Supported by National Institutes of Health (DK55679, and DK59888 to A.N.). Emory University&#160;Integrated Cellular Imaging Microscopy Core of the Winship Cancer&#160;Institute comprehensive cancer center grant, P30CA138292, and the Crohn's and Colitis Foundation of America Career Development award to C.T.C. and Fellowship Award to A.E.F.

Experiments used C57BL/6 mice between 10 and 12 weeks of age. All procedures using animals were reviewed and approved by the Emory University Institutional Animal Care and Use Committee and were performed according to National Institutes of Health criteria.
1. Experimental Setup
<ol>
	<li>Set Up the Cryostat
	<ol>
		<li>Equilibrate cryostat to -20 &#176;C, including the microtome blade and chucks (exercise extreme caution around the blade!).</li>
		<li>Fill an empty cryomold with OCT (Optimal Cutting Temperature compound) and equilibrate to -20 &#176;C (~30 min). Remove the frozen OCT from the mold and fix it on the chuck with liquid OCT. Place the block/chuck in the microtome arm and allow the OCT to set for 10 min.</li>
		<li>Set the cryostat to 10 &#181;m per section and shave the OCT block until it is flat. Back the microtome arm away from the blade by several centimeters. At this point do not adjust the blade or chuck for the remainder of the experiment.</li>
	</ol>
	</li>
	<li>Prepare the razor blades: Prepare 2 razor blades per sample. Using a metal file, dull the sharped edge of blades. Next, remove the aluminum flange with forceps.</li>
	<li>Pre-chill a Pyrex dish or other flat surface on dry ice.</li>
	<li>Prepare a dissection dish with 10-15 dissection pins. A 10 cm tissue culture dish 50% filled with silicon will suffice. Add 5 ml of Hanks buffer at RT.</li>
</ol>
2. Dissection of Distal Colonic Tissue
<ol>
	<li>Place mice in a sealed chamber and euthanize mice by isoflurane inhalation and cervical dislocation, then spray 70% ethanol onto the abdomen and thorax12.</li>
	<li>Make a small incision in skin of the abdomen with scissors and then make an incision to expose the peritoneal cavity. Similar procedures can be found described here12.</li>
	<li>Cut the large intestine at the anal verge and tease apart the mesentery until the colon is free.</li>
	<li>Excise a distal colon segment between 0 and 6 cm from the anus. Here, the crypt depth is ~150 &#181;m (see Figure 1B). Cut open the colon longitudinally using scissors and remove the fecal contents.</li>
	<li>Pin the tissue to the dissection dish with the mucosal surface facing up. Stretch the tissue using dissection pins on a silicon dish in Hanks buffer and let rest for 10 min at RT (Figure 1C). This removes folds from the tissue and allows the muscle layers to relax.</li>
</ol>
3. Mount Tissue on the Cryostat for Sectioning
<ol>
	<li>Slide a razor blade under the desired section of tissue and then pour off the Hanks buffer. Add another razor blade to the top, making a sandwich. Cut the tissue segment and remove the pins. Transfer the razor blade/tissue sandwich to dry ice. Allow the tissue to freeze (5-10 min, Figure 1D).</li>
	<li>Pick up the razor/tissue sandwich and allow it to warm slightly by placing a finger on the top blade (mucosal side up. This orients the tissue so that the basal muscle layers are sectioned first.). Separate the sandwich and cut around the edges of the tissue segment. Cut a tissue segment approximately, 0.5 cm x 1 cm. Edge areas have a tendency to curl, causing the serial sections to contain many tissue layers. Note that over-cutting is better than under-cutting, so err on the side of caution.</li>
	<li>Allow the tissue to warm until the ice on top of the tissue begins to melt. At this point quickly and carefully press the tissue into the OCT block in the cryostat.</li>
	<li>Remove the blade by placing a finger over the sample. The heat transfer will allow you to remove the blade without disrupting the tissue.</li>
	<li>Coat the tissue with OCT and equilibrate for 5 min. Cut sections at 10 &#181;m (Figure 1E, F). Visually inspect the sections until the crypts are seen. Place sections in a 1.5 ml tubes or on slides.</li>
	<li>For analysis of mRNA or protein, place the samples in tubes with 5 crypt-base, 5 transitional, and 5 surface sections per tube. For RNA collection add 1 ml commercial isolation reagent and incubate at RT for 10 min. Perform RNA purification according to manufacturer&#8217;s instructions. Use 5-10 &#181;g of total RNA for cDNA generation.</li>
	<li>For protein purification, add 0.5 ml of cold RIPA lysis buffer (plus protease inhibitors) per 5 sections. Sonicate 3 times at a 70% cycle, on ice.
	<ol>
		<li>Add samples to SDS PAGE loading buffer (Laemmli buffer) and incubate at 100 &#176;C for 10 min. Subject samples to SDS PAGE and transfer, then block in 5% milk/PBS for 2 hr. Perform western blot analysis followed by incubation with KLF4 antibodies (1:500) O/N at 4 &#176;C.</li>
	</ol>
	</li>
</ol>

<ol>
	<li>Noah, T. K., Donahue, B., Shroyer, N. F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Intestinal+development+and+differentiation.">Intestinal development and differentiation.</a> Exp Cell Res. 317, 2702-2710 (2011).</li><li>Humphries, A., Wright, N. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Colonic+crypt+organization+and+tumorigenesis.">Colonic crypt organization and tumorigenesis.</a> Nat Rev Cancer. 8, 415-424 (2008).</li><li>Weber, C. R., Turner, J. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Inflammatory+bowel+disease:+is+it+really+just+another+break+in+the+wall.">Inflammatory bowel disease: is it really just another break in the wall.</a> Gut. 56, 6-8 (2007).</li><li>Bjerknes, M., Cheng, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Methods+for+the+isolation+of+intact+epithelium+from+the+mouse+intestine.">Methods for the isolation of intact epithelium from the mouse intestine.</a> Anat Rec. 199, 565-574 (1981).</li><li>Sato, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Single+Lgr5+stem+cells+build+crypt-villus+structures+in+vitro+without+a+mesenchymal+niche.">Single Lgr5 stem cells build crypt-villus structures in vitro without a mesenchymal niche.</a> Nature. 459, 262-265 (2009).</li><li>Rand, M. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Calcium+depletion+dissociates+and+activates+heterodimeric+notch+receptors.">Calcium depletion dissociates and activates heterodimeric notch receptors.</a> Mol Cell Biol. 20, 1825-1835 (2000).</li><li>Gjorevski, N., Boghaert, E., Nelson, C. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Regulation+of+Epithelial-Mesenchymal+Transition+by+Transmission+of+Mechanical+Stress+through+Epithelial+Tissues.">Regulation of Epithelial-Mesenchymal Transition by Transmission of Mechanical Stress through Epithelial Tissues.</a> Cancer Microenviron. 5, 29-38 (2012).</li><li>Lechner, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Gene+expression+pattern+of+laser+microdissected+colonic+crypts+of+adenomas+with+low+grade+dysplasia.">Gene expression pattern of laser microdissected colonic crypts of adenomas with low grade dysplasia.</a> Gut. 52, 1148-1153 (2003).</li><li>Reizel, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Colon+stem+cell+and+crypt+dynamics+exposed+by+cell+lineage+reconstruction.">Colon stem cell and crypt dynamics exposed by cell lineage reconstruction.</a> PLoS Genet. 7, e1002192 (2011).</li><li>Kosinski, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Gene+expression+patterns+of+human+colon+tops+and+basal+crypts+and+BMP+antagonists+as+intestinal+stem+cell+niche+factors.">Gene expression patterns of human colon tops and basal crypts and BMP antagonists as intestinal stem cell niche factors.</a> Proc Natl Acad Sci U S A. 104, 15418-15423 (2007).</li><li>Tamura, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Pit+pattern+and+three-dimensional+configuration+of+isolated+crypts+from+the+patients+with+colorectal+neoplasm.">Pit pattern and three-dimensional configuration of isolated crypts from the patients with colorectal neoplasm.</a> J Gastroenterol. 37, 798-806 (2002).</li><li>Geem, D., Medina-Contreras, O., Kim, W., Huang, C. S., Denning, T. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Isolation+and+characterization+of+dendritic+cells+and+macrophages+from+the+mouse+intestine.">Isolation and characterization of dendritic cells and macrophages from the mouse intestine.</a> Journal of visualized experiments : JoVE. , e4040 (2012).</li><li>Laukoetter, M. G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=JAM-A+regulates+permeability+and+inflammation+in+the+intestine+in+vivo.">JAM-A regulates permeability and inflammation in the intestine in vivo.</a> J Exp Med. 204, 3067-3076 (2007).</li><li>Neumann, P. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Gut+commensal+bacteria+and+regional+Wnt+gene+expression+in+the+proximal+versus+distal+colon.">Gut commensal bacteria and regional Wnt gene expression in the proximal versus distal colon.</a> Am J Pathol. 184, 592-599 (2014).</li><li>Capaldo, C. T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Proinflammatory+cytokine-induced+tight+junction+remodeling+through+dynamic+self-assembly+of+claudins.">Proinflammatory cytokine-induced tight junction remodeling through dynamic self-assembly of claudins.</a> Mol Biol Cell. 25, 2710-2719 (2014).</li><li>Wells, J. M., Spence, J. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=How+to+make+an+intestine.">How to make an intestine.</a> Development. 141, 752-760 (2014).</li></ol>

The authors have nothing to disclose

The molecular mechanisms involved in colonic epithelial cell proliferation and differentiation are poorly understood. This includes gaps in our understanding of the cellular signaling environment of the stem cell compartment at the base of the colonic epithelial crypts. There is also an increasing interest in the processes that underlie enterocyte differentiation. For example, increased understanding of in vivo differentiation is required as a benchmark for studies aimed at producing in vitro primary intestinal systems16.
The above procedure contains several steps that require extra attention. Firstly, removing the edges around the frozen tissue segment (as discussed in section 3.2) is required as the tissue edges curl during dissection and freezing. Failure to move these edges results is a mixed population of surface and crypt base cells. Mounting the tissue on a pre-chilled, leveled OCT block is also essential. This protocol can be adapted to other areas of the distal colon by altering the number of sections in each pool. For example, as shown in Figure 1B, mucosal crypt length varies between 150-300 &#956;m. Therefore, when studying the region between 4 cm-6 cm from the anus, the number of sections should be increased from 15 to 30. Importantly, this protocol is not suggested for the proximal colon (7 cm-9 cm) due to folds (plicae obliquae) which extend into the lumen making it impossible to separate surface and crypt-base cells by serial sectioning.
Serial sectioning techniques have been used to study crypt-base and surface epithelial cell populations in humans. However, our protocol adds additional steps that are required due to the small size of murine tissue. We propose that the above protocol will allow for the investigation of crypt-base and surface epithelial cell population in genetically tractable mouse systems. Indeed, pooled sections yield high quality protein and RNA suitable downstream analysis. Future applications could include the study of cell signaling pathways or chromatin immunoprecipitation. However, it should be noted that, like several of the alternative methods described above, the resulting sections contain a mixture of epithelial and interstitial lamina propria cells. In conclusion, the protocol described here provides a rapid, high yield method for the analysis of molecular processes in spatially distinct regions of the murine colonic mucosa.

The colonic epithelial lining is a highly regenerative tissue, with resident stem cells replenishing the tissue every few days1. This process of regeneration requires the maintenance of a proliferative stem cell compartment. Over time, the newly produced daughter cells lose their proliferative potential and migrate toward the luminal surface of the intestine. Coincident with migration, progenitor cells differentiate into mature barrier-forming enterocytes or mucous producing goblet cells. Failure of this differentiation program is thought to contribute to compromised epithelial barrier such as is observed in inflammatory bowel disease and colon cancer2,3.
Detailed study of the above processes will require methodologies for isolating crypt-base and surface cell populations. Multiple methods exist, each with unique advantages and drawbacks. Current methods for the isolation of intestinal epithelial cells include chelating agents and mechanical disassociation, resulting in the isolation of entire crypts, epithelial sheets, or single cells, dependent on experimental conditions4,5. These are high yield methods, yet changes in intercellular signaling have been reported under these conditions that may not represent the native environment6,7. Laser capture microdissection allows for the collection of spatial distinct material, but achieves low molecular yield8,9. In human colonic tissue, serial horizontal cryosectioning methods have been developed10. However, murine mucosal tissues are prohibitively small for direct appropriation of this technique. In humans, intestinal crypt lengths (the distant between the crypt-base and surface cells) in the colon varies between ~100&#8211;1,000 &#956;m 11. In mice, crypt lengths are between ~50&#8211;300 &#956;m (see Figure 1A). The small size of murine crypts presents a challenge to the isolation of these two cell populations using existing protocols.
We now describe a low cost, high yield method for the isolation of crypt-base and surface epithelial cell population in murine colonic tissue. Tissue harvested in this manner may then be analyzed by a number of standard downstream applications, including immunofluorescence staining, RT&#8211;PCR (Real Time&#8211;Polymerase Chain Reaction) or western blotting.

<table><tbody><tr><td>Microtome</td><td>Leica Biosystems, Nussloch Germany</td><td>CM 1510-3</td><td></td></tr><tr><td>MyiQ real time PCR detector</td><td>BioRad</td><td></td><td></td></tr><tr><td>LSM 510&amp;nbsp;</td><td>Carl Zeiss</td><td></td><td>Confocal microscope</td></tr><tr><td>OCT</td><td>Tissue-Tek, Sakura Finetek, Torrance CA</td><td>4583</td><td></td></tr><tr><td>cryo-mold</td><td>Tissue-Tek, Sakura Finetek, Torrance CA</td><td>4557</td><td>25mmx20mmx5mm</td></tr><tr><td>High profile microtome blade</td><td>Leica Biosystems, Nussloch germany</td><td>818</td><td></td></tr><tr><td>GEM industrial blades</td><td>American Safety Razor Blades</td><td>62-0314</td><td></td></tr><tr><td>Sylgard silicon elastomere base</td><td>Dow Corning, Midland MI</td><td>3097358</td><td></td></tr><tr><td>27 1/2 g needle</td><td>Becton-Dickinson, Franklin Lakes, NJ</td><td>305109</td><td>pins for dissection</td></tr><tr><td>TRizol</td><td>Life Technologies</td><td>15596018</td><td></td></tr><tr><td>Rneasy</td><td>Qiagen</td><td>74104</td><td></td></tr><tr><td>DNAse</td><td>Qiagen</td><td>79254</td><td></td></tr><tr><td>Antibody ZO-1</td><td>Invitrogen&amp;nbsp;</td><td>187430</td><td></td></tr><tr><td>Antibody KLF4</td><td>Cell Signaling</td><td>4038S</td><td></td></tr><tr><td>Antibody mGAPDH</td><td>Sigma</td><td>G8795</td><td></td></tr><tr><td>Antibody Secondary Alexa conjugate</td><td>Invitrogen</td><td>A11034</td><td>488 anti-rabbit</td></tr><tr><td>Antibody Secondary HRP conjugate</td><td>Jackson</td><td>111/115-001-003</td><td>rabbit/mouse&amp;nbsp;</td></tr><tr><td>Topro-3</td><td>Invitrogen</td><td>T3605</td><td></td></tr><tr><td>HANKs balanced salt buffer</td><td>Life Technologies</td><td>14025092</td><td></td></tr><tr><td>RIPA lysis buffer</td><td></td><td></td><td>50mM Tris-HCl pH 7.4 150mM NaCl 1% NP40 0.25% Na-deoxycholate</td></tr><tr><td>primer TBP 3&#039;</td><td></td><td></td><td>GGAATTGTACCGCAGCTTCAAA</td></tr><tr><td>primer TBP 5&#039;</td><td></td><td></td><td>GATGACTGCAGCAAATCGCTT</td></tr><tr><td>primer KLF4 3&#039;</td><td></td><td></td><td>TGTGACTATGCAGGCTGTGGCAAA</td></tr><tr><td>primer KLF4 5&#039;</td><td></td><td></td><td>ACAGTGGTAAGGTTTCTCGCCTGT</td></tr></tbody></table>

cryosectioning method for microdissection of murine colonic mucosa

The colonic mucosal tissue provides a vital barrier to luminal antigens. This barrier is composed of a monolayer of simple columnar epithelial cells. The colonic epithelium is dynamically turned over and epithelial cells are generated in the stem cell containing crypts of Lieberk&#252;hn. Progenitor cells produced in the crypt-bases migrate toward the luminal surface, undergoing a process of cellular differentiation before being shed into the gut lumen. In order to study these processes at the molecular level, we have developed a simple method for the microdissection of two spatially distinct regions of the colonic mucosa; the proliferative crypt zone, and the differentiated surface epithelial cells. Our objective is to isolate specific crypt and surface epithelial cell populations from mouse colonic mucosa for the isolation of RNA and protein.

Colonic tissue sections were processed for histological assessment and H&#38;E staining13. A traditional cross-section view of the mucosa is seen in Figure 2A. Basal areas contain the muscularis externa, composed mainly of the circular muscularis. Proceeding toward the lumen, the muscularis mucosa is evident adjacent to the crypt-base epithelial cells, transitional cells are in the middle of the tissue, and finally, surface cell populations face the gut lumen. The serial sectioning method described here maintains an orientation such that the longitudinal and circular muscularis are encountered first (Figure 2B), followed by the muscularis mucosa (Figure 2C). Note the appearance of non-muscle interstitial cells in the top left of the image. For the downstream analysis described below, muscle sections are discarded. The subsequent sections contain epithelial cells and interstitial tissue (lamina propria), starting with the crypt-base cells (Figure 2D). Note the absence of a central lumen in most of the crypts, which appear darker due to the closely packed nuclei. These layers contain the proliferative compartment. The transitional cells appear as tightly packed glands with prominent central lumens (Figure 2E). Lastly, surface cell populations have an irregular structure, with areas of the epithelial monolayer viewed en face (Figure 2F).
Serial sections as described above may also be processed for immunofluorescence labeling and confocal microscopy (as described here14). Figure 2G shows isolated crypts fixed and permeabilized in 100% methanol and subsequently stained for nuclei (blue) and the cell-cell junction protein Zonula Occludens 1 (ZO-1, green). In the traditional sectioning orientation, crypt and surface cell can be viewed simultaneously (Figure 2G). Note that the ZO-1 junctional stain lines the lumen of the colonic crypt. This Z0-1 lining of the lumen can also be seen in serial sectioned samples of transitional cell populations, in the center of the circular glands (Figure 2G). Enhanced ZO-1 stain is seen in surface cell populations (Figure 2I and J).
Several differentiation factors are known to be expressed in a spatiotemporal fashion along the crypt-to&#8211;surface axis. This includes the transcription factor Kruppel-like factor 4 (KLF4), which is known to be enriched in surface cell populations. Using traditional sectioning methods, KLF4 is found in the nuclei of lumen facing surface cell populations (Figure 2K). We therefore speculated that KLF4 mRNA would be predominantly expressed in surface cell populations. To test this, serial sections were collected and grouped into surface, transitional, and crypt-base samples. Subsequently, RNA was harvested using standard Trizol extraction, with an additional purification by RNeasy column and DNAse treatment. RNA was collected from 5 pooled consecutive sections, which yielded between 5-10 &#181;g of total RNA per sample. These samples were then subjected to semi-quantitative real time PCR for both KLF4 and a reference gene, TATA box binding protein 1 (TBP-1) (Figure 2L)14. As shown in Figure 2L, after normalization to TBP-1, surface cells were found to express up to 8 times the KLF4 mRNA that is expressed in crypt cells. Similarly, KLF4 protein levels were found to exhibit spatial regulation along the crypt-surface axis. Serial sections were pooled as described above and then incubated in lysis buffer for 20 min at 4 &#176;C. This yielded between 200-250 &#181;g of protein per sample. Samples were then subjected analysis by SDS-PAGE (Figure 2M)15. As shown in Figure 2M, KLF4 protein levels are dramatically higher in surface cell populations. The above findings demonstrate the ability of this protocol to isolate large amounts of surface and crypt epithelial cells from the murine colonic mucosa.
<img alt="Figure 1" src="/files/ftp_upload/53112/53112fig1.jpg" /> 
Figure 1: (A) Schematic showing murine colonic mucosa and external muscle layers. Our method aims to collect discrete surface cell and crypt-base cell populations by serial cryosectioning (10 &#956;m each). The external muscle layers are discarded. (B) Crypt height varies along the length of the colon (distance between crypt-base and surface layers). Data points indicate individual crypt measurements and symbols indicate biological replicates (n = 4). (C) Colon segments collected, bisected, and pinned onto a silicon dissecting dish. (D) A tissue segment approximately 3 cm from the anus is pressed between to razor blades and the frozen on dry ice. (E) Tissue is then mounted on a pre-leveled OCT block. (F) Cryosections are removed and visually inspected.
<img alt="Figure 2" src="/files/ftp_upload/53112/53112fig2.jpg" /> 
Figure 2: Representative data. (A) Colonic tissue stained with Hematoxylin-Eosin in cross-section showing the circular muscularis (c.m.), the muscularis mucosa (m.m.), crypt-base cells, transitional cells, and surface cells. (B-C) colonic muscle layers. (D) Crypt-base cells. Note the absence of a central lumen. (E) Transitional cells. (F) Surface cells. (G) Immunofluorescence staining of isolated colonic crypts. ZO-1 (green) and nuclei (blue) are observed in cross-section. (H-I) ZO-1 and nuclear staining in transitional and surface cells. (J) magnified view of ZO-1 staining. (K) KLF4 (green) is enriched in surface cell populations. (L) Real-time PCR assessment of KLF4 mRNA levels between the three compartments. (M) Western blot analysis of KLF4 protein levels in these cell populations.

Watch this Scientific Journal Video about Cryosectioning Method for Microdissection of Murine Colonic Mucosa at JoVE.com

Cryosectioning Method for Microdissection of Murine Colonic Mucosa

Here we describe a simple method for the isolation of spatially distinct murine colonic epithelial surface cells from the underlying crypt-base cells.

The colonic mucosal tissue provides a vital barrier to luminal antigens. This barrier is composed of a monolayer of simple columnar epithelial cells. The ...

cryosectioning-method-for-microdissection-of-murine-colonic-mucosa

Research

JoVE Journal

Biology

17.3K Views.  Emory University, Atlanta, Georgia. Here we describe a simple method for the isolation of spatially distinct murine colonic epithelial surface cells from the underlying crypt-base cells.

Video: Cryosectioning Method for Microdissection of Murine Colonic Mucosa

Isolating And Immunostaining Lymphocytes and Dendritic Cells from Murine Peyer's Patches

Peyer's patches (PPs) are integral components of the gut-associated lymphoid tissues (GALT) and play a central role in intestinal immunosurveillance and homeostasis. Particulate antigens and microbes in the intestinal lumen are continuously sampled by PP M cells in the follicle-associated epithelium (FAE) and transported to an underlying network of dendritic cells (DCs), macrophages, and lymphocytes. In this article, we describe protocols in which murine PPs are (i) dissociated into single cell suspensions and subjected to flow cytometry and (ii) prepared for cryosectioning and immunostaining. For flow cytometry, PPs are mechanically dissociated and then filtered through 70 &mu;m membranes to generate single cell suspensions free of epithelial cells and large debris. Starting with 20-25 PPs (from four mice), this quick and reproducible method yields a population of &gt;2.5 x 106 cells with &gt;90% cell viability. For cryosectioning, freshly isolated PPs are immersed in Optimal Cutting Temperature (OCT) medium, snap-frozen in liquid nitrogen, and then sectioned using a cryomicrotome. Tissue sections (5-12 &mu;m) are air-dried, fixed with acetone or methanol, and then subjected to immunolabeling.

There is an increasing interest in understanding the immunological functions of specific subpopulations of cells in Peyer's patches (PPs), the primary inductive sites of gut-associated lymphoid tissues. Here we outline parallel protocols for preparing PP single cell preparations for flow cytometric analysis and PP cryosections for immunostaining.

Peyer's  patches (PPs) are integral components of the gut-associated lymphoid tissues  (GALT) and play a central role in intestinal immunosurveillance and ...

Immunology and Infection

Using Robotic Systems to Process and Embed Colonic Murine Samples for Histological Analyses

The understanding of human diseases has been greatly expanded thanks to the study of animal models. Nonetheless, histopathological evaluation of experimental models needs to be as rigorous as that applied for human samples. Indeed, drawing reliable and accurate conclusions is critically influenced by the quality of tissue section preparation. Here, we describe a protocol for histopathological analysis of murine tissues that implements several automated steps during the procedure, from the initial preparation to the paraffin embedding of the murine samples. The reduction of methodological variables through rigorous protocol standardization from automated procedures contributes to increased overall reliability of murine pathological analysis. Specifically, this protocol describes the utilization of automated processing and embedding robotic systems, routinely used for the tissue processing and paraffin embedding of human samples, to process murine specimens of intestinal inflammation. We conclude that the reliability of histopathological examination of murine tissues is significantly increased upon introduction of standardized and automated techniques.

Lack of standardization for murine tissue processing reduces the quality of murine histopathological analysis as compared to human specimens. Here, we present a protocol to perform histopathological examination of murine inflamed and uninflamed colonic tissues to show the feasibility of robotic systems routinely used for processing and embedding&#160;human samples.

The understanding of human diseases has been greatly expanded thanks to the study of animal models. Nonetheless, histopathological evaluation of ...

Optimization of Laser-Capture Microdissection for the Isolation of Enteric Ganglia from Fresh-Frozen Human Tissue

The purpose of this method is to obtain high-integrity RNA samples from enteric ganglia collected from unfixed, freshly-resected human intestinal tissue using laser capture microdissection (LCM). We have identified five steps in the workflow that are crucial for obtaining RNA isolates from enteric ganglia with sufficiently high quality and quantity for RNA-seq. First, when preparing intestinal tissue, each sample must have all excess liquid removed by blotting prior to flattening the serosa as much as possible across the bottom of large base molds. Samples are then quickly frozen atop a slurry of dry ice and 2-methylbutane. Second, when sectioning the tissue, it is important to position cryomolds so that intestinal sections parallel the full plane of the myenteric plexus, thereby yielding the greatest surface area of enteric ganglia per slide. Third, during LCM, polyethylene napthalate (PEN)-membrane slides offer the greatest speed and flexibility in outlining the non-uniform shapes of enteric ganglia when collecting enteric ganglia. Fourth, for distinct visualization of enteric ganglia within sections, ethanol-compatible dyes, like Cresyl Violet, offer excellent preservation of RNA integrity relative to aqueous dyes. Finally, for the extraction of RNA from captured ganglia, we observed differences between commercial RNA extraction kits that yielded superior RNA quantity and quality, while eliminating DNA contamination. Optimization of these factors in the current protocol greatly accelerates the workflow and yields enteric ganglia samples with exceptional RNA quality and quantity.

The goal of this protocol is to obtain high-integrity RNA samples from enteric ganglia isolated from unfixed, freshly-resected human intestinal tissue using laser capture microdissection (LCM). This protocol involves preparing flash-frozen samples of human intestinal tissue, cryosectioning, ethanolic staining and dehydration, LCM, and RNA extraction.

The purpose of this method is to obtain high-integrity RNA samples from enteric ganglia collected from unfixed, freshly-resected human intestinal tissue ...

Neuroscience

Performing Colonoscopic-Guided Pinch Biopsies in Mice and Evaluating Subsequent Tissue Changes

Understanding the tissue and cellular changes that occur in the acute injury response as well as during the wound healing process is of paramount importance when studying diseases of the gastrointestinal (GI) tract. The murine colonic pinch biopsy model is a useful tool to define these processes. Additionally, the interplay between gut luminal content (e.g., microbes) and the colon can be studied. However, wound induction and the ability to track wound closure over time in a reliable manner can be challenging. Moreover, tissue preparation and orientation must be carried out in a standardized way to optimally interrogate histologic and molecular changes. Here, we present a detailed method describing biopsy-induced injury and the monitoring of wound closure through repeat colonoscopies. An approach is described that ensures consistent and reproducible measurements of wound size, the ability to collect the wound bed for molecular analyses as well as visualize the wound bed upon sectioning of tissues. The ability to successfully carry out these techniques allows for studies of the acute injury response, wound healing and luminal-host interactions within the colon.

Here, we provide a detailed description of the procedure to induce colonoscopic-guided pinch biopsies in mice and track wound closure in real time. Additionally, methods for the preparation of tissues for histological, immunohistochemical and molecular analyses of the wound bed are provided.

Understanding the tissue and cellular changes that occur in the acute injury response as well as during the wound healing process is of paramount ...

Isolation of Primary Myofibroblasts from Mouse and Human Colon Tissue

The myofibroblast is a stromal cell of the gastrointestinal (GI) tract that has been gaining considerable attention for its critical role in many GI functions. While several myofibroblast cell lines are commercially available to study these cells in vitro, research results from a cell line exposed to experimental cell culture conditions have inherent limitations due to the overly reductionist nature of the work. Use of primary myofibroblasts offers a great advantage in terms of confirming experimental findings identified in a cell line. Isolation of primary myofibroblasts from an animal model allows for the study of myofibroblasts under conditions that more closely mimic the disease state being studied. Isolation of primary myofibroblasts from human colon tissue provides arguably the most relevant experimental data, since the cells come directly from patients with the underlying disease. We describe a well-established technique that can be utilized to isolate primary myofibroblasts from both mouse and human colon tissue. These isolated cells have been characterized to be alpha-smooth muscle actin and vimentin-positive, and desmin-negative, consistent with subepithelial intestinal myofibroblasts. Primary myofibroblast cells can be grown in cell culture and used for experimental purposes over a limited number of passages.

The myofibroblast is an influential stromal cell of the gastrointestinal tract that regulates important physiologic processes in both normal and disease states. We describe a technique that allows for the isolation of primary myofibroblasts from both mouse and human colon tissue, which can be utilized for in vitro experimentation.

The myofibroblast is  a stromal cell of the gastrointestinal (GI) tract that has been gaining  considerable attention for its critical role in many GI ...

Cryosectioning of Contiguous Regions of a Single Mouse Skeletal Muscle for Gene Expression and Histological Analyses

With this method, consecutive cryosections are collected to enable both microscopy applications for tissue histology and enrichment of RNA for gene expression using adjacent regions from a single mouse skeletal muscle. Typically, it is challenging to achieve adequate homogenization of small skeletal muscle samples because buffer volumes may be too low for efficient grinding applications, yet without sufficient mechanical disruption, the dense tissue architecture of muscle limits penetration of buffer reagents, ultimately causing low RNA yield. By following the protocol reported here, 30 &#956;m sections are collected and pooled allowing cryosectioning and subsequent needle homogenization to mechanically disrupt the muscle, increasing the surface area exposed for buffer penetration. The primary limitations of the technique are that it requires a cryostat, and it is relatively low throughput. However, high-quality RNA can be obtained from small samples of pooled muscle cryosections, making this method accessible for many different skeletal muscles and other tissues. Furthermore, this technique enables matched analyses (e.g., tissue histopathology and gene expression) from adjacent regions of a single skeletal muscle so that measurements can be directly compared across applications to reduce experimental uncertainty and to reduce replicative animal experiments necessary to source a small tissue for multiple applications.

Consecutive cryo-sections are collected to enable histological applications and enrichment of RNA for gene expression measurements using adjacent regions from a single mouse skeletal muscle. High-quality RNA is obtained from 20 - 30 mg of pooled cryosections and measurements are directly compared across applications.

With this method, consecutive cryosections are collected to enable both microscopy applications for tissue histology and enrichment of RNA for gene ...

Whole Cell Electrophysiology of Primary Cultured Murine Enterochromaffin Cells

Enterochromaffin (EC) cells in the gastrointestinal (GI) epithelium constitute the largest subpopulation of enteroendocrine cells. As specialized sensory cells, EC cells sense luminal stimuli and convert them into serotonin (5-hyroxytryptamine, 5-HT) release events. However, the electrophysiology of these cells is poorly understood because they are difficult to culture and to identify. The method presented in this paper outlines primary EC cell cultures optimized for single cell electrophysiology. This protocol utilizes a transgenic cyan fluorescent protein (CFP) reporter to identify mouse EC cells in mixed primary cultures, advancing the approach to obtaining high-quality recordings of whole cell electrophysiology in voltage- and current-clamp modes.

Enterochromaffin (EC) cells comprise a small subset of gastrointestinal epithelial cells. EC cells are electrically excitable and release serotonin, yet difficulties in culturing and identifying EC cells have limited physiological studies. The method presented here establishes a primary culture model amenable to examination of single EC cells by electrophysiology.

Enterochromaffin (EC) cells in the gastrointestinal (GI) epithelium constitute the largest subpopulation of enteroendocrine cells. As specialized sensory ...

Snap Freezing of Muscle Tissue for Sectioning: A Protocol to Obtain Ultrathin Sections of Rapidly Frozen Murine Muscle Tissue

Source: Bonetto, A. et al. <a href="https://www.jove.com/video/54893" target="_blank">The Colon-26 Carcinoma Tumor-bearing Mouse as a Model for the Study of Cancer Cachexia.</a> J. Vis. Exp. (2016)
This video describes the procedure for snap freezing muscle tissue and obtaining its thin sections. The technique can help study cancer-related cachexia in colon cancer mouse models.

Source: Bonetto, A. et al. The Colon-26 Carcinoma Tumor-bearing Mouse as a Model for the Study of Cancer Cachexia. J. Vis. Exp. (2016)
This video ...

JoVE Encyclopedia of Experiments

Cancer Research

Gastrointestinal Cancer

Animal model studies

Intestinal Crypts Isolation: A Method to Isolate Whole Crypts from Small Intestine of Murine Model

Source: Schewe, M. et al. <a href="https://www.jove.com/video/56329" target="_blank">The Organoid Reconstitution Assay (ORA) for the Functional Analysis of Intestinal Stem and Niche Cells.</a> J. Vis. Exp. (2017)
In this video, we demonstrate a technique to isolate whole crypts from a mouse&#8217;s small intestine. The isolated whole crypts can be used to propagate long-lived and self-renewing 3D organoids in vitro.

Source: Schewe, M. et al. The Organoid Reconstitution Assay (ORA) for the Functional Analysis of Intestinal Stem and Niche Cells. J. Vis. Exp. (2017)
In ...

Frozen Mouse Brain Tissue Sectioning: A Procedure to Obtain Thin Frozen Tissue Sections from Frozen Murine Brain Tissue

Source: Comba, A. et al. <a href="https://www.jove.com/v/60939/laser-capture-microdissection-glioma-subregions-for-spatial-molecular">Laser Capture Microdissection of Glioma Subregions for Spatial and Molecular Characterization of Intratumoral Heterogeneity, Oncostreams, and Invasion.</a> J. Vis. Exp. (2020)
In this video, we demonstrate the sectioning of a frozen mouse brain tumor tissue using a cryostat. The frozen brain tissue sections so obtained are stored at low temperatures until further analysis.

Source: Comba, A. et al. Laser Capture Microdissection of Glioma Subregions for Spatial and Molecular Characterization of Intratumoral Heterogeneity, ...

Cryosectioning Method for Microdissection of Murine Colonic Mucosa

Samenvatting

Meer video's verkennen

Hoofdstukken in deze video