우리는 도구를 개발하고 공유했으며 이 원고에 인용된 C. elegans 커뮤니티의 연구실에 감사드립니다. 일부 균주는 NIH Office of Research Infrastructure Programs(P40 OD010440)에서 자금을 지원하는 CGC에 의해 제공되었습니다. 이 연구는 A.L.S.(PJT-175245)에 대한 캐나다 보건 연구소(CIHR) 프로젝트 보조금의 지원을 받았습니다. CL은 캐나다 자연 과학 및 공학 연구 위원회(NSERC) 대학원 장학금(PGS-D)의 지원을 받습니다.

예쁜꼬마선충(Caenorhabditis elegans)의 후성유전학적 유전과 ChIP

<ol>
	<li>Alcazar, R. M., Lin, R., Fire, A. Z. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transmission+dynamics+of+heritable+silencing+induced+by+double-stranded+RNA+in+Caenorhabditis+elegans.">Transmission dynamics of heritable silencing induced by double-stranded RNA in Caenorhabditis elegans.</a> Genetics. 180 (3), 1275-1288 (2008).</li><li>Ashe, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=piRNAs+can+trigger+a+multigenerational+epigenetic+memory+in+the+germline+of+C.+elegans.">piRNAs can trigger a multigenerational epigenetic memory in the germline of C. elegans.</a> Cell. 150 (1), 88-99 (2012).</li><li>Buckley, B. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+nuclear+Argonaute+promotes+multigenerational+epigenetic+inheritance+and+germline+immortality.">A nuclear Argonaute promotes multigenerational epigenetic inheritance and germline immortality.</a> Nature. 489 (7416), 447-451 (2012).</li><li>Vastenhouw, N. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Long-term+gene+silencing+by+RNAi.">Long-term gene silencing by RNAi.</a> Nature. 442 (7105), 882 (2006).</li><li>Lee, H. -. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=C.+elegans+piRNAs+mediate+the+genome-wide+surveillance+of+germline+transcripts.">C. elegans piRNAs mediate the genome-wide surveillance of germline transcripts.</a> Cell. 150 (1), 78-87 (2012).</li><li>Luteijn, M. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Extremely+stable+Piwi-induced+gene+silencing+in+Caenorhabditis+elegans.">Extremely stable Piwi-induced gene silencing in Caenorhabditis elegans.</a> The EMBO Journal. 31 (16), 3422-3430 (2012).</li><li>Sapetschnig, A., Sarkies, P., Lehrbach, N. J., Miska, E. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Tertiary+siRNAs+mediate+paramutation+in+C.+elegans.">Tertiary siRNAs mediate paramutation in C. elegans.</a> PLoS Genetics. 11 (3), e1005078 (2015).</li><li>Shirayama, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=piRNAs+initiate+an+epigenetic+memory+of+nonself+RNA+in+the+C.+elegans+germline.">piRNAs initiate an epigenetic memory of nonself RNA in the C. elegans germline.</a> Cell. 150 (1), 65-77 (2012).</li><li>Minkina, O., Hunter, C. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Stable+heritable+germline+silencing+directs+somatic+silencing+at+an+endogenous+locus.">Stable heritable germline silencing directs somatic silencing at an endogenous locus.</a> Molecular Cell. 65 (4), 659-670 (2017).</li><li>Seroussi, U., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mechanisms+of+epigenetic+regulation+by+C.+elegans+nuclear+RNA+interference+pathways.">Mechanisms of epigenetic regulation by C. elegans nuclear RNA interference pathways.</a> Seminars in Cell &amp; Developmental Biology. 127, 142-154 (2022).</li><li>Lev, I., Gingold, H., Rechavi, O. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=H3K9me3+is+required+for+inheritance+of+small+RNAs+that+target+a+unique+subset+of+newly+evolved+genes.">H3K9me3 is required for inheritance of small RNAs that target a unique subset of newly evolved genes.</a> eLife. 8, e40448 (2019).</li><li>Woodhouse, R. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Chromatin+modifiers+SET-25+and+SET-32+are+required+for+establishment+but+not+long-term+maintenance+of+transgenerational+epigenetic+inheritance.">Chromatin modifiers SET-25 and SET-32 are required for establishment but not long-term maintenance of transgenerational epigenetic inheritance.</a> Cell Reports. 25 (8), 2259-2272 (2018).</li><li>Houri-Zeevi, L., Teichman, G., Gingold, H., Rechavi, O. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Stress+resets+ancestral+heritable+small+RNA+responses.">Stress resets ancestral heritable small RNA responses.</a> eLife. 10, e65797 (2021).</li><li>Houri-Ze'evi, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+tunable+mechanism+determines+the+duration+of+the+transgenerational+small+RNA+inheritance+in+C.+elegans.">A tunable mechanism determines the duration of the transgenerational small RNA inheritance in C. elegans.</a> Cell. 165 (1), 88-99 (2016).</li><li>Spracklin, G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+RNAi+inheritance+machinery+of+Caenorhabditis+elegans.">The RNAi inheritance machinery of Caenorhabditis elegans.</a> Genetics. 206 (3), 1403-1416 (2017).</li><li>Perales, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transgenerational+epigenetic+inheritance+is+negatively+regulated+by+the+HERI-1+chromodomain+protein.">Transgenerational epigenetic inheritance is negatively regulated by the HERI-1 chromodomain protein.</a> Genetics. 210 (4), 1287-1299 (2018).</li><li>Shukla, A., Perales, R., Kennedy, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=piRNAs+coordinate+poly(UG)+tailing+to+prevent+aberrant+and+perpetual+gene+silencing.">piRNAs coordinate poly(UG) tailing to prevent aberrant and perpetual gene silencing.</a> Current Biology. 31 (20), 4473-4485 (2021).</li><li>Ahringer, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Reverse+GeneticsWormBook:+the+Online+Review+of+C.+elegans+Biology.">Reverse GeneticsWormBook: the Online Review of C. elegans Biology.</a> WormBook. , (2006).</li><li>Rivera Gomez, K., Schvarzstein, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Immobilization+of+nematodes+for+live+imaging+using+an+agarose+pad+produced+with+a+Vinyl+Record.">Immobilization of nematodes for live imaging using an agarose pad produced with a Vinyl Record.</a> microPublication Biology. 2018, (2018).</li><li>Stiernagle, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Maintenance+of+C.+elegans.">Maintenance of C. elegans.</a> WormBook: The Online Review of C. Elegans Biology. , 1-11 (2006).</li><li>Askjaer, P., Ercan, S., Meister, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Modern+techniques+for+the+analysis+of+chromatin+and+nuclear+organization+in+C.+elegans.">Modern techniques for the analysis of chromatin and nuclear organization in C. elegans.</a> WormBook: the Online Review of C. elegans Biology. , 1-35 (2014).</li><li>Gu, S. G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Amplification+of+siRNA+in+Caenorhabditis+elegans+generates+a+transgenerational+sequence-targeted+histone+H3+lysine+9+methylation+footprint.">Amplification of siRNA in Caenorhabditis elegans generates a transgenerational sequence-targeted histone H3 lysine 9 methylation footprint.</a> Nature Genetics. 44 (2), 157-164 (2012).</li><li>Kalinava, N., Ni, J. Z., Peterman, K., Chen, E., Gu, S. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Decoupling+the+downstream+effects+of+germline+nuclear+RNAi+reveals+that+H3K9me3+is+dispensable+for+heritable+RNAi+and+the+maintenance+of+endogenous+siRNA-mediated+transcriptional+silencing+in+Caenorhabditis+elegans.">Decoupling the downstream effects of germline nuclear RNAi reveals that H3K9me3 is dispensable for heritable RNAi and the maintenance of endogenous siRNA-mediated transcriptional silencing in Caenorhabditis elegans.</a> Epigenetics &amp; Chromatin. 10, 6 (2017).</li><li>Kalinava, N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=elegans+heterochromatin+factor+SET-32+plays+an+essential+role+in+transgenerational+establishment+of+nuclear+RNAi-mediated+epigenetic+silencing.">elegans heterochromatin factor SET-32 plays an essential role in transgenerational establishment of nuclear RNAi-mediated epigenetic silencing.</a> Cell Reports. 25 (8), 2273-2284 (2018).</li><li>Lev, I., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=MET-2-dependent+H3K9+methylation+suppresses+transgenerational+small+RNA+inheritance.">MET-2-dependent H3K9 methylation suppresses transgenerational small RNA inheritance.</a> Current Biology. 27 (8), 1138-1147 (2017).</li><li>Kamath, R. S., Martinez-Campos, M., Zipperlen, P., Fraser, A. G., Ahringer, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Effectiveness+of+specific+RNA-mediated+interference+through+ingested+double-stranded+RNA+in+Caenorhabditis+elegans.">Effectiveness of specific RNA-mediated interference through ingested double-stranded RNA in Caenorhabditis elegans.</a> Genome Biology. 2 (1), (2001).</li><li>Xu, F., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+cytoplasmic+Argonaute+protein+promotes+the+inheritance+of+RNAi.">A cytoplasmic Argonaute protein promotes the inheritance of RNAi.</a> Cell Reports. 23 (8), 2482-2494 (2018).</li><li>Grishok, A., Tabara, H., Mello, C. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genetic+requirements+for+inheritance+of+RNAi+in+C.+elegans.">Genetic requirements for inheritance of RNAi in C. elegans.</a> Science. 287 (5462), 2494-2497 (2000).</li><li>Houri-Zeevi, L., Korem Kohanim, Y., Antonova, O., Rechavi, O. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Three+rules+explain+transgenerational+small+RNA+inheritance+in+C.+elegans.">Three rules explain transgenerational small RNA inheritance in C. elegans.</a> Cell. 182 (5), 1186-1197 (2020).</li><li>Burton, N. O., Burkhart, K. B., Kennedy, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Nuclear+RNAi+maintains+heritable+gene+silencing+in+Caenorhabditis+elegans.">Nuclear RNAi maintains heritable gene silencing in Caenorhabditis elegans.</a> Proceedings of the National Academy of Sciences. 108 (49), 19683-19688 (2011).</li><li>Mao, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+Nrde+pathway+mediates+small-RNA-directed+histone+H3+lysine+27+trimethylation+in+Caenorhabditis+elegans.">The Nrde pathway mediates small-RNA-directed histone H3 lysine 27 trimethylation in Caenorhabditis elegans.</a> Current Biology. 25 (18), 2398-2403 (2015).</li><li>Landt, S. G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=ChIP-seq+guidelines+and+practices+of+the+ENCODE+and+modENCODE+consortia.">ChIP-seq guidelines and practices of the ENCODE and modENCODE consortia.</a> Genome Research. 22 (9), 1813-1831 (2012).</li><li>Mukhopadhyay, A., Deplancke, B., Walhout, A. J. M., Tissenbaum, H. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Chromatin+immunoprecipitation+(ChIP)+coupled+to+detection+by+quantitative+real-time+PCR+to+study+transcription+factor+binding+to+DNA+in+Caenorhabditis+elegans.">Chromatin immunoprecipitation (ChIP) coupled to detection by quantitative real-time PCR to study transcription factor binding to DNA in Caenorhabditis elegans.</a> Nature Protocols. 3 (4), 698-709 (2008).</li></ol>

모든 저자는 공개할 충돌이 없음을 확인합니다.

이 프로토콜에서 dsRNA는 섭식에 의해 도입되며, 이는 예쁜꼬마선충(C. elegans) 18에서 표준 방법이 되었습니다. RNAi 유전 분석의 경우 공급 접근법은 큰 P0 집단 2,11,12,22,23,24,25를 얻는 쉬운 방법을 제공합니다. 그러나, RNAi 노출의 시기와 지속 시간은 전이유전자 침묵의 효능에 영향을 미치고(26), RNAi 박테리아의 농도는 유전성 RNAi 침묵의 지속성에 영향을 미친다1. 그러므로, 표준화된 RNAi 박테리아 및 벌레 성장은 GFP 침묵 그리고 유전의 내구의 일관된 수준을 얻게 중요합니다. 여기서 배아는 RNAi 플레이트에 도금되어 P0 동물이 부화할 때 RNAi 박테리아에 노출됩니다. 다른 접근법은 동기화된 L1 24,27 또는L4 25 단계 동물을 RNAi-NGM 플레이트에 도금하는 것입니다. 또한, 굶주림과 다른 스트레스는 RNAi 유전의 유지에 영향을 미치기 때문에(13), 식량 공급의 과밀 및 고갈을 방지하기 위해 플레이트를 모니터링해야 한다. 먹이를 주어 RNAi를 시작하는 대안으로, 선구적인 예쁜꼬마선충(C. elegans) RNAi 유전 연구 중 일부는 생식선 주입을 통해 RNAi를 유도했으며, 이는 dsRNA 농도 1,28을 더 잘 제어할 수 있습니다.
이 프로토콜에서, 각 세대는 이전에 기술된바와 같이 알칼리성 차아염소산염 처리를 가진 집단으로 통과된다 16,22,23,24. 차아염소산염 처리는 F1 세대가 부모 환경(22)으로부터 RNAi 박테리아에 오염되지 않도록 보장하고, 잠재적인 원치 않는 개체군 병목 현상을 방지한다. 그러나, 개별 동물이 뚜렷한 유전 패턴을 가질 수 있기 때문에 대량 통과 또한 한계가 될 수 있다 1,29. 각 세대를 설정하는 또 다른 방법은 개별 동물을 선택하는 것이다 1,2,9,11,25. 이 접근 방식을 사용하면 계통 내에서 표현형을 추적하고 유전적 교배를 통합할 수 있습니다. 계통 분석은 침투율이 낮은 표현형(low penetrance phenotype)에도 유리할 수있다 12.
형광 단백질 발현은 RNAi 유도 침묵 2,3,4,12,14,15,16,25,30의 강력하고 편리한 판독입니다. 이 프로토콜에 설명된 대로 GFP 표현은 ON 또는 OFF 11,12,15,16,25로 수동으로 점수를 매길 수 있습니다. 수동 채점은 정성적 강도 수준 3,4,14를 할당하여 더욱 구체화할 수 있습니다. 대안으로, 현미경 이미지(11,12,14,25,27)의 자동 강도 스코어링 또는살아있는 동물2의 유세포 분석 형광 측정은 정량적이고 처리량이 높은 판독값을 제공할 수 있다. 그러나, 보고자 발현이 생식세포에 제한되기 때문에, 자동화된 접근의 주의사항은 또한 연구가 비정상적인 생식세포 발달을 가진 돌연변이체를 통합하는 경우에 생식세포가 없는 동물에 대 침묵한 GFP 발현을 가진 동물 사이에서 분화해야 한다 이다. GFP 형광의 대안으로 역전사(RT)-qPCR을 사용하여 RNAi 표적 pre-mRNA 및 mRNA 수준 2,16,23,24를 정량화할 수 있습니다. 이 접근법은 RNA를 표적으로 하는 침묵에 대한 보다 직접적인 판독을 제공하며, 침묵이 가시적인 표현형을 생성하지 않는 다른 RNAi 표적에 특히 유용합니다. 인공 GFP 리포터 사용의 한계는 외인성 및 내인성 서열이 세대 간 RNAi11에서 차별적으로 조절된다는 것입니다. 따라서 온도에 민감한 배아 치사 대립유전자 oma-1(zu405)1,11,16,25와 같은 내인성 표적에 대한 연구는 형광 전이유전자 리포터에 대한 보완적 접근법으로 고려되어야 합니다.
RNAi 유전 분석의 맥락에서 ChIP를 분석하려면 처리와 복제를 비교해야 합니다. 첫째, 샘플 간 출발 물질의 차이를 설명하기 위해 ChIP 신호는 '입력 백분율'과 동일한 궤적에서 입력 신호로 정규화됩니다. 히스톤 H3 ChIP를 병렬로 처리하면 히스톤 변형 변경이 뉴클레오솜 밀도의 변화와 일치하는지 여부를 결정하는 데 도움이 됩니다. 또한 ChIP는 다단계 프로세스이기 때문에 효율성은 샘플마다 다를 수 있습니다. 적절한 양성 및 음성 대조군 유전자좌의 선택은 샘플과 실험 간의 신호 대 잡음비를 평가하고 비교하는 데 유용합니다. 또한 샘플 간의 비교를 용이하게 하기 위해 RNAi 표적의 ChIP DNA qPCR 임계값 주기 값은 종종 대조군 위치 3,11,15,23,30,31로 정규화됩니다. RNAi 처리의 효과를 평가하기 위해 치료 RNAi와 대조군 또는 RNAi 없음 조건에서 ChIP 신호의 비율도 비교됩니다. 현재 접근법의 한계는 ChIP가 전체 동물에서 수행되는 반면 RNAi 처리에 대한 반응은 생식세포에 고유할 수 있다는 것입니다. 이 경고를 극복하기 위한 접근 방식은 분리된 생식세포 핵을 사용하여 ChIP를 수행하는 것입니다. ChIP를 최적화하기 위한 추가적인 기술적 고려사항들 또한 다른 곳에서 광범위하게 논의되었다32,33.
전반적으로, 이 RNAi 유전 및 ChIP 프로토콜은 세대 간 후성유전학적 조절을 더 깊이 탐구하기 위해 다른 기술과 통합할 수 있는 상세하고 적응하기 쉬운 기반을 제공합니다. 예를 들어, ChIP DNA(ChIP-seq)에서 고처리량 염기서열분석 라이브러리를 구성하여 RNAi 표적에 근접한 염색질 환경과 게놈 전체 규모 모두에서 염색질 환경을 보다 자세히 볼 수 있습니다.

후성유전학적 유전은 유전자 조절 정보를 세대에 걸쳐 전달할 수 있도록 하여 부모의 환경이나 경험이 자손에게 영향을 미칠 수 있도록 합니다. 예쁜꼬마선충(C. elegans)에서, 외인성 이중 가닥 RNA(dsRNA)에 의해 시작된 생식세포 유전자 침묵은 원래 유발 요인 1,2,3,4에 노출되지 않은 자손에서 여러 세대에 걸쳐 유전될 수 있습니다. RNA 간섭(RNAi) 유전이라고 하는 이 과정은 예쁜꼬마선충(C. elegans)의 여러 관련 후성유전학적 침묵 현상 중 하나로, piRNA 개시 다세대 침묵2,5, paramutation/RNAe(RNA 유도 후성유전학적 침묵)6,7,8 및 다중 복제 배열 시작 침묵 9을 포함하며, 이는 작은 RNA 및 염색질 조절 기계에 대한 중복되지만 뚜렷한 요구 사항을 가지고 있습니다 . 예쁜꼬마선충(C. elegans) 외인성 RNAi에서 dsRNA는 표적 mRNA를 인식하기 위해 1차 아르고넛 단백질과 복합체에서 작용하는 작은 간섭 RNA(siRNA)로 처리됩니다. 이 표적화는 2차 아르고노우트와 결합하는 2차 siRNA의 증폭으로 이어져 세포질 및 핵 침묵 경로를 통해 표적 mRNA를 침묵시킵니다. 생식세포 발현 RNAi 표적의 경우, 핵 2차 Argonaute HRDE-1 및 추가 핵 RNAi 인자는 초기 전사체를 표적으로 하여 H3K9me310을 포함한 억제성 염색질 마크를 침착시키기 위해 전사 억제 및 히스톤 메틸전이효소의 모집을 초래합니다. 히스톤 H3K9me3는 RNAi 유전11,12에 의해 생식세포로 발현된 녹색 형광 단백질(GFP) 전이유전자의 유전성 침묵 확립을 촉진합니다.
이 프로토콜의 목표는 생식세포에서 GFP-히스톤 융합 단백질을 발현하는 전이유전자를 RNAi 유전을 위한 리포터로 사용하고 크로마틴 면역침전 및 정량적 중합효소 연쇄 반응(ChIP-qPCR)을 사용하여 리포터 전이유전자 자리에서 히스톤 변형의 변화를 분석하는 것입니다. 이 프로토콜은 리포터 침묵을 시작하기 위한 표준화된 플레이트 기반 RNAi 공급 접근 방식을 설명합니다. 또한 알칼리성 차아염소산염 처리('표백')를 통해 자궁 내 배아를 성체로부터 분리하여 세대 간 동물 통과에 대한 자세한 타임라인을 제공합니다. 형광 현미경 검사법과 히스톤 H3K9me3 ChIP-qPCR에 의해 집단의 하위 집합에서 GFP 침묵의 빈도를 모니터링하는 방법 및 대표 데이터도 설명되어 있습니다. 리포터 기반 RNAi 유전 분석은 후성유전학적 조절에서 유전적 및 환경적 요인의 역할을 기능적으로 해부할 수 있는 매우 다루기 쉬운 시스템을 제공하며, 이러한 리포터를 이용한 유전자 스크리닝은 2,3,15에 필요한 유전자와16,17 세대 간 후성유전학적 유전 기간을 부정적으로 조절하는 유전자를 모두 식별했습니다.

<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>Agarose</td>
			<td>Bioshop</td>
			<td>AGA002</td>
			<td></td>
		</tr>
		<tr>
			<td>Ampicillin</td>
			<td>Bioshop</td>
			<td>AMP201</td>
			<td>Make a 100 mg/mL solution in ultrapure water. Filter-sterilize and store at -20 &#176;C.</td>
		</tr>
		<tr>
			<td>Anti-H3K9me3 Rabbit Polyclonal Antibody</td>
			<td>Abcam</td>
			<td>ab8898</td>
			<td>Concentration is batch-dependent (0.9 - 1 mg/mL).</td>
		</tr>
		<tr>
			<td>Anti-Histone H3 Rabbit Polyclonal Antibody</td>
			<td>Abcam</td>
			<td>ab1791</td>
			<td>Concentration is batch-dependent (0.7 - 1 mg/mL).</td>
		</tr>
		<tr>
			<td>Bleach (6% Sodium hypochlorite)</td>
			<td>Lavo</td>
			<td>02358107</td>
			<td></td>
		</tr>
		<tr>
			<td>C. elegans strain with GFP RNAi Reporter</td>
			<td>NA</td>
			<td>SX1263</td>
			<td>Sapetschnig et al. 2015 (ref. 7). A gift from E. Miska lab, University of Cambridge.</td>
		</tr>
		<tr>
			<td>Carbenicillin</td>
			<td>BioShop</td>
			<td>CAR544</td>
			<td>Make a 25 mg/mL solution in ultrapure water. Filter-sterilize and store at -20 &#176;C.</td>
		</tr>
		<tr>
			<td>Dynabeads Protein G Magnetic Beads</td>
			<td>Invitrogen</td>
			<td>10003D</td>
			<td></td>
		</tr>
		<tr>
			<td>E. coli strain HT115(DE3)</td>
			<td>Caenorhabditis Genetics Center (CGC)</td>
			<td>HT115(DE3)</td>
			<td></td>
		</tr>
		<tr>
			<td>E. coli strain OP50-1</td>
			<td>Caenorhabditis Genetics Center (CGC)</td>
			<td>OP50-1</td>
			<td></td>
		</tr>
		<tr>
			<td>EDTA (0.5 M, pH 8.0)</td>
			<td>Invitrogen</td>
			<td>15575020</td>
			<td></td>
		</tr>
		<tr>
			<td>Fluorescence Stereoscope</td>
			<td>Zeiss</td>
			<td>Axio Zoom.V16</td>
			<td></td>
		</tr>
		<tr>
			<td>Formaldehyde (37%)</td>
			<td>Sigma</td>
			<td>F8775</td>
			<td></td>
		</tr>
		<tr>
			<td>Glycine</td>
			<td>Sigma</td>
			<td>50046</td>
			<td>Make a 1.25 M solution and store at 4 &#176;C.</td>
		</tr>
		<tr>
			<td>HEPES-KOH (1 M, pH 7.5)</td>
			<td>Teknova</td>
			<td>H1035</td>
			<td></td>
		</tr>
		<tr>
			<td>Hydrophobic Printed Slides, 10 wells</td>
			<td>VWR</td>
			<td>100488-904</td>
			<td></td>
		</tr>
		<tr>
			<td>IGEPAL CA-630 (Octylphenol ethoxylate)</td>
			<td>BioShop</td>
			<td>NON999</td>
			<td>Make a 10% (v/v) solution in ultrapure water and store at room temperature.</td>
		</tr>
		<tr>
			<td>IPTG (Isopropyl-&#946;-D-thiogalactoside)</td>
			<td>BioShop</td>
			<td>IPT001</td>
			<td>Make a 0.2 g/mL solution in ultrapure water. Filter-sterilize and store at -20 &#176;C.</td>
		</tr>
		<tr>
			<td>iTaq Universal SYBR Green Supermix</td>
			<td>Bio-Rad</td>
			<td>1725122</td>
			<td></td>
		</tr>
		<tr>
			<td>LB Agar Plates supplemented with 100 &#181;g/mL Ampicillin</td>
			<td>NA</td>
			<td>NA</td>
			<td>Standard lab recipe.</td>
		</tr>
		<tr>
			<td>Levamisole (Tetramisole hydrochloride)</td>
			<td>Sigma</td>
			<td>L9756</td>
			<td>Make a 200 mM solution in ultrapure water. Store at -20 &#176;C.</td>
		</tr>
		<tr>
			<td>LiCl (8 M)</td>
			<td>Sigma</td>
			<td>L7026</td>
			<td></td>
		</tr>
		<tr>
			<td>M9 Buffer</td>
			<td>NA</td>
			<td>NA</td>
			<td>22 mM KH2PO4, 42 mM Na2HPO4, 86 mM NaCl, 1 mM MgSO4.</td>
		</tr>
		<tr>
			<td>Magnetic Separator (1.5 mL tubes)</td>
			<td>Applied Biosystems</td>
			<td>A13346</td>
			<td></td>
		</tr>
		<tr>
			<td>Magnetic Separator (0.2 mL tubes)</td>
			<td>Permagen</td>
			<td>MSR812</td>
			<td></td>
		</tr>
		<tr>
			<td>Microscope Cover Glass</td>
			<td>Fisher Scientific</td>
			<td>12541B</td>
			<td></td>
		</tr>
		<tr>
			<td>Microscope Slide</td>
			<td>Technologist Choice</td>
			<td>LAB-037</td>
			<td></td>
		</tr>
		<tr>
			<td>NaCl (5 M)</td>
			<td>Promega</td>
			<td>V4221</td>
			<td>For ChIP buffers.</td>
		</tr>
		<tr>
			<td>NaOH&#160;</td>
			<td>Sigma</td>
			<td>S5881</td>
			<td>Make a 10 M solution and store at room temperature.</td>
		</tr>
		<tr>
			<td>NGM Plates</td>
			<td>NA</td>
			<td>NA</td>
			<td>1.7% (w/v) agar, 0.3% (w/v) NaCl, 0.25% (w/v) peptone, 1 mM CaCl2, 5 &#956;g/mL cholesterol, 25 mM Potassium phosphate pH 6.0, 1 mM MgSO4, 50 &#181;g/mL streptomycin.</td>
		</tr>
		<tr>
			<td>Normal Rabbit IgG (1 mg/mL)</td>
			<td>Cell Signaling Technology</td>
			<td>2729</td>
			<td></td>
		</tr>
		<tr>
			<td>Petri Dishes (35 mm x 10 mm)</td>
			<td>Sarstedt</td>
			<td>82.1135.500</td>
			<td></td>
		</tr>
		<tr>
			<td>Phosphate Buffered Saline (10X)</td>
			<td>Fisher BioReagents</td>
			<td>BP3991</td>
			<td></td>
		</tr>
		<tr>
			<td>Plasmid - Control RNAi&#160;</td>
			<td>Addgene</td>
			<td>L4440 (Plasmid #1654)</td>
			<td></td>
		</tr>
		<tr>
			<td>Plasmid - GFP-targetting RNAi&#160;</td>
			<td>Addgene</td>
			<td>L4417 (Plasmid #1649)</td>
			<td>Note, alternative L4440-derived plasmids targeting GFP can be used.</td>
		</tr>
		<tr>
			<td>Primer pair [-3.3 kb upstream of gfp]</td>
			<td>Integrated DNA Technologies</td>
			<td>NA</td>
			<td>F: AAACCAAAGGACGAGAGATTCA, R: GGCTCGATCAAGTAAAATTTCG</td>
		</tr>
		<tr>
			<td>Primer pair [+1.3 kb downstream of gfp]</td>
			<td>Integrated DNA Technologies</td>
			<td>NA</td>
			<td>F: TCGACCAGTTCTAAAGTCACCG, R: ACGTGCGGGATCATTTCTTACT</td>
		</tr>
		<tr>
			<td>Primer pair [clec-18]</td>
			<td>Integrated DNA Technologies</td>
			<td>NA</td>
			<td>F: TGCTCCATGACCTCAACAACA, R: AGTACAGTTCACCGATCCAGA</td>
		</tr>
		<tr>
			<td>Primer pair [gfp exon 1]</td>
			<td>Integrated DNA Technologies</td>
			<td>NA</td>
			<td>F: CTGGAGTTGTCCCAATTCTTGT, R: GGGTAAGTTTTCCGTATGTTGC</td>
		</tr>
		<tr>
			<td>Primer pair [gfp exon 4]</td>
			<td>Integrated DNA Technologies</td>
			<td>NA</td>
			<td>F: GATGGCCCTGTCCTTTTACCA, R: ATGCCATGTGTAATCCCAGCA</td>
		</tr>
		<tr>
			<td>Primer pair [hrp-2]</td>
			<td>Integrated DNA Technologies</td>
			<td>NA</td>
			<td>F: CGTCAACAGGGAGCAGCTG, R: CCTCCGAACTTTCTCTGTCCA</td>
		</tr>
		<tr>
			<td>Protease Inhibitor Cocktail Tablet</td>
			<td>Roche</td>
			<td>11836170001</td>
			<td></td>
		</tr>
		<tr>
			<td>Proteinase K&#160;</td>
			<td>Bioline</td>
			<td>BIO-37084</td>
			<td></td>
		</tr>
		<tr>
			<td>QIAquick PCR Purification Kit&#160;</td>
			<td>Qiagen</td>
			<td>28104</td>
			<td></td>
		</tr>
		<tr>
			<td>Real-Time PCR Detection System</td>
			<td>Bio-Rad</td>
			<td>CFX96&#160;</td>
			<td></td>
		</tr>
		<tr>
			<td>RNAi-NGM plates</td>
			<td>NA</td>
			<td>NA</td>
			<td>1.7% (w/v) agar, 0.3% (w/v) NaCl, 0.25% (w/v) peptone, 1 mM CaCl2, 5 &#181;g/mL cholesterol, 25 mM Potassium phosphate buffer pH 6.0, 1 mM MgSO4, 25 &#181;g/mL carbenicillin and 5 mM IPTG.</td>
		</tr>
		<tr>
			<td>RNase A</td>
			<td>Sigma</td>
			<td>R4642</td>
			<td></td>
		</tr>
		<tr>
			<td>Sarkosyl (N-Lauroylsarcosine sodium salt)</td>
			<td>Sigma</td>
			<td>L5777</td>
			<td>Make a 10% (w/v) solution and store at room temperature protected from light for a maximum of 1 month.</td>
		</tr>
		<tr>
			<td>SDS</td>
			<td>Sigma</td>
			<td>74255</td>
			<td>Make a 10% (w/v) solution and store at room temperature.</td>
		</tr>
		<tr>
			<td>Sodium deoxycholate</td>
			<td>Sigma</td>
			<td>30970</td>
			<td>Make a 5% (w/v) solution and store at room temperature protected from light for a maximum of 1 month.</td>
		</tr>
		<tr>
			<td>Sonication Tube</td>
			<td>Evergreen</td>
			<td>214-3721-010</td>
			<td></td>
		</tr>
		<tr>
			<td>Sonication Tube Cap</td>
			<td>Evergreen</td>
			<td>300-2911-020</td>
			<td></td>
		</tr>
		<tr>
			<td>Sonicator</td>
			<td>Qsonica</td>
			<td>Q800R3-110</td>
			<td></td>
		</tr>
		<tr>
			<td>Streptomycin sulfate</td>
			<td>Bioshop</td>
			<td>STP101</td>
			<td>Make a 50 mg/mL solution in ultrapure water. Filter-sterilize and store at -20 &#176;C.</td>
		</tr>
		<tr>
			<td>TAE buffer (1X)</td>
			<td>NA</td>
			<td>NA</td>
			<td>40 mM Tris, 20 mM acetate, 1 mM EDTA</td>
		</tr>
		<tr>
			<td>Tally counter clicker</td>
			<td>Uline</td>
			<td>H-7350</td>
			<td></td>
		</tr>
		<tr>
			<td>Tetracycline</td>
			<td>Bioshop</td>
			<td>TET701</td>
			<td>Make a 5 mg/mL solution in ethanol and store at -20 &#176;C.</td>
		</tr>
		<tr>
			<td>Thermomixer</td>
			<td>Eppendorf</td>
			<td>05-400-205</td>
			<td></td>
		</tr>
		<tr>
			<td>Tris-HCl (1 M, pH 8.0)</td>
			<td>Invitrogen</td>
			<td>15568025</td>
			<td></td>
		</tr>
		<tr>
			<td>Triton X-100</td>
			<td>Sigma</td>
			<td>T8787</td>
			<td>Make a 10% (v/v) solution in ultrapure water and store at room temperature.</td>
		</tr>
	</tbody>
</table>

analysis of transgenerational epigenetic inheritance in c. elegans using a fluorescent reporter and chromatin immunoprecipitation (chip)

세대 간 후성유전학적 유전(TEI)은 비코딩 RNA 및 염색질 변형과 같은 요인을 통해 게놈 염기서열을 변경하지 않고 생식세포를 통해 정보를 전달할 수 있습니다. 예쁜꼬마선충(Caenorhabditis elegans )의 RNA 간섭(RNAi) 유전 현상은 이 모델 유기체의 짧은 수명 주기, 자가 증식 및 투명성을 활용하는 TEI를 조사하는 데 효과적인 모델입니다. RNAi 유전에서 동물이 RNAi에 노출되면 표적 자리에서 유전자 침묵 및 변경된 염색질 서명이 발생하며, 이는 초기 유발 요인이 없는 상태에서 여러 세대 동안 지속됩니다. 이 프로토콜은 생식세포로 발현된 핵 녹색 형광 단백질(GFP) 리포터를 사용하여 예쁜꼬마선충(C. elegans )의 RNAi 유전 분석을 설명합니다. 리포터 침묵은 GFP를 표적으로 하는 이중 가닥 RNA를 발현하는 박테리아를 동물에게 먹이는 것으로 시작됩니다. 각 세대에서 동물은 동기화된 발달을 유지하기 위해 통과되며, 리포터 유전자 침묵은 현미경으로 결정됩니다. 선택된 세대에서, 집단은 GFP 리포터 자리에서 히스톤 변형 농축을 측정하기 위해 염색질 면역침전 (ChIP) - 정량 중합효소 연쇄 반응 (qPCR)을 위해 수집 및 처리됩니다. RNAi 유전을 연구하기 위한 이 프로토콜은 쉽게 수정될 수 있으며 다른 분석과 결합하여 작은 RNA 및 염색질 경로에서 TEI 인자를 추가로 조사할 수 있습니다.

Epigenetic inheritance allows the transmission of gene regulatory information across generations and can therefore allow the environment or experiences of parents to affect their progeny. In C. elegans, germline gene silencing initiated by exogenous double-stranded RNA (dsRNA) can be inherited for multiple generations in progeny not exposed to the original trigger1,2,3,4. This process, termed RNA interference (RNAi) inheritance, is one of several related epigenetic silencing phenomena in C. elegans, including piRNA-initiated multigenerational silencing2,5, paramutation/RNAe (RNA-induced epigenetic silencing)6,7,8, and multicopy array-initiated silencing9, which have overlapping but distinct requirements for small RNA and chromatin regulation machinery. In C. elegans exogenous RNAi, dsRNA is processed into small interfering RNAs (siRNAs) that act in a complex with primary Argonaute proteins to recognize their target mRNA. This targeting leads to the amplification of secondary siRNAs that associate with secondary Argonautes to silence target mRNA through both cytoplasmic and nuclear silencing pathways. For germline-expressed RNAi targets, the nuclear secondary Argonaute HRDE-1 and additional nuclear RNAi factors target nascent transcripts, resulting in transcriptional repression and recruitment of histone methyltransferases to deposit repressive chromatin marks, including H3K9me310. Histone H3K9me3 promotes the establishment of heritable silencing of germline-expressed green fluorescent protein (GFP) transgenes by RNAi inheritance11,12.
The goal of this protocol is to use a transgene expressing a GFP-histone fusion protein in the germline as a reporter for RNAi inheritance and to assay changes in histone modifications at the reporter transgene locus using chromatin immunoprecipitation and quantitative polymerase chain reaction (ChIP-qPCR). This protocol describes a standardized plate-based RNAi feeding approach to initiate reporter silencing. It also provides a detailed timeline for passaging animals between generations by isolating in utero embryos from gravid adults by alkaline hypochlorite treatment (&#39;bleaching&#39;). Methods and representative data for monitoring the frequency of GFP silencing in a subset of the population by fluorescence microscopy and for histone H3K9me3 ChIP-qPCR are also described. Reporter-based RNAi inheritance assays provide a highly tractable system to functionally dissect the roles of genetic and environmental factors in epigenetic regulation13,14, and genetic screens using such reporters have identified both genes that are required for2,3,15 and genes that negatively regulate16,17 the duration of transgenerational epigenetic inheritance.

저자 스포트라이트: 예쁜꼬마선충(C. elegans)의 RNAi 유전 및 ChIP 

형광 리포터 및 ChIP(Chromatin Immunoprecipitation)를 사용한 예쁜꼬마선충(C. elegans )의 세대 간 후성유전학적 유전 분석

Research in our lab examines how chromatin-associated proteins, histone modifications, and small RNA pathway factors work together in the context of development and transgenerational epigenetic inheritance. The RNA inheritance assay, using a GFP reporter, has become a very powerful tool. This protocol describes how to standardize the preparation, scoring, and passaging of worms, and the preparation of ChIP samples, which can help to generate reproducible results.One of the experimental challenges when studying germline-expressed transgenes is isolating the effects in the animal's germline. We're currently using whole animals for ChIP, but in the future we would like to develop assays to examine chromatin, specifically in the germline. Our laboratory is interested in histone methylation and proteins that recognize these marks.Going forward, we would like to investigate the interplay between these chromatin readers and small RNA pathways in the context of RNAi inheritance at transgenes and the regulation of endogenous sequences.

생식세포-발현된 GFP-히스톤 H2B [mex-5p::gfp-h2b::tbb-2 3'UTR]7 리포터(그림 2A)를 운반하는 동물은 GFP RNAi 또는 대조군 RNAi에 먹이를 줌으로써 노출시키고, 프로토콜 및 그림 1에 기술된 바와 같이 통과시켰다. 생식세포에 있는 핵 GFP 신호는 각 세대에 모집단의 표본을 위한 형광 해부 현미경을 사용하여 수동으로 점수가 매겨졌습니다. 전이유전자의 침묵은 GFP RNAi로 처리된 스코어링된 P0 및 F1 동물에서 완전히 침투하였다(도 2B). F2 세대에서 GFP 침묵의 유전을 나타내는 인구의 비율은 약 50%였습니다. F5 세대에 이르러서는 인구의 대다수가 침묵의 유전을 나타내지 않았으며, F10 세대에 이르러서는 모든 동물이 GFP를 발현했기 때문에 유전이 발견되지 않았습니다.
RNAi 유도 침묵에 해당하는 히스톤 H3K9me3 농축의 변화를 결정하기 위해 GFP RNAi 또는 대조군 RNAi 처리 후 F1 생성 동물에서 ChIP-qPCR을 수행했습니다. 예상대로, GFP RNAi 대우한 인구는 통제 RNAi 대우한 동물과 비교된 GFP 표적 그리고 1.3 kb 하류 지구에 더 높은 히스톤 H3K9me3 수준을 표시했습니다 (그림 2C). 히스톤 H3K9me3 ChIP의 특이성은 이 표지가 풍부해지는 것으로 알려진 양성 대조군 자리(clec-18)의 농축에 의해 뒷받침되지만 근처의 음성 대조군 자리(hrp-2)에서는 지지되지 않습니다. IgG 대조군 면역침전에서 히스톤 H3 농축 및 근백부 농축도 예상대로 모든 qPCR 유전자좌에서 검출되었습니다. 리포터의 ChIP 농축이 clec-18 양성 대조군 유전자좌로 정규화되면 GFP RNAi에서 더 높은 히스톤 H3K9me3 농축이 나타나는 반면 히스톤 H3 농축은 대조군과 GFP RNAi 처리 간에 유사합니다(그림 2D). GFP RNAi가 히스톤 H3K9me3 또는 clec-18 유전자좌에서 총 히스톤 H3 점유에 영향을 미치지 않을 것으로 예상되기 때문에, 이 정규화는 GFP RNAi와 대조군 RNAi 샘플 사이의 ChIP 효율 차이와 같은 기술적 변동에 대해 완화합니다. RNAi 처리 사이의 히스톤 H3K9me3 및 히스톤 H3 수준의 접힘 변화는 GFP RNAi 유도 침묵시 히스톤 점유와 무관하게 GFP 리포터 특정 히스톤 H3K9me3 농축을 보여줍니다 (그림 2E).
<img alt="Figure 2" class="xfigimg" src="/files/ftp_upload/65285/65285fig02.jpg"> 그림 2: GFP RNAi 유도 침묵은 RNAi 표적에서 H3K9me3 농축 증가에 해당합니다. (A) qPCR 앰플리콘 영역이 표지된 생식세포 발현 GFP RNAi 리포터 mjIs134[mex-5p::gfp-h2b::tbb-2 3'UTR]의 다이어그램. (B) 21°C에서 RNAi 처리 후 세대에 걸쳐 점수가 매겨진 GFP 발현. 오차 막대는 두 생물학적 반복의 표준 편차를 나타냅니다. (C) 두 가지 생물학적 복제에서 F1 젊은 성인의 H3K9me3, 히스톤 H3 및 IgG 대조군의 ChIP-qPCR. clec-18 및 hrp-2는 각각 H3K9me3 농축을 위한 양성 및 음성 대조군 유전자좌입니다. (D) GFP RNAi 리포터에서 H3K9me3 및 히스톤 H3 농축은 clec-18 양성 대조군 자리로 정규화되었습니다. (E) GFP RNAi-와 대조군 RNAi-처리 동물 사이의 H3K9me3 및 히스톤 H3 농축의 변화, clec-18로의 정규화. 점선은 1의 접기 변경을 나타냅니다. <a href="https://www.jove.com/files/ftp_upload/65285/65285fig02large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.</a>

Watch this Scientific Journal Video about RNAi Inheritance and ChIP in C. elegans at JoVE.com

이 프로토콜은 예쁜꼬마선충(C. elegans)에서 RNAi 유도 침묵 및 관련 염색질 변형의 후성유전학적 유전을 연구하기 위한 RNA 간섭 및 ChIP 분석을 설명합니다.

Transgenerational epigenetic inheritance (TEI) allows the transmission of information through the germline without changing the genome sequence, through ...

우리 실험실의 연구는 염색질 관련 단백질, 히스톤 변형 및 작은 RNA 경로 요인이 발달 및 세대 간 후성 유전 유전의 맥락에서 어떻게 함께 작동하는지 조사합니다. GFP 리포터를 사용하는 RNA 유전 분석은 매우 강력한 도구가 되었습니다. 이 프로토콜은 웜의 준비, 채점 및 패싱을 표준화하는 방법과 재현 가능한 결과를 생성하는 데 도움이 될 수 있는 ChIP 샘플의 준비를 설명합니다.생식세포 발현 전이유전자를 연구할 때 실험적 과제 중 하나는 동물의 생식세포에서 효과를 분리하는 것입니다. 우리는 현재 ChIP에 전체 동물을 사용하고 있지만 미래에는 특히 생식세포에서 염색질을 검사하기 위한 분석을 개발하고자 합니다. 우리 실험실은 히스톤 메틸화와 이러한 표시를 인식하는 단백질에 관심이 있습니다.앞으로 우리는 전이유전자에서의 RNAi 유전과 내인성 서열의 조절의 맥락에서 이러한 염색질 리더와 작은 RNA 경로 사이의 상호 작용을 조사하고자 합니다.

analysis-transgenerational-epigenetic-inheritance-c-elegans-using

Research

JoVE Journal

Genetics

Analysis of Transgenerational Epigenetic Inheritance in C. elegans Using a Fluorescent Reporter and Chromatin Immunoprecipitation (ChIP)

1.6K 조회수.  University of Toronto. 우리 실험실의 연구는 염색질 관련 단백질, 히스톤 변형 및 작은 RNA 경로 요인이 발달 및 세대 간 후성 유전 유전의 맥락에서 어떻게 함께 작동하는지 조사합니다. GFP 리포터를 사용하는 RNA 유전 분석은 매우 강력한 도구가 되었습니다. 이 프로토콜은 웜의 준비, 채점 및 패싱을 표준화하는 방법과 재현 가능한 결과를 생성하는 데 도움이 될 수 있는 ChIP 샘플의 준비를 설명합?...

비디오: 저자 스포트라이트: 예쁜꼬마선충(C. elegans)의 RNAi 유전 및 ChIP 

Transgenerational epigenetic inheritance (TEI) allows the transmission of information through the germline without changing the genome sequence, through factors such as non-coding RNAs and chromatin modifications. The phenomenon of RNA interference (RNAi) inheritance in the nematode Caenorhabditis elegans is an effective model to investigate TEI that takes advantage of this model organism's short life cycle, self-propagation, and transparency. In RNAi inheritance, exposure of animals to RNAi leads to gene silencing and altered chromatin signatures at the target locus that persist for multiple generations in the absence of the initial trigger. This protocol describes the analysis of RNAi inheritance in C. elegans using a germline-expressed nuclear green fluorescent protein (GFP) reporter. Reporter silencing is initiated by feeding the animals bacteria expressing double-stranded RNA targeting GFP. At each generation, animals are passaged to maintain synchronized development, and reporter gene silencing is determined by microscopy. At select generations, populations are collected and processed for chromatin immunoprecipitation (ChIP)-quantitative polymerase chain reaction (qPCR) to measure histone modification enrichment at the GFP reporter locus. This protocol for studying RNAi inheritance can be easily modified and combined with other analyses to further investigate TEI factors in small RNA and chromatin pathways.

This protocol describes an RNA interference and ChIP assay to study the epigenetic inheritance of RNAi-induced silencing and associated chromatin modifications in C. elegans.

연구

유전학

Bleaching and Plating Caenorhabditis elegans P0 Generation Embryos onto RNAi-NGM plates

Bleaching and Plating Caenorhabditis elegans P0 Generation Embryos onto RNAi-NGM plates  

Prepare animals for the RNAi inheritance assay by picking three or four gravid Caenorhabditis elegans adults under the 35 millimeter standard NGM plates seeded with OP50-1 bacteria. After four days, wash the gravid adult worms off the plates into 1.5 milliliter tubes using 800 microliters of M9 buffer supplemented with Triton X-100. Repeat the wash and pull the worms into one tube.After centrifuging the worms at 1, 000 G for 1.5 to two minutes, aspirate the supernatant leaving 100 microliters without disturbing the worm pellet. To each tube containing the worm pellet, add 650 microliters of double distilled water. To isolate the C.elegans embryos from the collected population, add 250 microliters of the freshly prepared bleaching solution and start a timer.Every one to two minutes, vortex the tubes thoroughly. After five minutes, monitor the degradation of adult worms under the stereoscope. Continue vortexing until the worms are completely dissolved and only embryos remain.This generally takes six to seven minutes. Immediately centrifuge the tubes at 1, 000 G for 1.5 minutes and aspirate the supernatant, leaving approximately 50 to 100 microliters of the supernatant with the embryos. Add one milliliter of M9 buffer supplemented with Triton X-100 to the embryos and vortex.Centrifuge the suspension and repeat the wash two times. After the final wash, aspirate the supernatant and leave approximately 100 microliters in the tube. Vortex the tubes with isolated embryos and pipette two microliters from each tube twice onto a labeled glass slide.Count the embryos using a tally counter to estimate the concentration of embryos per microliter. To start a semi-synchronized population growth, transfer approximately 250 embryos onto each RNAi NGM plate containing E.coli HT115 bacteria with GFP or control RNAi vectors. Allow the liquid to absorb.Incubate the P naught generation treated with RNAi for four days at 21 degrees Celsius.

Caenorhabditis elegans P0 세대 배아를 RNAi-NGM 플레이트에 표백 및 도금

Passaging and Scoring the Caenorhabditis elegans P0 Generation for Germline GFP Expression

Passaging and Scoring the Caenorhabditis elegans P0 Generation for Germline GFP Expression  

Begin preparing the agarose pads by placing a drop of melted 1%agarose onto the vinyl record using a glass Pasteur pipet. Orient a glass slide so that the lines on the record are horizontal or vertical, and place the slide quickly onto the agarose drop for 30 seconds. Remove the glass slide from the record and add approximately five microliters of freshly prepared five millimolar levamisole under the stereoscope.Gently flick the tube containing worms and transfer 5 to 10 microliters onto the agarose pad to mount the worms. Estimate the number of worms as they are being added so that there are approximately 40 worms per replicate. Line up the worms in rows using an eyelash pick, and place a glass coverslip onto the slide.Isolate the embryos from the remaining worms using the bleaching protocol and plate 250 embryos onto 35 millimeter NGM plates seeded with OP50-1 bacteria. Under the fluorescent stereoscope, use a GFP filter set and count and record the number of GFP positive and GFP negative worms on the slides for each replicate using a tally counter. The manual scoring of the nuclear GFP signal in the germline for each generation showed that the silencing of the transgene was fully penetrant in the scored P0 and F1 worms treated with GFP RNAi.In the F2 generation, the proportion of the population exhibiting inheritance of GFP silencing was approximately 50%By the F5 generation, the majority of the population did not show the inheritance of silencing. By the F10 generation, all the worms expressed GFP and no inheritance was detected.

생식세포 GFP 발현을 위한 예쁜꼬마선충(Caenorhabditis elegans) P0 생성 Passaging and scoring the Caenorhabditis elegans P0 Generation for Germline GFP Expression(생식세포 GFP 발현을 위한 Caenorhabditis elegans P0 생성의 Passaging 및 스코어링

Collection of F1 Generation Caenorhabditis elegans for Chromatin Immunoprecipitation (ChIP)

Collection of F1 Generation Caenorhabditis elegans for Chromatin Immunoprecipitation (ChIP)  

Begin by plating approximately 3, 500 C.elgans F1 generation embryos on 14 plates and allow them to grow to the young adult stage for three days at 21 degrees Celsius. Wash and collect the C.elgans into 1.5-milliliter tubes using PBS/TX. Centrifuge at 1000 G for two minutes, aspirate, and pull the worms from one strain into one tube.Repeat three washes with PBS/TX. Next, aspirate the supernatant leaving one milliliter in the tube and invert to mix. After counting the number of C.elgans worms in three microliters three times, calculate the concentration of worms and transfer a volume corresponding to 3000 worms to a new tube for formaldehyde cross-linking.

Chromatin Immunoprecipitation (ChIP)에 대한 F1 세대 Caenorhabditis elegans 수집

Formaldehyde Crosslinking of the F1 Generation of Caenorhabditis elegans for ChIP

Formaldehyde Crosslinking of the F1 Generation of Caenorhabditis elegans for ChIP  

Begin by adding formaldehyde to a 1.8%final concentration to the tube containing the worms and rotating the tube at room temperature for six minutes. Then immediately freeze the tubes in liquid nitrogen, and store the samples at 80 degrees Celsius. To proceed thaw the formaldehyde cross-link sample in a room temperature water bath for three minutes, and rotate the samples for 16 minutes at room temperature.At 1.25 molar glycine to a 125 millimolar final concentration, and rotate for five minutes at room temperature. Following this step, keep the samples on ice, or at four degrees, and use ice cold buffers until the magnetic bead elution. After centrifuging the sample at 1000 g for three minutes, wash it three times with one milliliter of PBSTX.Then wash it two times with one milliliter of Resuspension Buffer. After the last wash, leave enough Buffer to ensure the total volume is at least three times the pellet volume and a minimum of 100 microliters.

ChIP에 대한 예쁜꼬마선충 의 F1 세대의 포름알데히드 교차결합

Sonication of Formaldehyde-Crosslinked Caenorhabditis elegans and Chromatin Immunoprecipitation

Sonication of Formaldehyde-Crosslinked Caenorhabditis elegans and Chromatin Immunoprecipitation  

Begin by mixing and aliquoting 90 to 120 microliters of the formaldehyde crosslinked C.Elegans samples into a polystyrene sonication tube. Add an equal volume of resuspension buffer containing 2X detergents. Sonicate in a water bath sonicator for seven minutes.Gently mix the sample by pipetting and repeat the sonication for an additional seven minutes. Once done, transfer the sonicated lysate to a 1.5 milliliter tube. Add a half volume of resuspension buffer without detergents.After centrifugation at 13, 000 G for 15 minutes at four degrees Celsius, divide the lysate supernatant into four parts. Store the input lysate part at minus 20 degrees Celsius in a 1.5 milliliter tube. Add 0.5 micrograms of anti-H3K9 trimethylation, anti-histone H3 or IgG to the appropriate immunoprecipitation or IP sample.Incubate the reaction at four degrees Celsius overnight with rotation. The following day, aliquot the nine microliters of protein G coated magnetic beads per IP sample in a 1.5 milliliter tube. After two washes with one milliliter of FA-150, resuspend the magnetic beads in the FA-150 buffer.Once done, add 7.5 microliters of the magnetic bead suspension to each IP antibody mix before incubating the tubes at four degrees Celsius for two hours with rotation. Next, wash the magnetic beads seven times using at least 200 microliters of each buffer solution. Incubate each wash at four degrees Celsius for five minutes with rotation before collecting the beads on a magnetic stand to aspirate the wash.After aspirating the last wash of the buffer, resuspend the magnetic beads in 50 microliters of chromatin IP elution buffer, and transfer it to a 1.5 milliliter tube. After eluting the sample in a ThermoMixer, collect the beads on a magnetic stand and transfer the supernatant to a new tube. Repeat the elution with another 50 microliters of chromatin immunoprecipitation elution buffer.Once done, pull a total of 100 microliters of supernatant before proceeding with reverse cross-linking and DNA elution.