of excitatory neurons after behavioral experience, how the cellular patterns of Arc expression might change with multiple episodes of repeated or distinctive experiences over days was not investigated. 
In vivo two-photon microscopy offers a powerful way to examine experience-dependent cellular changes in the living brain8,9. To enable the examination of Arc expression in live neurons by two-photon microscopy, we previously generated a knock-in mouse line in which a GFP reporter is placed under the control of the endogenous Arc promoter10. This protocol describes the surgical preparations and imaging procedures for tracking experience-dependent Arc-GFP expression patterns in neuronal ensembles in the live animal. In this method, chronic cranial windows were first implanted in Arc-GFP mice over the cortical regions of interest. Those animals were then repeatedly imaged by two-photon microscopy after desired behavioral paradigms over the course of several days. This method may be generally applicable to animals carrying other fluorescent reporters of experience-dependent molecular changes4.

In Vivo Two-photon Imaging Of Experience-dependent Molecular Changes In Cortical Neurons

Experience-dependent molecular changes in neurons are essential for the brain's ability to adapt in response to behavioral challenges. An in vivo two-photon imaging method is described here that allows the tracking of such molecular changes in individual cortical neurons through genetically encoded reporters.

두피 뉴런에서 생체 내 두 - 광자의 영상은 경험에 의존 분자 변경

The brain's ability to change in response to experience is essential for healthy brain function, and abnormalities in this process contribute to a variety ...

Fast Micro-iontophoresis of Glutamate and GABA: A Useful Tool to Investigate Synaptic Integration

One of the fundamental interests in neuroscience is to understand the integration of excitatory and inhibitory inputs along the very complex structure of the dendritic tree, which eventually leads to neuronal output of action potentials at the axon. The influence of diverse spatial and temporal parameters of specific synaptic input on neuronal output is currently under investigation, e.g. the distance-dependent attenuation of dendritic inputs, the location-dependent interaction of spatially segregated inputs, the influence of GABAergig inhibition on excitatory integration, linear and non-linear integration modes, and many more.
With fast micro-iontophoresis of glutamate and GABA it is possible to precisely investigate the spatial and temporal integration of glutamatergic excitation and GABAergic inhibition. Critical technical requirements are either a triggered fluorescent lamp, light-emitting diode (LED), or a two-photon scanning microscope to visualize dendritic branches without introducing significant photo-damage of the tissue. Furthermore, it is very important to have a micro-iontophoresis amplifier that allows for fast capacitance compensation of high resistance pipettes. Another crucial point is that no transmitter is involuntarily released by the pipette during the experiment.
Once established, this technique will give reliable and reproducible signals with a high neurotransmitter and location specificity. Compared to glutamate and GABA uncaging, fast iontophoresis allows using both transmitters at the same time but at very distant locations without limitation to the field of view. There are also advantages compared to focal electrical stimulation of axons: with micro-iontophoresis the location of the input site is definitely known and it is sure that only the neurotransmitter of interest is released. However it has to be considered that with micro-iontophoresis only the postsynapse is activated and presynaptic aspects of neurotransmitter release are not resolved. In this article we demonstrate how to set up micro-iontophoresis in brain slice experiments.

In this article we introduce fast micro-iontophoresis of neurotransmitters as a technique to investigate integration of postsynaptic signals with high spatial and temporal precision.

글루타민산 염과 GABA의 빠른 마이크로 이온 도입 : 시냅틱 통합을 조사하는 유용한 도구

One of the fundamental interests in neuroscience is to understand the integration of excitatory and inhibitory inputs along the very complex structure of ...

A Procedure for Implanting Organized Arrays of Microwires for Single-unit Recordings in Awake, Behaving Animals

In vivo electrophysiological recordings in the awake, behaving animal provide a powerful method for understanding neural signaling at the single-cell level. The technique allows experimenters to examine temporally and regionally specific firing patterns in order to correlate recorded action potentials with ongoing behavior. Moreover, single-unit recordings can be combined with a plethora of other techniques in order to produce comprehensive explanations of neural function. In this article, we describe the anesthesia and preparation for microwire implantation. Subsequently, we enumerate the necessary equipment and surgical steps to accurately insert a microwire array into a target structure. Lastly, we briefly describe the equipment used to record from each individual electrode in the array. The fixed microwire arrays described are well-suited for chronic implantation and allow for longitudinal recordings of neural data in almost any behavioral preparation. We discuss tracing electrode tracks to triangulate microwire positions as well as ways to combine microwire implantation with immunohistochemical techniques in order to increase the anatomical specificity of recorded results.

Implanting organized arrays of microwires for use in single-unit electrophysiological recordings presents a number of technical challenges.&#160;Methods for performing this technique and the equipment necessary are described.&#160;Also, the beneficial use of organized microwire arrays to record from distinct neural subregions with high spatial selectivity is discussed.

동물 행동하자, 깨어있는 단일 단위 레코딩을위한 Microwires의 조직 된 배열을 주입하기위한 절차

In vivo electrophysiological recordings in the awake, behaving animal provide a powerful method for understanding neural signaling at the single-cell ...

Using the Electroretinogram to Assess Function in the Rodent Retina and the Protective Effects of Remote Limb Ischemic Preconditioning

The ERG is the sum of all retinal activity. The ERG is usually recorded from the cornea, which acts as an antenna that collects and sums signals from the retina. The ERG is a sensitive measure of changes in retinal function that are pan-retinal, but is less effective for detecting damage confined to a small area of retina. In the present work we describe how to record the &#8216;flash&#8217; ERG, which is the potential generated when the retina is exposed to a brief light flash. We describe methods of anaesthesia, mydriasis and corneal management during recording; how to keep the retina dark adapted; electrode materials and placement; the range and calibration of stimulus energy; recording parameters and the extraction of data. We also describe a method of inducing ischemia in one limb, and how to use the ERG to assess the effects of this remote-from-the-retina ischemia on retinal function after light damage. A two-flash protocol is described which allows isolation of the cone-driven component of the dark-adapted ERG, and thereby the separation of the rod and cone components. Because it can be recorded with techniques that are minimally invasive, the ERG has been widely used in studies of the physiology, pharmacology and toxicology of the retina. We describe one example of this usefulness, in which the ERG is used to assess the function of the light-damaged retina, with and without a neuroprotective intervention; preconditioning by remote ischemia.

The electroretinogram (ERG) is an electrical potential generated by the retina in response to light. This paper describes how to use the ERG to assess retinal function, in dark-adapted rats, and how it can be can be used to assess a neuroprotective intervention, in the present case remote ischemic preconditioning.

쥐 망막 및 원격 사지 허혈 양상의 보호 효과에 기능을 평가하기 위해 전위도를 사용하여

The ERG is the sum of all retinal activity. The ERG is usually recorded from the cornea, which acts as an antenna that collects and sums signals from the ...

Optogenetic Entrainment of Hippocampal Theta Oscillations in Behaving Mice

Extensive data on relationships of neural network oscillations to behavior and organization of neuronal discharge across brain regions call for new tools to selectively manipulate brain rhythms. Here we describe an approach combining projection-specific optogenetics with extracellular electrophysiology for high-fidelity control of hippocampal theta oscillations (5-10 Hz) in behaving mice. The specificity of the optogenetic entrainment is achieved by targeting channelrhodopsin-2 (ChR2) to the GABAergic population of medial septal cells, crucially involved in the generation of hippocampal theta oscillations, and a local synchronized activation of a subset of inhibitory septal afferents in the hippocampus. The efficacy of the optogenetic rhythm control is verified by a simultaneous monitoring of the local field potential (LFP) across lamina of the CA1 area and/or of neuronal discharge. Using this readily implementable preparation we show efficacy of various optogenetic stimulation protocols for induction of theta oscillations and for the manipulation of their frequency and regularity. Finally, a combination of the theta rhythm control with projection-specific inhibition addresses the readout of particular aspects of the hippocampal synchronization by efferent regions.

We describe the use of optogenetics and electrophysiological recordings for selective manipulations of hippocampal theta oscillations (5-10 Hz) in behaving mice. The efficacy of the rhythm entrainment is monitored using local field potential. A combination of opto- and pharmacogenetic inhibition addresses the efferent readout of hippocampal synchronization.

Optogenetic 쥐 행동에 Hippocampal 세타 진동의 유입

Extensive data on relationships of neural network oscillations to behavior and organization of neuronal discharge across brain regions call for new tools ...

Optogenetics Identification of a Neuronal Type with a Glass Optrode in Awake Mice

It is a major concern in neuroscience how different types of neurons work in neural circuits. Recent advances in optogenetics have enabled the identification of the neuronal type in in vivo electrophysiological experiments in broad brain regions. In optogenetics experiments, it is critical to deliver the light to the recording site. However, it is often hard to deliver the stimulation light to the deep brain regions from the brain&#39;s surface. Especially, it is difficult for the stimulation light to reach the deep brain regions when the optical transparency of the brain surface is low, as is often the case with recordings from awake animals. Here, we describe a method to record spike responses to the light from an awake mouse using a custom-made glass optrode. In this method, the light is delivered through the recording glass electrode so that it is possible to reliably stimulate the recorded neuron with light in the deep brain regions. This custom-made optrode system consists of accessible and inexpensive materials and is easy to assemble.

This work introduces a method to perform an optogenetic single-unit recording reliably from an awake mouse using a custom-made glass optrode.

깨어 있는 쥐에 유리 Optrode 신경 형식의 Optogenetics 식별

It is a major concern in neuroscience how different types of neurons work in neural circuits. Recent advances in optogenetics have enabled the ...

In Vivo Calcium Imaging of Lateral-line Hair Cells in Larval Zebrafish

Sensory hair cells are mechanoreceptors found in the inner ear that are required for hearing and balance. Hair cells are activated in response to sensory stimuli that mechanically deflect apical protrusions called hair bundles. Deflection opens mechanotransduction (MET) channels in hair bundles, leading to an influx of cations, including calcium. This cation influx depolarizes the cell and opens voltage-gated calcium channels located basally at the hair-cell presynapse. In mammals, hair cells are encased in bone, and it is challenging to functionally assess these activities in vivo. In contrast, larval zebrafish are transparent and possess an externally located lateral-line organ that contains hair cells. These hair cells are functionally and structurally similar to mammalian hair cells and can be functionally assessed in vivo. This article outlines a technique that utilizes a genetically encoded calcium indicator (GECI), GCaMP6s, to measure stimulus-evoked calcium signals in zebrafish lateral-line hair cells. GCaMP6s can be used, along with confocal imaging, to measure in vivo calcium signals at the apex and base of lateral-line hair cells. These signals provide a real-time, quantifiable readout of both mechanosensation- and presynapse-dependent calcium activities within these hair cells. These calcium signals also provide important functional information regarding how hair cells detect and transmit sensory stimuli. Overall, this technique generates useful data about relative changes in calcium activity in vivo. It is less well-suited for quantification of the absolute magnitude of calcium changes. This in vivo technique is sensitive to motion artifacts. A reasonable amount of practice and skill are required for proper positioning, immobilization, and stimulation of larvae. Ultimately, when properly executed, the protocol outlined in this article provides a powerful way to collect valuable information about the activity of hair-cells in their natural, fully integrated states within a live animal.

The zebrafish is a model system that has many valuable features including optical clarity, rapid external development, and, of particular importance to the field of hearing and balance, externally located sensory hair cells. This article outlines how transgenic zebrafish can be used to assay both hair-cell mechanosensation and presynaptic function in toto.

애벌레 Zebrafish의 측면 라인 세포의 생체 내 칼슘 이미징

Sensory hair cells are mechanoreceptors found in the inner ear that are required for hearing and balance. Hair cells are activated in response to sensory ...