우리는 박사 조나단 홀과 마우로 치머만 (ETH 취리히) PFK2 와 cep 1 ASOs, p27/CDKN1B ASOs, 및 박사 라팔 Ciosk (프리드리히 Miescher 연구소 생물 의학 연구의 디자인에 대 한 박사 Maikel Wouters의 합성에 대 한 감사 바젤) 안티-GLD-1 항 체에 대 한. 이 작품은 생명 공학 및 생물 과학 연구 위원회 (BB/K009303/1)와 왕 사회 울프 연구 공로 수상 (WM170036) A.P.G.에 의해 지원 되었다

1. 디자인 센스 Oligonucleotides (ASOs)
<ol><li>mRNA 또는 단편38사용 가능한 온라인 도구 사용 하 여 그의 이차 구조를 분석 합니다. 따라서, 빈 상자에 뉴클레오티드 (nt) 시퀀스를 입력 합니다. 기본 옵션 상자에서 격리 된 기본적인 쌍을 방지및 최소 자유 에너지 (MFE) 및 파티션 함수를 선택 합니다. 출력 옵션 상자에서 대화형 RNA 이차 구조 플롯 을 선택 하 고 마지막 진행 버튼을 클릭 합니다. 새 창 관심의 mRNA의 이차 구조를 표시 하는 팝업이 됩니다.</li>
	<li>적어도 3 개의 다른 탐지 보조 구조 부족 한 지역에 우선적으로 관심의 mRNA 내 21-24 국세청 긴 시퀀스를 선택 (예., 구조화 되지 않은 루프에서) 및에서 3' 되지 않은 지역 (UTR). 참고: 그것은 ASOs 3' 되지 않은 지역 (UTR) 시퀀스에 어 닐 링 최고의 수행 관찰 되었습니다. 1 개의 가능성은 리보솜 코딩 시퀀스 (CD)에 바인딩된 ASOs의 어 닐 링 방해 때때로 수 있습니다. 5 ' Utr는 어 닐 링 ASOs 테스트 하지 했다.<ol>
<li>50 %guanidine / 시 토 신 비율 영역을 선택 하 고 헤어핀 또는 어 닐 링 자체의 잠재적인 형성을 피하기 위해 반복 뉴클레오티드 협동 부족.</li>
	</ol>
</li>
	<li>디자인 2'-methoxy RNA oligonucleotides biotin moiety는 3', 선택된 영역 (1.2 단계) 원하는 내에 완벽 하 게 보완에 베어링을 수정 하는 수동으로 mRNA를 대상. 참고: 2'-methoxy 수정 RNA 저항 세포 RNases를 렌더링 하 고 녹는 온도에 엄격한 수 있는 이중을 증가 한다. Biotin moiety는 streptavidin과 ASOs를 캡처 필요 합니다.<ol>
<li>~ 60-65에 RNA 하이브리드의 용융 온도 조정 ° C 높은 언어 시퀀스 복잡 다는 것을 확인 하 고 (> 60%)으로 적합 한 온라인 도구39결정.</li>
		<li>40 기본 로컬 정렬 검색 도구 사용 하 여 잠재적인 아소 크로스-교 잡에는 transcriptome 다른 mRNAs와에 대 한 검색. 뉴클레오티드 폭발, 빈 상자에 시퀀스를 삽입 선택 하 고 관심의 유기 체. 기본으로 나머지 매개 변수를 유지 하 고 폭발을 클릭 합니다. 참고: 8-10 국세청의도 부분 연속 맞춤 간 교 잡 및이 mRNA의 복구를 발생할 수 있습니다.</li>
	</ol>
</li>
</ol>2. 문화, UV 방사선 및 세포 세포 세포의 용 해
참고: 다음 절차는 설명 신진 효 모 S. cerevisiae, C. 선 충, 선 충 및 인간 미 발달 신장 세포 (HEK293). 그것은 명시적으로 아직 테스트 하지 않지만 그럼에도 불구 하 고, 뿐만 아니라, 다른 유기 체에 적용할 수 있습니다.
<ol><li>S. cerevisiae
	<ol>
<li>효 모 세포를 성장 (예., BY4743 미분; 변형 MATa/α his3Δ1/his3Δ1 leu2Δ0/leu2Δ0 LYS2/lys2Δ0 met15Δ0/MET15 ura3Δ0/ura3Δ0 PFK2:TAP / PFK2) YPD 미디어의 500 ml에서 (1% 효 모 추출 물, 2% 펩, 2 %D-포도 당) 220 rpm에서 일정 한 동요와 30 ° C에서.</li>
		<li>중간 로그 단계에서 세포를 수집 (600 nm (OD)600 에서 광학 밀도 ~ 0.6) 0.45 μ m 나일론 필터를 사용 하 여 여과 또는 실 온 (RT)에서 2 분 동안 3000 × g에서 원심 분리. 삭제 흐름 통해 또는 상쾌한, 각각.</li>
		<li>셀 세 번 25 mL의 인산 염-버퍼링-염 분 (PBS) 0.45 μ m 나일론 필터를 사용 하 여 세척 또는 RT에서 2 분 동안 3000 × g에서 원심 분리 하 여 수집 하 고는 상쾌한 삭제. 최대한 빨리 부과 스트레스 RNA-단백질 상호 작용에 영향을 미칠 수로 세포를 수집 합니다.</li>
		<li>25 ml PBS의 셀 resuspend 하 고 정지는 15 cm 배양 접시에에서 붓는 다. 얼음에 접시를 놓고, 뚜껑을 제거 하 고 셀 세 번 400 mJ cm-2 부드러운 혼합과 각 노출 주기 사이 얼음에 2 분 휴식 UV crosslinker에서 254 nm 자외선의 노출.</li>
		<li>50 mL 튜브에 세포를 전송 및 4 ° c.에 3 분 동안 3000 × g에서 원심 분리 하 여 세포를 수집 삭제는 상쾌한 고 펠 릿을 유지. 참고: 셀 스냅 액체 질소에서 냉동 고-80 ° c.에 저장 된 수 합니다.</li>
		<li>냉장된 세포의 용 해 버퍼 A의 4 mL에 셀 resuspend (파운드-A; 100 mM Tris HCl, pH 7.5, 500mm LiCl, 10 mM EDTA, 1% 트라이 톤 X-100, 5mm DTT, 20 U ml-1 DNase I, 100 U ml-1 RNasin, EDTA 무료 프로 테아 제 억제 물 칵테일을 완료).</li>
		<li>2 2 mL 튜브에 세포를 전송 합니다. 최대 추가 합니다. ⅔의 유리 구슬 냉장 볼륨과 4 ° c.에서 10 분 동안 30 Hz에서 조직 lyser의 세포를 중단</li>
		<li>뜨거운 바늘으로 튜브의 하단에 구멍을 펀치와 30에 대 한 600 × g에서 원심 분리 하 여 신선한 1.5 mL 튜브에는 lysate 전송 s.</li>
		<li>3 분 동안 3000 × g에서 4 ° C에서 3 개의 순차 centrifugations에 의해 lysate 5000 × g 그리고 10000 × g 5 분에 대 한 선택을 취소 합니다. 참고: 추출 스냅인-액체 질소에서 냉동 고 수-80 ° c.에 저장</li>
	</ol></li>
	<li>C. 선 충
	<ol>
<li>선 충 류 성장 매체 (NGM) 접시 (0.3 %NaCl, 1.7 %agar, 0.25% 펩, 1mm CaCl2, 5 µ g/mL 콜레스테롤, 1mm MgSO4, 25 mM KPO4 버퍼, pH 6.0) OP50 대장균 긴장 시드에 20 ° C에서 문화 브리스톨 N2 웜 41 .
</li>
		<li>각 접시에 M9 버퍼41 (0.3% KH2포4, 0.6% 나2HPO4, 0.5 %NaCl, 1 mM MgSO4)의 5 mL을 추가, resuspend 벌레를 15 mL 튜브에 벌레를 전송 접시를 동요 한다. 슬라이드에는 서 스 펜 션의 2 µ L를 놓고 정지에서 벌레는 현미경으로 계산 합니다. 다음 접시 당 벌레의 수를 계산 하려면 요소를 적용 합니다.</li>
		<li>수집 ~ 120000 웜 (400 × g, 2 분, RT) 상 온에서 원심 분리 하 여 폐기는 상쾌한.</li>
		<li>벌레 세 번 씻어. 따라서, M9 버퍼의 10 mL을 추가, 반전에 의해 혼합 및 실시간에 2 분 동안 400 × g에서 원심 분리 하 여 벌레를 수집</li>
		<li>벌레를 M9 버퍼의 15 mL를 추가 하 고 실시간에 15 분 동안 회전 바퀴에</li>
		<li>NGM 접시 (접시 당 4000 ~ 웜)에 벌레를 전송 및 UV 빛에 노출 (254 nm) UV-crosslinker에서 300 엠 제이 cm-2 에서.</li>
		<li>접시에 직접 M9 버퍼의 5 mL을 추가 하 고 버퍼에 벌레를 resuspend에 접시를 흔들어. 15 mL 튜브에는 피 펫과 서 스 펜 션을 전송 하 고 실시간에 2 분 동안 400 × g에서 원심 분리 하 여 벌레를 수집</li>
		<li>세포의 용 해 버퍼 B의 2 mL에 벌레를 resuspend (파운드-B; 100 mM Tris HCl, pH 8.0, 150 m m NaCl, 1 mM EDTA, 0.75 %IGEPAL, 1mm DTT, 20 U mL-1 DNase I, 100 U mL-1 RNasin, EDTA 무료 프로 테아 제 억제 물 칵테일을 완료).</li>
		<li>액체 질소로 채워진 박격포에 벌레 갈아. 실시간에 녹여 50 mL 튜브에 분말을 수집 참고: 액체 질소 안전 절차 (예: 연기 후드와 안전 장갑)에 따라 처리 합니다.</li>
		<li>Lysate 10 분 14000 × g에서 원심 분리 하 여 지방 층 포함 한 하 고 이후에 명확히 전달 0.45 μ m 필터 주사기를 통해 lysate.</li>
	</ol></li>
	<li>사람 배양된 세포 참고: 다음 설명 기반 과도 transfection HEK293 세포 pGL3-CDKN1B-3 ' UTR 기자 플라스 미드 CDKN1B/27의 하류 반딧불 luciferase 유전자42의 3′UTR 표현 하.<ol>
<li>문화 HEK293 세포 Dulbecco의 수정이 글의 중간 (DMEM)에 하 포도 당 25 m m 및 1 m m 나트륨 pyruvate, 포함 된 100 mL-1 페니실린, 100 µ g mL-1 스과 10% 태아 둔감 한 혈 청 (FBS), 보충 하 고 37 ° c에서 품 어는 습도 챔버 (인큐베이터) 포함 된 5% CO2.</li>
		<li>표준 10cm 조직 문화에 씨 ~ 3 × 106 HEK293 세포 transfection는 전날 접시. hemocytometer 셀을 계산 합니다.</li>
		<li>취재 원 유전자의 믹스 2 µ g (예., pGL3-p27-3'UTR) transfection 시 약의 20 µ L와 70 %confluency (~ 7 × 106 셀)에 셀 transfect 고.</li>
		<li>수확 하기 전에 셀 추가 48 h에 대 한 37 ° C에는 인큐베이터에 배치 합니다.</li>
		<li>혈 청 학적인 피 펫과 매체를 제거 하 고 37 ° c.에 미리 예 열 하는 PBS의 10 mL로 두 번 셀을 신속 하 게 세척 혈 청 학적인 피 펫으로 PBS를 제거 합니다.</li>
		<li>접시에 6 mL PBS의 추가 얼음에 놓고 다음 셀 UV 빛에 노출 (254 nm) UV crosslinker에 100 mJ cm-2 에서. 참고: 접시 유지 되어야 한다 얼음에-자외선 노출 시.</li>
		<li>셀 (총 10 ~7 셀) PBS에 15 mL 튜브에 떨어져 다쳤어요.</li>
		<li>4 ° C에서 10 분 동안 250 × g에서 셀 아래로 회전 시키십시오 하 고는 피 펫과 상쾌한 제거. 참고: 셀 펠 릿 스냅-액체 질소에서 냉동 고 사용까지-80 ° C에서 저장 될 수 있습니다.</li>
		<li>미리 냉장된 세포의 용 해 버퍼의 2 mL에 셀 resuspend (파운드-A)에 대 한 아래로 pipetting으로 5-6 번, 얼음에 튜브를 유지 하면서.</li>
		<li>얼음에 5 mL 튜브에는 피 펫과 lysate 전송.</li>
		<li>제목 lysate 쥡니다 30와 10 μ m 진폭에서 20 s 파열의 구성의 3 라운드를 얼음에 기간 냉각의 s. 참고: 쥡니다 세포와 파편 DNA의 세포의 용 해 완료로 좋습니다.</li>
		<li>2 mL 튜브 및 4 ° c.에서 10 분 동안 15000 × g에서 원심 분리기는 lysate 전송 (= 추출) 상쾌한 수집 및 새로운 튜브에 전송. 추가 단백질 및 RNA 분석을 위한 분석 샘플 (5-10%)를 제거 합니다. 참고:이 단계는 모든 나머지 세포 파편을 제거 하는 중요 하 고 반복 될 수 있습니다.</li>
	</ol></li>
</ol>3. 첫 번째 단계: 많은 RNA 격리
<ol><li>Oligo(dT)25의 1 mg equilibrate-결합 각 세포의 용 해 버퍼의 500 µ L에 자석 구슬.</li>
	<li>결합 5 mg, 10 mg 또는 4 mg (단백질) S. cerevisiae, C. 선 충 또는 HEK293 추출, 각각, oligo(dT)25 의 1 밀리 그램-자석 구슬 결합. 믹서에 25 ° C에서 10 분 동안 적극적으로 샘플을 믹스. 참고: 추출의 단백질 농도 소 혈 청 알 부 민 (BSA)를 사용 하 여 참조 표준으로 Bradford 분석 실험으로 확인할 수 있습니다. 샘플의 활기찬 동요 구슬의 침전을 방지 합니다. MRNA 격리의 특이성을 평가 하기 위해 제어 실험 polyadenylic 산 (pA)의 초과 (20 µ g)를 추가 하 여 병렬로 수행할 수 있습니다.</li>
	<li>10 s를 제거 마그네틱 스탠드에 튜브를 놓고는 상쾌한. 복구 (단계 3.7)의 다음 라운드에 대 한 얼음에 상쾌한을 유지.</li>
	<li>세척의 500 µ L A 버퍼 추가 (10 mM Tris HCl, pH 7.5, 600mm LiCl, 1 mM EDTA, 0.1% 트라이 톤 X-100) 구슬과 5 소용돌이에 s. 참고: 워시 버퍼에 LiCl의 농도가 달라질 수 있습니다. 600 mM LiCl 좋지만 낮은 농도 (500 m m C. 선 충, HEK293 300 m m) 테스트도 했다.</li>
	<li>자석으로 비즈를 수집 하 고 구슬 (WB, 10 mM Tris HCl, pH 7.5, 600mm LiCl, 1 mM EDTA)는 워시 버퍼 B의 500 µ L로 두 번 세척.</li>
	<li>믹서에 10 mm Tris HCl, pH 7.5 연속 떨고 (1000 rpm)으로 2 분 동안 80 ° C에서 30 µ L에서 RNA을 elute. 즉시 튜브 마그네틱 스탠드에 놓고 10 후는 eluate 수집 미 저장 정화의 추가 라운드 구슬. 참고: 낮은 온도에서 구슬에 mRNAs의 잠재적인 다시 바인딩 방지 하기 위해 가능한 한 빨리는 eluate를 수집 합니다.</li>
	<li>3.3 단계에서 수집 된 상쾌한에 구슬 이전 단계에서 추가 하 고 반복 캡처, 세척 및 차입 mRNAs의 두 번 (단계 3.3-3.6). 반복된 라운드에서 있다 다음 결합 하 고-80 ° c.에 저장 될 수 있다</li>
</ol>4. 두 번째 단계: 3'-Biotinylated' 2-Methoxy 수정 센스 RNA Oligonucleotides와 특정의 캡처 mRNAs
참고: ASOs의 적합성을 테스트 하기 위해 다음 절차는 총 RNAs 셀에서 격리를 수행할 수 있습니다.
<ol><li>30 µ L 바인딩의 1 mL에 자석 구슬 streptavidin 결합의 equilibrate와 버퍼 (B & W 버퍼, 10 mM Tris HCl, pH 7.5, 150 mM NaCl, 0.5 m EDTA, pH 8.0)을 씻어 1 시간에 대 한 회전에 0.1 mg mL-1대장균 이동 RNA (tRNA)을 포함 하 실시간<ol>
<li>구슬 B & W 버퍼의 750 µ L로 세 번 세척.</li>
		<li>B & W 버퍼의 30 µ L에 구슬 resuspend 그리고 사용까지 얼음에 계속.</li>
	</ol>
</li>
	<li>이전 많은 격리에서 총 단백질의 ~ 35 µ g을 희석 (참조 3) 1.5 mL 튜브에 B & W 버퍼의 100 µ L에서. 참고: 총 RNA와 ASOs의 특이성을 테스트 하려면 추가 600 B & W 버퍼의 100 µ L 정제 총 RNA의 ng.</li>
	<li>각각 아소의 200 pmol 추가 하 고 5 분 동안 70 ° C에서 품 어. 참고: 높은 온도 아소의 어 닐 링을 촉진 하는 RNA 이차 구조를 해결 합니다.</li>
	<li>장치에서 전체 열-블록을 제거 하 고 천천히 진정 10 분에 대 한 실시간에 그것을 배치.</li>
	<li>4.1 단계에서 샘플 equilibrated streptavidin 결합 자석 구슬의 30 µ L를 추가 합니다.</li>
	<li>믹서에 950 rpm에서 일정 한 동요와 25 ° C에서 30 분 동안 혼합물을 품 어. 참고:이 좋습니다 구슬의 침전을 방지 하기 위해 튜브 마다 10 분 영화를.</li>
	<li>튜브에 마그네틱 스탠드, 제거는 상쾌한 놓고 55 ° c.에 세 번으로 미리 데워 B & W 버퍼의 750 µ L 구슬 세척 참고: 최적의 세척 온도 달라질 수 있습니다 약간 다르다/다른 ASOs 사이. 비 가교 된 총 RNA 사전 셀 추출 물으로 실험을 수행으로이 상태를 조정 하는 것이 좋습니다.</li>
	<li>10 mm Tris HCl, pH 7.5 믹서. 에 950 rpm에서 일정 한 동요와 10 분 동안 90 ° C에서 20 µ L에서 RNA elute 마그네틱 스탠드에 튜브를 놓고는 eluate 즉시 수집 합니다. 참고: 단백질 분석용 구슬에 1 × Laemmli 버퍼의 20 µ L을 추가 하 고 5 분 단백질은 immunoblot 분석 표준 실험실 프로토콜을 다음에서 모니터링에 대 한 95 ° C에서 품 어.</li>
</ol>

저자는 공개 없다.

여행 특정 mRNAs에 vivo에서 생 화 확 적인 수단에 바인딩된 단백질의 분석을 허용 한다. 우리 다른 생물/세포에서 mRNA 목표와 특정 RBPs의 상호 작용을 확인 하기 위해 메서드를 사용 하는 동안 여행 또한 많은 RNAs, 세포질 긴 ncRNAs 등의 연구에 적용할 수 있습니다. 또한, MS 또는 RNA 시퀀싱 바인딩된 단백질 RNAs의 체계적인 분석은 업 스케일링 절차의 얻을 수 있습니다. 이와 관련, 우리의 예비 데이터 효 모 문화의 1 L와 인간의 HEK293 세포의 100 백만 이상 잘 표현한 mRNAs에 대 한 신뢰할 수 있는 MS 데이터를 얻기 위해 (되지 않은 결과) 충분 한 시작 물자를 제공할 수 있는 것을 나타냅니다.
254에서 UV 빛을 가진 세포의 방사선 조사를 포함 하는 설명된 여행 프로토콜 nm crosslink RNA-단백질 상호 작용. 정화 하는 동안 엄격한 세척 조건 구현 수 있습니다. 그럼에도 불구 하 고, 명시적으로 테스트, 가교는 선택 사항이 며 active RNPs 또한 생리 버퍼가 복구할 수 있습니다 주의 하 길. 그러나,이 경우 lysates의 목표가 RNA 단백질 또는 RNAs의 잠재적인 다시 배열 해야 될 고려. 반대로, 만약 UV 또는 다른 가교 절차 적용 (예, 포름알데히드), RNA의 무결성 평가 되어야 한다로 RNA 저하 mRNPs의 저하 회복으로 이어질 수 있습니다. 또한, 자외선 가교 오히려 비효율적인 (~ 5%) 이며 이중 가닥 RNA와 상호 작용 하는 단백질에 대 한 심지어 덜 그렇게 있는 RBPs12의 특정 클래스의 검색에 대 한 바이어스를 소개 수 있습니다. 마지막으로, UV 방사선 또한 데이터 해석45,46에 대 한 간주 되어야 하는 단백질-단백질, 단백질-DNA crosslinks을 유도할 수 있다. 따라서, 포름알데히드, 예를 들어, 대체 가교 절차 또한 mRNAs에 더 큰 단백질 어셈블리를 캡처하는 데 특히 관심의 수 있습니다.
여행의 하나의 주요 기능은 특정 RNAs, 선택도 증가 및 감소 공동 오염 물질을 정화의 확률 아소 기반 정화 절차 2 단계입니다. 예를 들어, 하나의 관심사 biotin-바인딩 단백질의 공동 정화 이어질 수 있는 세포 추출 물에 직접 추가 하는 biotinylated ASOs 관련이 있습니다. 이 여행에서 covalently 결합 된 oligo-(dT)25 자석 구슬를 사용 하 여 많은 RNAs의 엄격한 정화 조건 RNA-단백질 위하여 캡처 할 수 있는 정화의 첫 라운드를 구현 하 여 피할입니다. 또한, 많은 RNA 선택 리보솜 RNAs tRNAs, 등 매우 풍부한 ncRNAs 제거 하 고 따라서 샘플 및 간 교 잡 및 오염에 대 한 잠재적인 출처의 복잡성을 감소 시킨다. 두 번째 단계에서 특정 mRNAs biotinylated로 복구 되 고 지역에 mRNA 표적에 anneal ASOs를 수정. 또는, 수정된 ASOs 수 또한 직접 covalently에 첨부는 아민-링커를 통해 자석 구슬 biotin 바인딩 단백질을 잡으려고 성향 감소. 그러나, 우리의 경험, streptavidin 구슬의 추가 이전 ASOs는 많은 RNA 분수의 인큐베이션 복구 mRNPs 아소 결합 구슬의 직접적인 추가 보다 더 효율적으로. 가능 하 게, 무료 oligos는 접착 고정된 oligos에 비해 구조화 된 RNA에 시퀀스에 더 나은 접근을 선호 하 고 있습니다. 따라서, ASOs의 샘플 인큐베이션 전에 구슬의 공유 결합 RNA 대상의 복구를 위해 유해할 수 하 고 경험을 테스트 될 수 있다.
아소 기반 방법으로 하나의 단점은 일부 대상 mRNAs의 비효율적인 복구입니다. 따라서이 좋습니다 anneal 여러 ASOs의 평가 대 본의 다른 지역에. 특히, 3'-UTR에서 시퀀스 anneal 2-3 ASOs 또는 관심의 mRNA의 CD 디자인을 좋습니다. 각 아소 각각 mRNA 대상의 복구에 대 한 다른 효율성을 전시 수 있습니다 하 고 경험적으로 되어야 합니다 (그림 2A, B, 데이터 표시 되지 않음)을 테스트. 끝에, 우리는 발견 ASOs 3' Utr에 어 닐 링 더 수행 CD를 단련 하는 것 들에 비해. 이것은 리보솜 CD 내에서 효율적인 하이브리드를 방해 수 있습니다 반면 리보솜, 번역의 부재로 인해 Utr에 사이트를 바인딩 증가 접근성 때문일 수 있었다. 우리 또한 경험이 풍부한 비 표적 mRNAs에서 증가 오염으로 이어질 수 및 풀 다운 효율 감소 여러 ASOs의 조합. 어떤 경우에, 선택한 oligos의 선택도 경쟁 실험에 의해 통제 될 수 있다 (예., 경쟁 oligos의 추가).
더 우려 없는 RNAs와 잠재적인 간 교 잡에 관한 다른 mRNAs와 그도 부분 교 잡 관찰로 이어질 수 있습니다 그 mRNA (그림 2C)의 복구. 설계 ASOs의 적합성 평가, 따라서 좋습니다 초기 체 외에 테스트 총 RNAs 소금 농도 및 버퍼의 세척 온도 최적화를 수행. 우리의 손에서 150 m m를 포함 하는 버퍼에서 결합 하는 streptavidin 자석 구슬의 세척 55 ° C에서 NaCl 수행, 하지만 각 설계 아소에 대 한 조건의 독립 테스트 것이 좋습니다. 주목할 만한, 우리 모든 ASOs (2D 그림) 에서 체 외 실험에서 선택 했다 캡처 가교 된 셀 추출 물 (그림 3)에서 각각 mRNA 표적에 대 한 적절 한 추가에서 의 유효성 substantiating 발견 체 외 테스트. MRNA 캡처에 대 한 적합 한 ASOs, 설계 외 추가 요소 선택도에 영향을 줄 수 있습니다. 따라서, 구슬 유형 사양에 따라 BSA 및 tRNA와 포괄적인 차단 절차 구슬에 난다 바인딩을 방지할 수 있습니다. 더 단백질의 불특정 흡수를 줄이기 위해,이 좋습니다 Lo 바인딩 튜브를 사용 하 여를 샘플의 낮은 금액으로 작업 하는 경우에 특히.
일반적으로, 여행 수 ASOs와 RNAs를 잡으려고 이전 설립된 접근을 보완 하 고 있다. 예를 들어, 비 코딩 RNA Xist 의 긴 (90-메 르) biotinylated DNA oligonucleotides 전체 사본 를 포함 하는 배열을 사용 하 여 200-800 백만 자외선 가교 된 세포에서 파생 된 핵 추출 물에서 바인딩된 단백질 격리 했다 34,35. 그러나, 선택한 바둑판식 배열 접근 없는 RNAs과 간 교 잡에 대 한 중대 한 잠재력에 비추어 문제가 될 수 있다 그리고 특정 사본, 예를 선택 하는 데 사용할 수 없습니다., 양자 택일로 접합 형태. 최근, 잠긴된 핵 산 (LNA) 특별히 또는 DNA 아소 mixmers covalently 세포 자유로운 추출 물;에서 생체 외에서 사본 또는 높은 표현된 리보솜 RNAs를 복구 하는 자기 수 지에 붙어 있었다 그러나, 그것은 vivo에서 형성 된 mRNA 단백질 단지36의 복구를 위해 시험 되었다. RBPs와 ncRNA post-transcriptional 유전자 제어의 증가 인식에 비추어 우리를 믿고 여행을 구성과 RNP 단지 세포내 환경 단서와 미치는 영향에 따라 세포 내에서 역학 조사 하는 유용한 방법 건강과 질병.

Post-transcriptional 유전자 규칙 구동 RNA 의무적인 단백질 (RBPs), 비 코딩 RNAs (ncRNAs) 및 mRNAs 사이 상호 작용을 통해이 직접 처리, 현지화, 번역 및 셀1 에 내에서 모든 대 본의 , 2. RBPs 고 ribonucleoprotein 단지/입자 (RNPs)로 알려져 설정 특정 mRNAs와 상호 작용 하는 ncRNA mRNAs와 유전자 식 컨트롤의 운명을 이해 하는 열쇠 이므로. RNP 단지3,4의 생 화 확 적인 특성에 대 한 보완 방법을 착수: "RNA 중심" 접근을 포함 한다 "단백질 중심" 접근은 특정 RBPs의 정화를 바탕으로, 하는 동안은 모집단 또는 개별 RNAs 및 상호 작용 단백질 또는 RNAs의 후속 분석의 격리. 최근, polyadenylated와 상호 작용 하는 RBP 레 퍼 토리의 식별을 위한 RNA 중심 접근 (poly(A)) RNAs5 인기 끌고있다 점점 단백질-RNA 안정화 하는 자외선 (UV) 빛 가교 단계를 통합 하 여 상호 작용 이전 극적으로 인간 세포6,7,,89,10,11RBPs의 카탈로그를 확장, mRNAs의 격리 꼬마 선 충 12,14, saccharomyces cerevisiae의12,13,및 다른 유기 체15,,1617,18, 19,20. 그러나, 단백질의 특정 사본에 ncRNAs 매핑 여전히 좋은 도전입니다. 이 위해, 두 가지 주요 방법을 현재 사용: 한편으로, RNA aptamer 태그 친 화력 정화 수 있도록 관심의 RNA를 융합 하는. 따라서, RNA aptamers aminoglycoside 항생제를 포함 한 tobramycin 및 스21,22,,2324또는 단백질 외 투 단백질 같은 높은 선호도와 바인딩 R17/MS2 살 균 소 또는 세균성 streptavidin S125,,2627,,2829. 비록이 방법은 상대적으로 강력 하 고 다재 다능 한 수를 표시 했다, 조사, 설계는 RNA 복제 요구 하 고 따라서 자연 mRNAs를 캡처하는 데 사용할 수 없습니다. 다른 한편으로, 센스 oligonucleotides (ASOs)는 복구에 대 한 초기에 사용 되었다 하 고의 높은 네이티브 RNPs30,31 및 바이러스 성 RNAs32표현. 더 최근에, ASOs 캡처 오래 비 코딩 RNAs33,,3435 에 적용 된 고 생체 외에서 mRNPs36형성. 모든 RNA 중심 접근 한 주요 제한 요인이 더 문제가 낮은 표현 mRNAs의 복구를 만들기 관심, RNA의 복사본입니다. 이 제한 반응; upscaling에 의해 극복 될 수 있다 그러나,이 잠재적으로 배경 증가 발생할 수 있습니다.
여기, 우리가 우리의 최근에 개발한 아소 기반 협동 RNA 격리 절차 (여행) 높은 선택도37 (그림 1). 와 네이티브 mRNA 단백질 복합물을 설명 두 개의 순차적 아소 기반 정화 단계를 포함 하는 프로토콜, 상용 oligo(dT)와 많은 mRNAs의 특별히 설계 된 짧은 biotinylated 2'-methoxy를 사용 하 여 특정 mRNAs의 캡처 다음 비즈를 결합 하는 즉 ASOs RNA입니다. 이 2 단계 절차는 오염 단백질을 제거 하는 데 도움이 하 고 조정 및 최적화에 대 한 기회를 추가 합니다. 이 경우에, 여행에서 효 모, 선 충, 선택 된 mRNAs에 적용 된 그리고 mRNA 단백질 복합물을 형성 하는 인간 세포 vivo에서 확인 하.

<table><tbody><tr><td>MaxQ 5000 Large Incubated and Refrigerated Orbital Shaker</td><td>Thermo Fisher Scientific</td><td>SHKE5000-8CE</td><td>Floor shaker to grow yeast cells</td></tr><tr><td>BBD 6220</td><td>Thermo Fisher Scientific</td><td></td><td>CO&lt;sub&gt;2&lt;/sub&gt; incubator to grow human cells</td></tr><tr><td>Sonicator Soniprep150</td><td>MSE</td><td>MSS150.CX4.5</td><td>Sonicator/cell disruptor. Used to shear DNA in human cell lysates</td></tr><tr><td>Stratalinker 1800</td><td>Stratagene</td><td></td><td>Stratalinker to expose cells to UV light at 254 nm</td></tr><tr><td>Tissue Lyser</td><td>Qiagen</td><td>RETSCH MM200</td><td>Device to mechanically disrupt yeast cells</td></tr><tr><td>Refrigerated Centrifuge</td><td>Eppendorf</td><td>5810R</td><td>Centrifuge to spin down cells, lysates</td></tr><tr><td>Shaking incubator, Thriller</td><td>Peqlab</td><td></td><td>Thermoshaker for 1.5 mL tubes</td></tr><tr><td>Glass beads 0.5mm</td><td>Stratech Scientific Limited</td><td>11079105</td><td>Lysis of yeast cells</td></tr><tr><td>Nylon Filter, 0.41 &amp;mu;m</td><td>Millipore</td><td>NY4104700</td><td>Collection of yeast cells</td></tr><tr><td>Millex-HA Filter, 0.45 &amp;micro;m</td><td>EMD Millipore</td><td>SLHA02510</td><td>Filter to clear nematode lysate</td></tr><tr><td>Eppendorf LoBind microcentrifuge tubes Protein 1.5 mL</td><td>Sigma-Aldrich</td><td>22431081</td><td>Minimise protein loss</td></tr><tr><td>2 mL microfuge tube</td><td>Ambion</td><td>AM12425</td><td>Yeast extract preparation and other applications</td></tr><tr><td>5 mL tube</td><td>Thermo Fisher Scientific</td><td>129A</td><td>Collection of HEK293 cell lysate</td></tr><tr><td>15 mL tube</td><td>Sarstedt</td><td>62.547.254</td><td>Collection &lt;i&gt;C. elegans&lt;/i&gt;</td></tr><tr><td>50 mL plastic tube</td><td>Sarstedt</td><td>62.554.502</td><td>Collection yeast cells</td></tr><tr><td>DMEM, high glucose, pyruvate</td><td>Thermo Fisher Scientific</td><td>41966</td><td>Media for culturing HEK293 cells</td></tr><tr><td>Penicillin-Streptomycin</td><td>Sigma-Aldrich</td><td>P4333</td><td>Used to supplement cell culture media to control bacterial contamination</td></tr><tr><td>Fetal Bovine Serum (FBS)</td><td>Sigma-Aldrich</td><td>F7524</td><td>Used to supplement cell culture media</td></tr><tr><td>Lipofectamine 2000</td><td>Thermo Fisher Scientific</td><td>11668027</td><td>Transfection reagent</td></tr><tr><td>RQ1 RNase-Free DNase</td><td>Promega</td><td>M6101</td><td>DNAse I to degrade DNA from cell lysate</td></tr><tr><td>RNasin Plus RNase Inhibitor</td><td>Promega</td><td>N2611</td><td>RNase inhibitor to avoid RNA degradation</td></tr><tr><td>cOmplete, Mini, EDTA-free Protease Inhibitor Cocktail</td><td>Roche</td><td>11836170001</td><td>Protease inhibitor cocktail to avoid protein degradation</td></tr><tr><td>Dynabeads Oligo (dT)25</td><td>Thermo Fisher Scientific</td><td>61011</td><td>Magnetic beads required for the first step of mRNA-protein complex purification</td></tr><tr><td>Dynabeads M-280 Streptavidin</td><td>Thermo Fisher Scientific</td><td>11205D</td><td>Magnetic beads required for the second step of mRNA-protein complex purification</td></tr><tr><td>&lt;em&gt;E. coli&lt;/em&gt; tRNA</td><td>Sigma-Aldrich</td><td>10109550001</td><td>transfer RNA from &lt;em&gt;E. coli &lt;/em&gt;used for blocking streptavidin beads and avoid unsepecific interactions</td></tr><tr><td>Quick Start Bradford 1x Dye Reagent</td><td>BioRad</td><td>5000205</td><td>To determine protein concentration within lysates, using BSA as reference</td></tr><tr><td>Bovine Serum Albumin</td><td>Sigma</td><td>A7906-100G</td><td>Used to perform the standard curve that will be used as reference for protein concentration determination</td></tr><tr><td>mouse anti-Act1</td><td>MP Biomedicals</td><td>869100</td><td>Antibody for detection of yeast actin in Western blot (1:2,500)</td></tr><tr><td>mouse anti-Act1</td><td>Sigma</td><td>A1978</td><td>Antibody for detection of human actin in Western blot (1:2,000)</td></tr><tr><td>mouse anti-HuR</td><td>Santa Cruz</td><td>sc-5261</td><td>Antibody for detection of HuR in Western blot (1:500)</td></tr><tr><td>mouse anti&amp;ndash;CYC-1</td><td>Invitrogen</td><td>456100</td><td>Antibody for detection of Cyc-1 in Western blot (1:1,000)</td></tr><tr><td>peroxidase anti-peroxidase soluble complex</td><td>Sigma</td><td>P1291</td><td>Detection of Pfk2:TAP in Western blot (1:5,000)</td></tr><tr><td>HRP-conjugated sheep anti-mouse IgG</td><td>Amersham</td><td>NXA931</td><td>HRP-coupled secondary antibody</td></tr></tbody></table>

an oligonucleotide-based tandem rna isolation procedure to recover eukaryotic mrna-protein complexes

RNA 의무적인 단백질 (RBPs) post-transcriptional 유전자 발현 통제에 주요 역할을 재생합니다. 따라서, mRNA 단백질 복합물의 생 화 확 적인 특성 상호 작용 단백질 또는 비 코딩 RNAs에 의해 유추 하는 mRNA 규정을 이해 하는 데 필수적 이다. 여기, 탠덤 RNA 격리 절차 (여행) 세포 추출 물에서 endogenously 형성된 mRNA 단백질 복합물의 정화를 가능 하 게 설명 합니다. 2 단계 프로토콜 포함 polyadenylated mRNAs 센스 oligo(dT) 구슬 및 후속의 다음으로 고립 될 수 있다 3'-biotinylated 2'-O-갠 센스 RNA oligonucleotides와 함께 관심 있는 mRNA의 캡처의 격리 streptavidin 구슬입니다. 여행 가교 된 mRNA-ribonucleoprotein (mRNP) 단지 vivo에서 효 모, 선 충 및 추가 RNA와 단백질 분석에 대 한 인간의 세포에서 복구할 데 사용 되었습니다. 따라서, 여행은 mRNPs 세포내 또는 환경 단서에 의해 부과 된의 동적 다시 배열 공부 하는 생물에 걸쳐 polyadenylated RNAs의 모든 종류에 적용할 수 있습니다 다목적 접근 이다.

우리는 여행, 3 다른 유기 체37에서 바인딩된 단백질 그들의 특정 한 mRNAs를 잡으려고 불리는 아소 기반 RNA 격리 전략 개발. 본질적으로, RNA-단백질 복합물 가교 된에서 vivo에서 했다 254 nm, 및 많은 세포의 UV 방사선에 의해 RNAs는 상용 올리고 (dT) 결합 하는 자석 구슬, 복구 된 다음의 mRNA와 격리 했다 3'-biotinylated 2-0'-methoxy 수정 센스 RNA oligonucleotides (그림 1). 우리 따라서 전체 complementarity 여러 21-24 국세청 수정 ASOs 영역 선택 된 mRNAs에 효 모, 선 충 C. 및 인간, 디자인과 (뇌관 및 ASOs의 목록이 테이블에서에서 주어진 다 관심의 mRNA를 복구할의 적합성 테스트 1). 효율성과 개별 ASOs의 특이성 각 유기 체에서 분리 된 비 가교 된 총 RNA와 먼저 평가 했다. 이 실험에서 RNA ASOs streptavidin 활용 된 상자성 구슬에 결합 되었고 해당 유기 체에서 준비 하는 비 가교 된 총 RNA와 인 큐베이 팅. 구슬에서 캡처된 mRNAs의 출시 후 mRNA의 존재 뿐만 아니라 없는 제어 mRNAs는 반전 녹음 방송 (RT)에 의해 모니터링 대상-중 합 효소 연쇄 반응 (PCR)37. 우리는 두 개의 변수, 소금 농도 및 온도 워시 버퍼, 3 개의 다른 ASOs (그림 2A)와 함께 테스트 되었습니다 누 룩에서 PFK2 mRNA의 캡처의 효율에 중요 한 역할을 했다 것으로 나타났습니다. 복구 감소 25 m m 소금 (NaCl) 농도 낮추는 부정적인 모든 ASOs, 감지할 수 없는 수준 mRNA (PFK1)를 제어 하지만 그것은 또한 원하는 복구 감소 표적 mRNA PFK2 (입력의 10-15%). 반대로, 생리 적인 수준 (150 m m NaCl) 염 농도의 증가 PFK2 mRNAs의 복구와 아소 PFK2-2, PFK1 컨트롤의 초과 75%까지 증가 하 여 mRNA 적어도 5 (그림 2A). 추가 메모의 다른 ASOs mRNA의 중대 한 변이 대상 캡처 신진대사에서 보였다 생리 소금 농도, ASOs. 의 경험적 검증에 대 한 필요성을 강조 워시 버퍼의 온도 의존 mRNA 복구의 cep-1 C. 선 충과 효 RPS20 mRNAs 각각 ASOs (표 1)를 사용 하 여 exemplified입니다. 우리는 최적의 세척 온도 50 ° C와 분명 관련이 없는 mRNAs와 mRNAs 대상 (그림 2B)의 효율적인 복구 낮은 배경에서 55 ° C 사이 했다 관찰 했다. 이 시점에서, 우리는 십자가-교 잡의 ASOs의 다른 mRNAs와 가능성을 강조 하고자 합니다. 예를 들어 DNM1 아소 DNM1 코딩 시퀀스 내에서 시퀀스를 완벽 하 게 보완 이지만 그것은 또한 부분적으로 ACT1 mRNA와 anneals. DNM1 ASOs 간 교 잡 (그림 2C)에 대 한 강한 성향을 보여주는 세척 온도 관계 없이 모두 mRNAs 복구. 마지막으로, 우리는 위의 설명된 테스트 사용 하 고 최적화 선택에서 각각 대상 mRNAs의 복구에 적합 했던 3 ASOs를 총 RNA S. cerevisiae, C. 선 충 및 인간의 세포 (그림 2D에서 격리 ).
적당 한 ASOs 생체 외에서 의 초기 선택 후 우리 셀 추출 물 자외선 가교 된 생물/셀 (그림 1)에서 얻은 여행을 수행. 특히, 우리는 3 개의 다른 유기 체에서 3 개의 다른 mRNAs의 복구 테스트: 효 모 S. cerevisiae, cep 1 C. 선 충, 선 충 및 기자에서에서 PFK2 mRNA mRNA (pGL3-CDKN1B-3'UTR) 3' UTR 베어링 인간 CDKN1B/p27 mRNA 순서 인간 HEK293 세포에서 과도 식 luciferase (루크) 기자에 게 융합. RNA 격리의 특이성을 제어 하려면 모니터링 하는 여러 관련 없는 mRNAs의 복구 하 고 우리는 펜 실바 니 아 셀 추출 물에 oligo(dT)25에 세포 mRNAs의 바인딩으로 경쟁의 과잉의 추가 의해 경쟁 실험 수행 는 첫 번째 단계 정화 단계 동안 구슬. 이전 비 가교 된 총 RNA 샘플 (그림 2), RT-PCR 확인 본 각 mRNAs의 농축 대상 mRNA 여행 동안, 여러 비 관련 제어 mRNAs 농축 되지 했다 반면 (그림 3A). 또한, 어느 mRNAs ASOs, 불특정 바인딩 방지 하는 적절 한 차단 절차를 나타내는 없이 구슬에 감지 했다. 이 줄에 무관/발진 ASOs 또한 사용할 수 있습니다 제어, 특정 mRNAs와 바운드 단백질의 유추 캡처 간 교 잡에 대 한 잠재적인 다음 고려 되어야 하는. 이후 최종 eluate에 단백질은 스테인드 polyacrylamide 젤 (데이터 표시 되지 않음)에 거의 구상 될 수, 이전에 알려진된 mRNA 상호 작용 단백질의 존재는 더 immunoblot 분석에 의해 평가 됩니다. S. cerevisiae, 리보솜 독립적인 방식으로12; PFK2 mRNA를 선택적으로 묶는에서 Pfk2p 포함 C. 선 충 GLD-1, 3 ' UTR cep 1 의 시퀀스는 정식 RBP mRNA 변환 규칙43; 그리고 허는 RBP mRNA 안정성 및 p27/CDKN1B mRNA44의 번역. 예상 대로,이 단백질의 모든 서쪽 오 점 분석 (그림 3B)에 의해 각각 mRNAs의 여행 있다에서 확인 되었다.
<img alt="Figure 1" class="xfigimg" src="/files/ftp_upload/58223/58223fig1.jpg"> 그림 1입니다. 여행의 도식 대표. 단백질은 RNA에 vivo에서 UV 방사선에 의해 가교 된. (밝은 녹색 상자) 첫 번째 단계에서 많은 RNA-단백질 복합물 oligo(dT)25 구슬 언바운드 단백질 제거 하려면 엄격한 세척 조건 적용 복구 됩니다. 두 번째 단계 (핑크 상자)에서 대상 mRNP는 뽑아-아웃 biotinylated 센스 RNA oligonucleotides와 streptavidin 구슬. 순화 mRNPs 다음 RT-PCR 및 immunoblot/질량 분석 (MS) RNAs 단백질 각각의 관심, mRNA와 상호 작용을 식별 하 여 분석 된다. 그림은 권한이 있는 이전 게시37 에서 수정 되었습니다. <a href="https://www.jove.com/files/ftp_upload/58223/58223fig1large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭 하십시오.</a>
<img alt="Figure 2" class="xfigimg" src="/files/ftp_upload/58223/58223fig2.jpg"> 그림 2입니다. 비 가교 화 셀/유기 체를 사용 하 여 전체 RNA에서 선택 된 mRNAs의 절연 antisense RNA 캡처 프로브 수정. (A) 효 모 PFK2 mRNA ASOs와의 캡처 효율성에 소금 농도의 영향. 효 모 세포에서 총 RNA 표시 ASOs와 결합 되었고 55 ° c.에 지정 된 소금 (NaCl) 농도 포함 하는 버퍼와 세척 그린, 블루와 오렌지 라인 대표37RT-PCR 의해 결정으로 다른 ASOs PFK2 mRNA 복구: PFK2 1 , PFK2-2에는 3' UTR, CD에서 PFK2 4 anneal. PFK1 는 부정적인 mRNA를 제어. PCR 32 증폭 사이클 수행 하 고 앞에서 설명한37로 계량 했다. C. eleganscep-1 및 효 모 RPS20 아소의 (B) 일부 다른 세척 온도, 검정과 빨강 라인에 각각 표현에서 mRNAs 바인딩됩니다. C. eleganspgk-1 및 효 모 ACT1 비 대상 (제어) mRNAs는. 30과 32 PCR 주기는 각각 효 모와 선 충 C. mRNAs의 검출에 대 한 적용 했다. (C) DNM1 ACT1 mRNA와 (빨간) 시퀀스는 DNM1 mRNA로 잠재적인 간 교 잡에 아소의 교 잡의 도식 대표는 왼쪽에 표시 됩니다. 효 모 DNM1 및 ACT1 mRNAs 구슬에서 eluted의 검출을 위한 RT-PCR 반응 (30 주기)에서 제품을 보여주는 agarose 젤 오른쪽에 표시 됩니다. 입력, 총 RNA; Sn, ASOs;를 가진 외피 후 상쾌한 E, 구슬에서 세척에서 있다 표시 온도 이전 차입 (40 ° C, 50 ° C와 60 ° C). 제어 실험 (Ctrl) 아소를 추가 하지 않고 동시에 수행 되었다. (D) Agarose 젤 (오른쪽) 효 모 S. cerevisiae, C. 선 충, 그리고 인간의 HEK293 세포 (H. sapiens)의 총 RNA에서 캡처한 mRNAs의 검출을 위한 RT-PCR 제품을 보여주는. 입력, 총 RNA; Sn, 표면에 뜨는; E, 구슬에서 있다입니다. PCR 효 모 mRNAs에 대 한 30 확대 주기, C. 선 충 mRNAs 32 사이클에 의해 수행 됐다 고 28 및 30 각각 인간의 tubulin p27 mRNAs를 주기. 그림은 권한이 있는 이전 게시37 에서 수정 되었습니다. <a href="https://www.jove.com/files/ftp_upload/58223/58223fig2large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭 하십시오.</a>
<img alt="Figure 3" class="xfigimg" src="/files/ftp_upload/58223/58223fig3.jpg"> 그림 3입니다. 여행과 자외선 가교 된 셀에서 파생 된 추출 물에서 특정 mRNA 단백질 복합물의 캡처. (A) Agarose 젤 oligo(dT)와 S. cerevisiae, C. 선 충 그리고 인간 (H. sapiens) 셀 추출 물에서 나타난된 ASOs 캡처 시 RT-PCR와 (오른쪽) mRNAs의 검출에 대 한. 입력, 가교 화 셀/유기 체;에서 총 RNA Ctrl 키, 아소 없이 제어입니다. 많은, 많은 경쟁 RT-PCR은 35 증폭 사이클 설명된37 로 뤽에 대 한 p27, 32 주기 그리고 수행 29 tubulin위해 사이클. (B) 표시 된 항 체 (오른쪽)와 mRNA-바인딩 단백질의 Immunoblot 분석. 로드 된 분수는 다음과 같습니다: 0.1%, 2.5% 1% 효 모, 선 충 및 인간의 입력; 10%, 10%, 5% 효 모, 선 충 및 인간 oligo(dT) 차선; 그리고 모든 ASOs 차선 66%입니다. 분자 무게 (MW) kilodaltons (kDa)에 표시 됩니다. 그림 허가37와 게시입니다. <a href="https://www.jove.com/files/ftp_upload/58223/58223fig3large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭 하십시오.</a>
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody>
<tr>
<td>뇌관 이름</td>
			<td colspan="2">시퀀스</td>
			<td>대상</td>
			<td>크기</td>
		</tr>
<tr>
<td>Pfk2_Fwd</td>
			<td colspan="2">GTGTTAAGGGTTCACATGTCG</td>
			<td>PFK2 S. cerevisiae</td>
			<td>133 혈압</td>
		</tr>
<tr>
<td>Pfk2_Rev</td>
			<td colspan="2">CTTCCAACCAAATGGTCAGC</td>
			<td>PFK2 S. cerevisiae</td>
			<td>133 혈압</td>
		</tr>
<tr>
<td>Pfk1_Fwd</td>
			<td colspan="2">GGTGATTCTCCAGGTATGAATG</td>
			<td>PFK1 S. cerevisiae</td>
			<td>97 혈압</td>
		</tr>
<tr>
<td>Pfk1_Rev</td>
			<td colspan="2">CTTCGTAACCTTCGTAAACAGC</td>
			<td>PFK1 S. cerevisiae</td>
			<td>97 혈압</td>
		</tr>
<tr>
<td>Act1_Fwd</td>
			<td colspan="2">GTCTGGATTGGTGGTTCTATC</td>
			<td>ACT1 S. cerevisiae</td>
			<td>85 혈압</td>
		</tr>
<tr>
<td>Act1_Rev</td>
			<td colspan="2">GGACCACTTTCGTCGTATTC</td>
			<td>ACT1 S. cerevisiae</td>
			<td>85 혈압</td>
		</tr>
<tr>
<td>Dnm1_Fwd</td>
			<td colspan="2">CTGTGTTCGATGCATCAGAC</td>
			<td>DNM1 S. cerevisiae</td>
			<td>156 혈압</td>
		</tr>
<tr>
<td>Dnm1_Rev</td>
			<td colspan="2">CGCACTCCAATTCTTCTCTC</td>
			<td>DNM1 S. cerevisiae</td>
			<td>156 혈압</td>
		</tr>
<tr>
<td>Rps20_Fwd</td>
			<td colspan="2">CGCTGAACAACACAACTTGG</td>
			<td>RPS20 S. cerevisiae</td>
			<td>228 혈압</td>
		</tr>
<tr>
<td>Rps20_Rev</td>
			<td colspan="2">GGAAGCAACAACAACTTCGAC</td>
			<td>RPS20 S. cerevisiae</td>
			<td>228 혈압</td>
		</tr>
<tr>
<td>Cep1_Fwd</td>
			<td colspan="2">CGATGAAGAGAAGTCGCTGT</td>
			<td>cep-1 C. 선 충</td>
			<td>110 혈압</td>
		</tr>
<tr>
<td>Cep1_Rev</td>
			<td colspan="2">ATCTGGGAACTTTTGCTTCG</td>
			<td>cep-1 C. 선 충</td>
			<td>110 혈압</td>
		</tr>
<tr>
<td>Pgk1_Fwd</td>
			<td colspan="2">GCGATATTTATGTCAATGATGCTTTC</td>
			<td>pgk-1 C. 선 충</td>
			<td>74 혈압</td>
		</tr>
<tr>
<td>Pgk1_Rev</td>
			<td colspan="2">TGAGTGCTCGACTCCAACCA</td>
			<td>pgk-1 C. 선 충</td>
			<td>74 혈압</td>
		</tr>
<tr>
<td>Mpk1_Fwd</td>
			<td colspan="2">TGCTCAGTAATCGGCCATTG</td>
			<td>mpk-1 C. 선 충</td>
			<td>74 혈압</td>
		</tr>
<tr>
<td>Mpk1_Rev</td>
			<td colspan="2">TCCAACAACTGCCAAAATCAAA</td>
			<td>mpk-1 C. 선 충</td>
			<td>74 혈압</td>
		</tr>
<tr>
<td>p27_Fwd</td>
			<td colspan="2">TTTAAAAATACATATCGCTGACTTCATGG</td>
			<td>p27 헤 사피엔스</td>
			<td>212 혈압</td>
		</tr>
<tr>
<td>p27_Rev</td>
			<td colspan="2">CAAAGTTTATGTGCTACATAAAAGGTAAAAA</td>
			<td>p27 헤 사피엔스</td>
			<td>212 혈압</td>
		</tr>
<tr>
<td>Luc_Fwd</td>
			<td colspan="2">AATGGCTCATATCGCTCCTGGAT</td>
			<td>Luciferase P. pγralis
</td>
			<td>117 혈압</td>
		</tr>
<tr>
<td>Luc_Rev</td>
			<td colspan="2">TGGACGATGGCCTTGATCTTGTCT</td>
			<td>Luciferase P. pγralis
</td>
			<td>117 혈압</td>
		</tr>
<tr>
<td>Β-TUBULIN_Fwd</td>
			<td colspan="2">CTGAACCACCTTGTCTCAGC</td>
			<td>Β-TUBULIN 헤 사피엔스
</td>
			<td>136 혈압</td>
		</tr>
<tr>
<td>Β-TUBULIN_Rev</td>
			<td colspan="2">AGCCAGGCATAAAGAAATGG</td>
			<td>Β-TUBULIN 헤 사피엔스
</td>
			<td>136 혈압</td>
		</tr>
<tr>
<td>
PFK2-1 아소</td>
			<td colspan="2">AAUAGAAAGUGUAAUAAAAGGUCAU</td>
			<td>3' UTR PFK2 S. cerevisiae
</td>
			<td>-</td>
		</tr>
<tr>
<td>
PFK2-2 아소</td>
			<td colspan="2">GUUUCAUGGGGUAGUACUUGU</td>
			<td>3' UTR PFK2 S. cerevisiae
</td>
			<td>-</td>
		</tr>
<tr>
<td>
PFK2-4 아소</td>
			<td colspan="2">CUUGAAGAGGAGCGUUCAUA</td>
			<td>ORF PFK2 S. cerevisiae
</td>
			<td>-</td>
		</tr>
<tr>
<td>
DNM1 아소</td>
			<td colspan="2">UCGGUCAGUGGAGGUUCAGCGUUU</td>
			<td>ORF DNM1 S. cerevisiae
</td>
			<td>-</td>
		</tr>
<tr>
<td>
RPS20 아소</td>
			<td colspan="2">GUCGGUAAUAGCCUUCUCAUUCUUG</td>
			<td>ORF RPS20 S. cerevisiae
</td>
			<td>-</td>
		</tr>
<tr>
<td>
cep-1 아소</td>
			<td colspan="2">GUGAGAAAUGCGGUGCUUUGAAA</td>
			<td>3' UTR cep 1 C. 선 충
</td>
			<td>-</td>
		</tr>
<tr>
<td>
p27 아소</td>
			<td colspan="2">UCAUACCCCGCUCCACGUCAGUU</td>
			<td>3' UTR p27 헤 사피엔스
</td>
			<td>-</td>
		</tr>
</tbody></table>표 1입니다. Oligonucleotide 시퀀스. PCR 뇌관 및 ASOs 확대 후이 일, 뇌관 순서, 유전자 대상 및 예상된 조각 크기에 사용의 목록입니다.

Watch this Scientific Journal Video about An Oligonucleotide-based Tandem RNA Isolation Procedure to Recover Eukaryotic mRNA-Protein Complexes at JoVE.com

An Oligonucleotide-based Tandem RNA Isolation Procedure to Recover Eukaryotic mRNA-Protein Complexes

진 핵 세포 mRNA 단백질 복합물을 복구 하는 Oligonucleotide 기반 협동 RNA 격리 절차

Endogenously 구성 된 mRNA 단백질 복합물의 복구에 대 한 협동 RNA 격리 절차 (여행) 설명 되어 있습니다. 특히, RNA-단백질 복합물 가교 된에서 vivo에서, polyadenylated RNAs는 격리 oligo(dT) 구슬, 추출 물 이며 특정 한 mRNAs와 수정 된 RNA 센스 oligonucleotides 캡처됩니다. 단백질 mRNAs에 바인딩된 immunoblot 분석에 의해 검색 됩니다.

RNA-binding proteins (RBPs) play key roles in the post-transcriptional control of gene expression. Therefore, biochemical characterization of mRNA-protein ...

an-oligonucleotide-based-tandem-rna-isolation-procedure-to-recover

Research

JoVE Journal

Biochemistry

11.0K 조회수.  University of Surrey. Endogenously 구성 된 mRNA 단백질 복합물의 복구에 대 한 협동 RNA 격리 절차 (여행) 설명 되어 있습니다. 특히, RNA-단백질 복합물 가교 된에서 vivo에서, polyadenylated RNAs는 격리 oligo(dT) 구슬, 추출 물 이며 특정 한 mRNAs와 수정 된 RNA 센스 oligonucleotides 캡처됩니다. 단백질 mRNAs에 바인딩된 immunoblot 분석에 의해 검색 됩니다.

비디오: An Oligonucleotide-based Tandem RNA Isolation Procedure to Recover Eukaryotic mRNA-Protein Complexes

Isolation of Cognate RNA-protein Complexes from Cells Using Oligonucleotide-directed Elution

Ribonucleoprotein particles direct the biogenesis and post-transcriptional regulation of all mRNAs through distinct combinations of RNA binding proteins. They are composed of position-dependent, cis-acting RNA elements and unique combinations of RNA binding proteins. Defining the composition of a specific RNP is essential to achieving a fundamental understanding of gene regulation. The isolation of a select RNP is akin to finding a needle in a haystack. Here, we demonstrate an approach to isolate RNPs associated at the 5' untranslated region of a select mRNA in asynchronous, transfected cells. This cognate RNP has been demonstrated to be necessary for the translation of select viruses and cellular stress-response genes.
The demonstrated RNA-protein co-precipitation protocol is suitable for the downstream analysis of protein components through proteomic analyses, immunoblots, or suitable biochemical identification assays. This experimental protocol demonstrates that DHX9/RNA helicase A is enriched at the 5' terminus of cognate retroviral RNA and provides preliminary information for the identification of its association with cell stress-associated huR and junD cognate mRNAs.

This manuscript describes an approach to isolate select cognate RNPs formed in eukaryotic cells via a specific oligonucleotide-directed enrichment. We demonstrate the applicability of this approach by isolating a cognate RNP bound to the retroviral 5' untranslated region that is composed of DHX9/RNA helicase A.

올리고 뉴클레오티드 지시 용출을 사용하여 세포에서 동족 RNA 단백질 단지의 분리

Ribonucleoprotein particles direct the biogenesis and post-transcriptional regulation of all mRNAs through distinct combinations of RNA binding proteins. ...

연구

생화학

Novel RNA-Binding Proteins Isolation by the RaPID Methodology

RNA-binding proteins (RBPs) play important roles in every aspect of RNA metabolism and regulation. Their identification is a major challenge in modern biology. Only a few in vitro and in vivo methods enable the identification of RBPs associated with a particular target mRNA. However, their main limitations are the identification of RBPs in a non-cellular environment (in vitro) or the low efficiency isolation of RNA of interest (in vivo). An RNA-binding protein purification and identification (RaPID) methodology was designed to overcome these limitations in yeast and enable efficient isolation of proteins that are associated in vivo. To achieve this, the RNA of interest is tagged with MS2 loops, and co-expressed with a fusion protein of an MS2-binding protein and a streptavidin-binding protein (SBP). Cells are then subjected to crosslinking and lysed, and complexes are isolated through streptavidin beads. The proteins that co-purify with the tagged RNA can then be determined by mass spectrometry. We recently used this protocol to identify novel proteins associated with the ER-associated PMP1 mRNA. Here, we provide a detailed protocol of RaPID, and discuss some of its limitations and advantages.

RNA-protein interactions lie at the heart of many cellular processes. Here, we describe an in vivo method to isolate specific RNA and identify novel proteins that are associated with it. This could shed new light on how RNAs are regulated in the cell.

빠른 방법론에 의해 소설 RNA 결합 단백질 분리

RNA-binding proteins (RBPs) play important roles in every aspect of RNA metabolism and regulation. Their identification is a major challenge in modern ...

유전학

Tandem Affinity Purification of Protein Complexes from Eukaryotic Cells

The purification of active protein-protein and protein-nucleic acid complexes is crucial for the characterization of enzymatic activities and de novo identification of novel subunits and post-translational modifications. Bacterial systems allow for the expression and purification of a wide variety of single polypeptides and protein complexes. However, this system does not enable the purification of protein subunits that contain post-translational modifications (e.g., phosphorylation and acetylation), and the identification of novel regulatory subunits that are only present/expressed in the eukaryotic system. Here, we provide a detailed description of a novel, robust, and efficient tandem affinity purification (TAP) method using STREP- and FLAG-tagged proteins that facilitates the purification of protein complexes with transiently or stably expressed epitope-tagged proteins from eukaryotic cells. This protocol can be applied to characterize protein complex functionality, to discover post-translational modifications on complex subunits, and to identify novel regulatory complex components by mass spectrometry. Notably, this TAP method can be applied to study protein complexes formed by eukaryotic or pathogenic (viral and bacterial) components, thus yielding a wide array of downstream experimental opportunities. We propose that researchers working with protein complexes could utilize this approach in many different ways.

We describe here a novel, robust, and efficient tandem affinity purification (TAP) method for the expression, isolation, and characterization of protein complexes from eukaryotic cells. This protocol could be utilized for the biochemical characterization of discrete complexes as well as the identification of novel interactors and post-translational modifications that regulate their function.

진핵 세포에서 단백질 복합체의 탠덤 선호도 정화

The purification of active protein-protein and protein-nucleic acid complexes is crucial for the characterization of enzymatic activities and de novo ...

RNA Pull-down Procedure to Identify RNA Targets of a Long Non-coding RNA

Long non-coding RNA (lncRNA), which are sequences of more than 200 nucleotides without a defined reading frame, belong to the regulatory non-coding RNA&#39;s family. Although their biological functions remain largely unknown, the number of these lncRNAs has steadily increased and it is now estimated that humans may have more than 10,000 such transcripts. Some of these are known to be involved in important regulatory pathways of gene expression which take place at the transcriptional level, but also at different steps of RNA co- and post-transcriptional maturation. In the latter cases, RNAs that are targeted by the lncRNA have to be identified. That&#39;s the reason why it is useful to develop a method enabling the identification of RNAs associated directly or indirectly with a lncRNA of interest.
This protocol, which was inspired by previously published protocols allowing the isolation of a lncRNA together with its associated chromatin sequences, was adapted to permit the isolation of associated RNAs. We determined that two steps are critical for the efficiency of this protocol. The first is the design of specific anti-sense DNA oligonucleotide probes able to hybridize to the lncRNA of interest. To this end, the lncRNA secondary structure was predicted by bioinformatics and anti-sense oligonucleotide probes were designed with a strong affinity for regions that display a low probability of internal base pairing. The second crucial step of the procedure relies on the fixative conditions of the tissue or cultured cells that have to preserve the network between all molecular partners. Coupled with high throughput RNA sequencing, this RNA pull-down protocol can provide the whole RNA interactome of a lncRNA of interest.

This RNA pull-down method allows identifying the RNA targets of a long non-coding RNA (lncRNA). Based on the hybridization of home-made, designed anti-sense DNA oligonucleotide probes specific to this lncRNA in an appropriately fixed tissue or cell line, it efficiently allows the capture of all RNA targets of the lncRNA.

오래 비 코딩 RNA의 RNA 표적 식별에 RNA 풀 다운 절차

Long non-coding RNA (lncRNA), which are sequences of more than 200 nucleotides without a defined reading frame, belong to the regulatory non-coding ...

Artificial RNA Polymerase II Elongation Complexes for Dissecting Co-transcriptional RNA Processing Events

Eukaryotic mRNA synthesis is a complex biochemical process requiring transcription of a DNA template into a precursor RNA by the multi-subunit enzyme RNA polymerase II and co-transcriptional capping and splicing of the precursor RNA to form the mature mRNA. During mRNA synthesis, the RNA polymerase II elongation complex is a target for regulation by a large collection of transcription factors that control its catalytic activity, as well as the capping, splicing, and 3&#8217;-processing enzymes that create the mature mRNA. Because of the inherent complexity of mRNA synthesis, simpler experimental systems enabling isolation and investigation of its various co-transcriptional stages have great utility.
In this article, we describe one such simple experimental system suitable for investigating co-transcriptional RNA capping. This system relies on defined RNA polymerase II elongation complexes assembled from purified polymerase and artificial transcription bubbles. When immobilized via biotinylated DNA, these RNA polymerase II elongation complexes provide an easily manipulable tool for dissecting co-transcriptional RNA capping and mechanisms by which the elongation complex recruits and regulates capping enzyme during co-transcriptional RNA capping. We anticipate this system could be adapted for studying recruitment and/or assembly of proteins or protein complexes with roles in other stages of mRNA maturation coupled to the RNA polymerase II elongation complex.

Here, we describe the assembly of RNA polymerase II (Pol II) elongation complexes requiring only short synthetic DNA and RNA oligonucleotides and purified Pol II. These complexes are useful for studying mechanisms underlying co-transcriptional processing of transcripts associated with the Pol II elongation complex.

인공 RNA 폴리머라제 II 연신복합체 해부 공동 전사 RNA 처리 이벤트

Eukaryotic mRNA synthesis is a complex biochemical process requiring transcription of a DNA template into a precursor RNA by the multi-subunit enzyme RNA ...

Translating Ribosome Affinity Purification (TRAP) for RNA Isolation from Endothelial Cells In Vivo

Many studies have been limited to using in vitro cellular assays and whole tissues or isolating of specific cell types from animals for in vitro analysis of transcriptome and gene expression by qPCR and RNA sequencing. Comprehensive transcriptome and gene expression analysis of specific cell types in complex tissues and organs will be critical to understand cellular and molecular mechanisms by which genes are regulated and their association with tissue homeostasis and organ functions. In this article, we demonstrate the methodology for isolation of ribosome-bound RNA directly in vivo in the vascular endothelia of animal lungs as an example. The specific materials and procedures for tissue processing and RNA purification will be described, including the assessment of RNA quality and yield as well as real time qPCR for arteriogenic gene assays. This approach, known as translating ribosome affinity purification (TRAP) technique, can be utilized for characterization of gene expression and transcriptome analysis of certain cell types directly in vivo in any specific type in complex tissues.

Translating Ribosome Affinity Purification TRAP for RNA Isolation from Endothelial Cells In Vivo

We present an approach to purify ribosome-bound mRNA from vascular endothelial cells (ECs) directly in mouse brain, lung and heart tissues via EC-specific genetic tag of enhanced green fluorescence protein (EGFP)in ribosomes in combination with RNA purification.

생체 내피 세포에서 RNA 격리를 위한 리보솜 친화성 정제(TRAP) 번역

Many studies have been limited to using in vitro cellular assays and whole tissues or isolating of specific cell types from animals for in vitro analysis ...

A Rapid High-throughput Method for Mapping Ribonucleoproteins (RNPs) on Human pre-mRNA

Sequencing RNAs that co-immunoprecipitate (co-IP) with RNA binding proteins has increased our understanding of splicing by demonstrating that binding location often influences function of a splicing factor.  However, as with any sampling strategy the chance of identifying an RNA bound to a splicing factor is proportional to its cellular abundance.  We have developed a novel in vitro approach for surveying binding specificity on otherwise transient pre-mRNA. This approach utilizes a specifically designed oligonucleotide pool that tiles across introns, exons, splice junctions, or other pre-mRNA.  The pool is subjected to some kind of molecular selection. Here, we demonstrate the method by separating the oligonucleotide into a bound and unbound fraction and utilize a two color array strategy to record the enrichment of each oligonucleotide in the bound fraction. The array data generates high-resolution maps with the ability to identify sequence-specific and structural determinates of ribonucleoprotein (RNP) binding on pre-mRNA.  A unique advantage to this method is its ability to avoid the sampling bias towards mRNA associated with current IP and SELEX techniques, as the pool is specifically designed and synthesized from pre-mRNA sequence. The flexibility of the oligonucleotide pool is another advantage since the experimenter chooses which regions to study and tile across, tailoring the pool to their individual needs.  Using this technique, one can assay the effects of polymorphisms or mutations on binding on a large scale or clone the library into a functional splicing reporter and identify oligonucleotides that are enriched in the included fraction.  This novel in vitro high-resolution mapping scheme provides a unique way to study RNP interactions with transient pre-mRNA species, whose low abundance makes them difficult to study with current in vivo techniques.  



A Rapid High-throughput Method for Mapping Ribonucleoproteins RNPs on Human pre-mRNA

Due to the transient nature of pre-mRNA, it can be difficult to isolate and study in vivo. Here, we present a novel in vitro approach to investigate RNA-protein interactions using a synthetic oligo pool that tiles across selected regions of pre-mRNA.

인간 사전 mRNA에 매핑 Ribonucleoproteins에 대한 신속한 하이 스루풋 방법 (RNPs)

Sequencing RNAs that co-immunoprecipitate (co-IP) with RNA binding proteins has increased our understanding of splicing by demonstrating that binding ...

생물학

Isolation of Translating Ribosomes Containing Peptidyl-tRNAs for Functional and Structural Analyses

Recently, structural and biochemical studies have detailed many of the molecular events that occur in the ribosome during inhibition of protein synthesis by antibiotics and during nascent polypeptide synthesis. Some of these antibiotics, and regulatory nascent polypeptides mostly in the form of peptidyl-tRNAs, inhibit either peptide bond formation or translation termination1-7. These inhibitory events can stop the movement of the ribosome, a phenomenon termed "translational arrest". Translation arrest induced by either an antibiotic or a nascent polypeptide has been shown to regulate the expression of genes involved in diverse cellular functions such as cell growth, antibiotic resistance, protein translocation and cell metabolism8-13. Knowledge of how antibiotics and regulatory nascent polypeptides alter ribosome function is essential if we are to understand the complete role of the ribosome in translation, in every organism.
Here, we describe a simple methodology that can be used to purify, exclusively, for analysis, those ribosomes translating a specific mRNA and containing a specific peptidyl-tRNA14. This procedure is based on selective isolation of translating ribosomes bound to a biotin-labeled mRNA. These translational complexes are separated from other ribosomes in the same mixture, using streptavidin paramagnetic beads (SMB) and a magnetic field (MF). Biotin-labeled mRNAs are synthesized by run-off transcription assays using as templates PCR-generated DNA fragments that contain T7 transcriptional promoters. T7 RNA polymerase incorporates biotin-16-UMP from biotin-UTP; under our conditions approximately ten biotin-16-UMP molecules are incorporated in a 600 nt mRNA with a 25% UMP content. These biotin-labeled mRNAs are then isolated, and used in in vitro translation assays performed with release factor 2 (RF2)-depleted cell-free extracts obtained from Escherichia coli strains containing wild type or mutant ribosomes. Ribosomes translating the biotin-labeled mRNA sequences are stalled at the stop codon region, due to the absence of the RF2 protein, which normally accomplishes translation termination. Stalled ribosomes containing the newly synthesized peptidyl-tRNA are isolated and removed from the translation reactions using SMB and an MF. These beads only bind biotin-containing messages.
The isolated, translational complexes, can be used to analyze the structural and functional features of wild type or mutant ribosomal components, or peptidyl-tRNA sequences, as well as determining ribosome interaction with antibiotics or other molecular factors 1,14-16. To examine the function of these isolated ribosome complexes, peptidyl-transferase assays can be performed in the presence of the antibiotic puromycin1. To study structural changes in translational complexes, well established procedures can be used, such as i) crosslinking to specific amino acids14 and/or ii) alkylation protection assays1,14,17.

A major impediment to biochemical analyses of ribosomes containing nascent peptidyl-tRNAs has been the presence of other ribosomes in the same samples, ribosomes not involved in the translation of the specific mRNA sequence being analyzed. We developed a simple methodology to purify, exclusively, the ribosomes containing the nascent peptidyl-tRNA of interest.

기능 및 구조 분석을위한 Peptidyl - tRNAs를 포함 번역 리보솜의 분리

Recently, structural and biochemical studies have detailed many of the molecular events that occur in the ribosome during inhibition of protein synthesis ...

Method for the Isolation and Identification of mRNAs, microRNAs and Protein Components of Ribonucleoprotein Complexes from Cell Extracts using RIP-Chip

As a result of the development of high-throughput sequencing and efficient microarray analysis, global gene expression analysis has become an easy and readily available form of data collection. In many research and disease models however, steady state levels of target gene mRNA does not always directly correlate with steady state protein levels. Post-transcriptional gene regulation is a likely explanation of the divergence between the two. Driven by the binding of RNA Binding Proteins (RBP), post-transcriptional regulation affects mRNA localization, stability and translation by forming a Ribonucleoprotein (RNP) complex with target mRNAs. Identifying these unknown de novo mRNA targets from cellular extracts in the RNP complex is pivotal to understanding mechanisms and functions of the RBP and their resulting effect on protein output. This protocol outlines a method termed RNP immunoprecipitation-microarray (RIP-Chip), which allows for the identification of specific mRNAs associated in the ribonucleoprotein complex, under changing experimental conditions, along with options to further optimize an experiment for the individual researcher. With this important experimental tool, researchers can explore the intricate mechanisms associated with post-transcriptional gene regulation as well as other ribonucleoprotein interactions.

A step by step protocol to isolating and identifying RNA associated complexes through RIP-Chip.

RIP 칩을 사용하여 세포 추출물에서 mRNAs, microRNAs 및 Ribonucleoprotein 단지의 단백질 구성 요소의 분리 및 확인에 방법

As a result of the development of high-throughput sequencing and efficient microarray analysis, global gene expression analysis has become an easy and ...

Isolation of mRNAs Associated with Yeast Mitochondria to Study Mechanisms of Localized Translation

Most of mitochondrial proteins are encoded in the nucleus and need to be imported into the organelle. Import may occur while the protein is synthesized near the mitochondria. Support for this possibility is derived from recent studies, in which many mRNAs encoding mitochondrial proteins were shown to be localized to the mitochondria vicinity. Together with earlier demonstrations of ribosomes&#8217; association with the outer membrane, these results suggest a localized translation process. Such localized translation may improve import efficiency, provide unique regulation sites and minimize cases of ectopic expression. Diverse methods have been used to characterize the factors and elements that mediate localized translation. Standard among these is subcellular fractionation by differential centrifugation. This protocol has the advantage of isolation of mRNAs, ribosomes and proteins in a single procedure. These can then be characterized by various molecular and biochemical methods. Furthermore, transcriptomics and proteomics methods can be applied to the resulting material, thereby allow genome-wide insights. The utilization of yeast as a model organism for such studies has the advantages of speed, costs and simplicity. Furthermore, the advanced genetic tools and available deletion strains facilitate verification of candidate factors.

Many mRNAs encoding mitochondrial proteins are associated with the mitochondria outer membrane. We describe a subcellular fractionation procedure aimed at isolation of yeast mitochondria with its associated mRNAs and ribosomes. This protocol can be applied to cells grown under diverse conditions&#160;in order to reveal mechanisms of mRNA localization and localized translation near the mitochondria.

현지화 번역의 메커니즘을 연구하는 효모 미토콘드리아와의 mRNA 관련의 분리

Most of mitochondrial proteins are encoded in the nucleus and need to be imported into the organelle. Import may occur while the protein is synthesized ...