Supported by National Institutes of Health (DK55679, and DK59888 to A.N.). Emory University&#160;Integrated Cellular Imaging Microscopy Core of the Winship Cancer&#160;Institute comprehensive cancer center grant, P30CA138292, and the Crohn's and Colitis Foundation of America Career Development award to C.T.C. and Fellowship Award to A.E.F.

Deneyler, yaşlan 10 ile 12 hafta arasında, C57BL / 6 fareleri kullanılmıştır. Hayvanları kullanan tüm prosedürleri gözden ve Emory Üniversitesi Kurumsal Hayvan Bakım ve Kullanım Kurulu tarafından onaylanmış ve Sağlık kriterlerine National Institutes göre gerçekleştirilmiştir bulundu. 1. Deney Düzeneği <ol><li> Cryostat Kurma <ol><li> Mikrotom bıçak ve mandreller dahil, -20 ° C&#39;ye Kriyostat dengelenmesi (bıçak etrafında aşırı dikkatli!). </li><li> Ekim boş bir cryomold (Optimal Kesme Sıcaklık bileşik) doldurun ve -20 ° C (~ 30 dk) dengelenmesi. Kalıptan dondurulmuş Ekim çıkarın ve sıvı OCT ile aynasının üzerinde sabitleyin. Mikrotom kolunda blok / mandreni yerleştirin ve Ekim 10 dakika için ayarlamanızı sağlar. </li><li> Bölüm başına 10 um Kriyostat ayarlayın ve düz olana kadar Ekim blok tıraş. Birkaç santimetre bıçaktan uzak mikrotom kolunu yedekleyin. Bu noktada exper kalanı için bıçak ya da Chuck ayarlamak yokşekli. </li></ol></li><li> Jilet hazırlayın: numune başına 2 Jilet hazırlayın. Metal dosyasını kullanarak, bıçakların sharped kenarı donuk. Sonra, forseps ile alüminyum flanşı çıkarın. </li><li> Kuru buz üzerinde bir Pyrex çanak veya diğer düz bir yüzeye önceden soğuk. </li><li> 10-15 diseksiyon pimleri ile diseksiyon çanak hazırlayın. Silikon ile dolu bir 10 cm&#39;lik bir doku kültürü kabı% 50 yeterli olacaktır. Oda sıcaklığında Hanks tamponu içinde 5 ml. </li></ol> Distal Kolon Doku 2. Diseksiyon <ol><li> Izofluran inhalasyonu ve servikal dislokasyon ile yerleştirin yalıtılmış bir bölmede fareler ve euthanize fareler, daha sonra karın ve göğüs 12 üzerine% 70 etanol sprey. </li><li> Makas ile karın derisinde küçük bir kesi yapmak ve daha sonra bir kesi periton boşluğuna maruz olun. Benzer işlemler burada 12 tarif bulunabilir. </li><li> Anal eşiğinde kalın bağırsak kesin ve kolon serbest kalıncaya kadar mezenter ayrı kızdırmak. </li><li> Distal kolon tüketimanüsten 0 ve 6 cm arasında kademeli. Burada, kript derinliği ~ 150 mikron (Şekil 1B bakınız). Makas kullanarak boyuna kolon açın ve dışkı içeriğini kaldırmak kesmek. </li><li> Mukoza yüzeyi yukarı bakacak şekilde diseksiyon çanak doku pin. Hanks tamponu bir silikon çanak doku kullanılarak diseksiyon işaretçilerine gerin ve RT (Şekil 1C) 10 dakika dinlendirin. Bu doku kıvrımlar kaldırır ve kas tabakaları dinlenmek için izin verir. </li></ol> Kesit için Kriyostat 3. Montaj Doku <ol><li> Dokuda istenilen bölümünde bir jileti kaydırın ve ardından Hanks tampon dökünüz. Bir sandviç yapma, üstüne başka bir jilet ekleyin. Doku segmenti kesin ve işaretçilerine çıkarın. Kuru buz jilet / doku sandviç aktarın. (5-10 dk, Şekil 1D) doku dondurmak için izin verin. </li><li> Jilet / doku sandviç Pick up ve üst bl üzerinde bir parmak koyarak hafifçe ısınmaya bırakınade (mukozal tarafı yukarı. Bu bazal kas tabakaları ilk kesitli böylece doku yönlendirir.). Sandviç ayırın ve doku segmentinin kenarlarda kesti. Bir doku bir bölümü yaklaşık olarak 0.5 cm x 1 cm kesilir. Kenar bölgeleri seri bölümleri birçok doku katmanları içeren neden kıvrılmaya bir eğilim vardır. Aşırı kesme altında kesim daha iyi olduğunu unutmayın, bu yüzden dikkatli bir tarafında err. </li><li> Doku üstünde buz erimeye başlayana kadar doku ısınmasını bekleyin. Bu noktada hızlı ve dikkatli kriyostat OCT bloğa doku basın. </li><li> Numune üzerinde parmağınızı koyarak bıçağını çıkarın. Isı transferi doku aksatmadan bıçağı çıkarmak için izin verecektir. </li><li> Ceket Ekim doku ve 5 dakika için dengelenmeye. 10 mikron (Şekil 1E, F) bölümleri kesin. Kriptler görülür kadar gözle bölümleri inceleyin. 1.5 ml tüpler içinde veya slaytlar yerleştirin bölümleri. </li><li> MRNA veya protein, bir yer t analizi için5 crypt-baz geçiş 5 ve tüp başına 5 yüzey bölümleri ile tüplerde o örnekleri. RNA toplanması için 1 ml ticari bir yalıtım reaktif ekleme ve 10 dakika için oda sıcaklığında inkübe edilir. Üreticinin talimatlarına uygun olarak, RNA saflaştırma gerçekleştirin. CDNA üretimi için toplam RNA 5-10 mikrogram kullanın. </li><li> Protein Saflaştırma için, soğuk RIPA 0.5 ml 5 bölümden başına tampon (artı proteaz inhibitörleri), liziz ekleyin. Buz üzerinde,% 70&#39;lik bir çevrim ile 3 kez sonikasyon. <ol><li> SDS-PAGE yükleme tamponu (Laemmli tamponu) numune ilave edin ve 10 dakika boyunca 100 ° C de inkübe edilir. SDS PAGE ve transfer tabi örnekleri, daha sonra 2 saat boyunca% 5 süt / PBS içinde bloke eder. (: 1: 500), 4 ° C&#39;de, O / N Klf4 antikorlar ile kuluçkalandı ve ardından Western blot analizini gerçekleştirir. </li></ol></li></ol>

<ol>
	<li>Noah, T. K., Donahue, B., Shroyer, N. F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Intestinal+development+and+differentiation.">Intestinal development and differentiation.</a> Exp Cell Res. 317, 2702-2710 (2011).</li><li>Humphries, A., Wright, N. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Colonic+crypt+organization+and+tumorigenesis.">Colonic crypt organization and tumorigenesis.</a> Nat Rev Cancer. 8, 415-424 (2008).</li><li>Weber, C. R., Turner, J. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Inflammatory+bowel+disease:+is+it+really+just+another+break+in+the+wall.">Inflammatory bowel disease: is it really just another break in the wall.</a> Gut. 56, 6-8 (2007).</li><li>Bjerknes, M., Cheng, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Methods+for+the+isolation+of+intact+epithelium+from+the+mouse+intestine.">Methods for the isolation of intact epithelium from the mouse intestine.</a> Anat Rec. 199, 565-574 (1981).</li><li>Sato, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Single+Lgr5+stem+cells+build+crypt-villus+structures+in+vitro+without+a+mesenchymal+niche.">Single Lgr5 stem cells build crypt-villus structures in vitro without a mesenchymal niche.</a> Nature. 459, 262-265 (2009).</li><li>Rand, M. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Calcium+depletion+dissociates+and+activates+heterodimeric+notch+receptors.">Calcium depletion dissociates and activates heterodimeric notch receptors.</a> Mol Cell Biol. 20, 1825-1835 (2000).</li><li>Gjorevski, N., Boghaert, E., Nelson, C. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Regulation+of+Epithelial-Mesenchymal+Transition+by+Transmission+of+Mechanical+Stress+through+Epithelial+Tissues.">Regulation of Epithelial-Mesenchymal Transition by Transmission of Mechanical Stress through Epithelial Tissues.</a> Cancer Microenviron. 5, 29-38 (2012).</li><li>Lechner, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Gene+expression+pattern+of+laser+microdissected+colonic+crypts+of+adenomas+with+low+grade+dysplasia.">Gene expression pattern of laser microdissected colonic crypts of adenomas with low grade dysplasia.</a> Gut. 52, 1148-1153 (2003).</li><li>Reizel, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Colon+stem+cell+and+crypt+dynamics+exposed+by+cell+lineage+reconstruction.">Colon stem cell and crypt dynamics exposed by cell lineage reconstruction.</a> PLoS Genet. 7, e1002192 (2011).</li><li>Kosinski, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Gene+expression+patterns+of+human+colon+tops+and+basal+crypts+and+BMP+antagonists+as+intestinal+stem+cell+niche+factors.">Gene expression patterns of human colon tops and basal crypts and BMP antagonists as intestinal stem cell niche factors.</a> Proc Natl Acad Sci U S A. 104, 15418-15423 (2007).</li><li>Tamura, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Pit+pattern+and+three-dimensional+configuration+of+isolated+crypts+from+the+patients+with+colorectal+neoplasm.">Pit pattern and three-dimensional configuration of isolated crypts from the patients with colorectal neoplasm.</a> J Gastroenterol. 37, 798-806 (2002).</li><li>Geem, D., Medina-Contreras, O., Kim, W., Huang, C. S., Denning, T. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Isolation+and+characterization+of+dendritic+cells+and+macrophages+from+the+mouse+intestine.">Isolation and characterization of dendritic cells and macrophages from the mouse intestine.</a> Journal of visualized experiments : JoVE. , e4040 (2012).</li><li>Laukoetter, M. G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=JAM-A+regulates+permeability+and+inflammation+in+the+intestine+in+vivo.">JAM-A regulates permeability and inflammation in the intestine in vivo.</a> J Exp Med. 204, 3067-3076 (2007).</li><li>Neumann, P. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Gut+commensal+bacteria+and+regional+Wnt+gene+expression+in+the+proximal+versus+distal+colon.">Gut commensal bacteria and regional Wnt gene expression in the proximal versus distal colon.</a> Am J Pathol. 184, 592-599 (2014).</li><li>Capaldo, C. T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Proinflammatory+cytokine-induced+tight+junction+remodeling+through+dynamic+self-assembly+of+claudins.">Proinflammatory cytokine-induced tight junction remodeling through dynamic self-assembly of claudins.</a> Mol Biol Cell. 25, 2710-2719 (2014).</li><li>Wells, J. M., Spence, J. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=How+to+make+an+intestine.">How to make an intestine.</a> Development. 141, 752-760 (2014).</li></ol>

The authors have nothing to disclose

Kolon epitel hücre çoğalması ve farklılaşması katılan moleküler mekanizmalar tam olarak anlaşılamamıştır. Bu kolon epitel kriptlerin dibinde kök hücre bölmesinin hücresel sinyal ortamında anlayışımızda boşlukları içerir. Enterosit farklılaşmasını altında yatan süreçlerin artan bir ilgi vardır. Örneğin, in vivo farklılaşma anlayışı in vitro primer intestinal sistemleri 16 üretmeyi amaçlayan çalışmalar için bir kriter olarak gerekli arttı. Yukarıdaki prosedür ekstra dikkat gerektiren çeşitli adımları içerir. Öncelikle, dondurulmuş doku segmentinde etrafında kenarları (bölüm 3.2&#39;de anlatıldığı gibi) kaldırarak diseksiyon ve donma sırasında kıvrılma doku kenarları olarak gereklidir. Bu kenarları sonuçları taşımak için başarısızlık yüzeyi ve kript baz hücrelerinin karışık nüfusu. Önceden soğutulmuş, tesviye Ekim blokta doku montaj da esastır. Tonun protokolü her bir havuz bölümlerin sayısını değiştirerek distal kolon diğer alanlarda adapte edilebilir. Şekil 1B &#39;de gösterildiği gibi Örneğin, mukozal kript uzunluğu 150-300 um arasında değişir. Anüsten 4 cm 6 cm arasında bölgeyi incelemek Bu nedenle, bölme sayısı Önemlisi 30&#39;a 15&#39;e yükselmiştir gerektiğini, bu protokol proksimal kolon için tavsiye edilmez (7 cm 9 cm) nedeniyle kıvrımları ile ( Seri kesit ile ayrı yüzeyi ve kript-baz hücrelerine imkansız hale lümenine uzanan plika obliquae). Seri kesit teknikleri kript-temel çalışma ve insanlarda epitel hücre popülasyonlarının yüzey kullanılmıştır. Ancak, bizim protokol nedeniyle fare doku küçük boyutu için gerekli olan ek adımlar ekler. Yukarıdaki protokol genetik uysal fare sistemlerinde kript tabanı ve yüzey epitel hücre popülasyonunun soruşturma sağlayacak öneriyorum. Gerçekten de, bir araya getirilmiş bölümler Yield yüksek kaliteli protein ve RNA uygun aşağı analizi. Gelecekteki uygulamalar, hücre sinyal yolları veya kromatin immunoprecipitation çalışma içerebilir. Bununla birlikte, yukarıda tarif edilen alternatif yöntemler birkaç gibi, elde edilen bölümler epitelial be interstitial lamina propriya hücrelerinin bir karışımını içeren, dikkat edilmelidir. Sonuç olarak, burada tarif edilen bir protokol murin kolon mukozası uzamsal olarak ayrı bölgelerde moleküler proseslerin analizi için hızlı, yüksek verimli bir yöntem temin etmektedir.

Kolon epitel ikamet kök hücreleri birkaç günde 1 doku Yenileyici ile son derece rejeneratif doku vardır. Rejenerasyon Bu işlem, bir proliferatif kök hücre bölmesinin bakım gerektirir. Zamanla, yeni üretilen kızı hücrelerinin çoğalma potansiyeli kaybeder ve bağırsak lümen yüzeyine doğru göç ederler. Göç ile tesadüf, progenitör hücrelerin olgun bariyer oluşturan enterositlerin veya mukoza üreten goblet hücrelerine farklılaşır. Bu farklılaşma programlarının başarısızlığı, iltihabik barsak hastalığı ve kolon kanseri 2,3 gözlenmiştir gibi epitelyal bariyer tehlikeye katkı düşünülmektedir. Yukarıdaki işlemlerin detaylı bir çalışma kript-taban ve yüzey hücre popülasyonlarının izole edilmesi için metodolojileri gerektirecektir. Birden yöntemler benzersiz avantajlar ve dezavantajları, her biri mevcuttur. Intestinal epitelyal hücrelerin izolasyonu için güncel yöntemler, CHDeney koşulları, 4,5 göre, tüm kriptlerin, epitelyal levhalar, ya da tek hücreleri, izolasyonu ile sonuçlanarak elating maddeler ve mekanik ayrışma. Bu yüksek verim yöntemlerdir, fakat hücreler arası sinyal değişiklik doğal ortamından 6,7 temsil edebilir, bu koşullar altında rapor edilmiştir. Lazer yakalama mikrodiseksiyon mekansal farklı malzemenin toplanması için izin verir, ancak düşük molekül verim 8,9 ulaşır. İnsan kalın bağırsak dokusunda olarak, seri, yatay krio-bölümleme yöntemleri 10 geliştirilmiştir. Bununla birlikte, faregiller mukozal dokular, bu tekniğin, doğrudan dağıtımı ile ilgili bir engelleyici küçüktür. İnsanlarda, kolonda (kript-taban ve yüzey hücreleri arasındaki uzak) bağırsak crypt uzunlukları um 100-1000 ~ arasında 11 değişir. Farelerde, kript boyları um 50-300 ~ arasındaki (Şekil 1A bakınız). fare kript küçük boyutlu isola bir meydan okuma sunuyorMevcut protokolleri kullanarak, bu iki hücre popülasyonlarının yon. Artık, düşük maliyetli, kript-baz izolasyonu için yüksek verimli bir yöntem tarif ve murin kolon dokusunda epitel hücre popülasyonu, yüzey. Bu şekilde hasat Doku daha sonra immünofloresan boyama, RT-PCR (Anlık-Polimeraz Zincir Reaksiyonu) ve western blotting de dahil olmak üzere, standart bir sonraki uygulamada, bir dizi analiz edilebilir.

<table border="0" cellpadding="0" cellspacing="0">
	<tbody>
		<tr>
			<td>Microtome</td>
			<td>Leica Biosystems, Nussloch Germany</td>
			<td>CM 1510-3</td>
			<td></td>
		</tr>
		<tr>
			<td>MyiQ real time PCR detector</td>
			<td>BioRad</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>LSM 510&#160;</td>
			<td>Carl Zeiss</td>
			<td></td>
			<td>Confocal microscope</td>
		</tr>
		<tr>
			<td>Materials</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>OCT</td>
			<td>Tissue-Tek, Sakura Finetek, Torrance CA</td>
			<td>4583</td>
			<td></td>
		</tr>
		<tr>
			<td>cryo-mold</td>
			<td>Tissue-Tek, Sakura Finetek, Torrance CA</td>
			<td>4557</td>
			<td>25mmx20mmx5mm</td>
		</tr>
		<tr>
			<td>High profile microtome blade</td>
			<td>Leica Biosystems, Nussloch germany</td>
			<td>818</td>
			<td></td>
		</tr>
		<tr>
			<td>GEM industrial blades</td>
			<td>American Safety Razor Blades</td>
			<td>62-0314</td>
			<td></td>
		</tr>
		<tr>
			<td>Sylgard silicon elastomere base</td>
			<td>Dow Corning, Midland MI</td>
			<td>3097358</td>
			<td></td>
		</tr>
		<tr>
			<td>27 1/2 g needle</td>
			<td>Becton-Dickinson, Franklin Lakes, NJ</td>
			<td>305109</td>
			<td>pins for dissection</td>
		</tr>
		<tr>
			<td>TRizol</td>
			<td>Life Technologies</td>
			<td>15596018</td>
			<td></td>
		</tr>
		<tr>
			<td>Rneasy</td>
			<td>Qiagen</td>
			<td>74104</td>
			<td></td>
		</tr>
		<tr>
			<td>DNAse</td>
			<td>Qiagen</td>
			<td>79254</td>
			<td></td>
		</tr>
		<tr>
			<td>Reagents</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Antibody ZO-1</td>
			<td>Invitrogen&#160;</td>
			<td>187430</td>
			<td></td>
		</tr>
		<tr>
			<td>Antibody KLF4</td>
			<td>Cell Signaling</td>
			<td>4038S</td>
			<td></td>
		</tr>
		<tr>
			<td>Antibody mGAPDH</td>
			<td>Sigma</td>
			<td>G8795</td>
			<td></td>
		</tr>
		<tr>
			<td>Antibody Secondary Alexa conjugate</td>
			<td>Invitrogen</td>
			<td>A11034</td>
			<td>488 anti-rabbit</td>
		</tr>
		<tr>
			<td>Antibody Secondary HRP conjugate</td>
			<td>Jackson</td>
			<td>111/115-001-003</td>
			<td>rabbit/mouse&#160;</td>
		</tr>
		<tr>
			<td>Topro-3</td>
			<td>Invitrogen</td>
			<td>T3605</td>
			<td></td>
		</tr>
		<tr>
			<td>HANKs balanced salt buffer</td>
			<td>Life Technologies</td>
			<td>14025092</td>
			<td></td>
		</tr>
		<tr>
			<td>RIPA lysis buffer</td>
			<td></td>
			<td></td>
			<td>50mM Tris-HCl pH 7.4 150mM NaCl 1% NP40 0.25% Na-deoxycholate</td>
		</tr>
		<tr>
			<td>PCR Primers</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>primer TBP 3&#39;</td>
			<td></td>
			<td></td>
			<td>GGAATTGTACCGCAGCTTCAAA</td>
		</tr>
		<tr>
			<td>primer TBP 5&#39;</td>
			<td></td>
			<td></td>
			<td>GATGACTGCAGCAAATCGCTT</td>
		</tr>
		<tr>
			<td>primer KLF4 3&#39;</td>
			<td></td>
			<td></td>
			<td>TGTGACTATGCAGGCTGTGGCAAA</td>
		</tr>
		<tr>
			<td>primer KLF4 5&#39;</td>
			<td></td>
			<td></td>
			<td>ACAGTGGTAAGGTTTCTCGCCTGT</td>
		</tr>
	</tbody>
</table>

cryosectioning method for microdissection of murine colonic mucosa

The colonic mucosal tissue provides a vital barrier to luminal antigens. This barrier is composed of a monolayer of simple columnar epithelial cells. The colonic epithelium is dynamically turned over and epithelial cells are generated in the stem cell containing crypts of Lieberk&#252;hn. Progenitor cells produced in the crypt-bases migrate toward the luminal surface, undergoing a process of cellular differentiation before being shed into the gut lumen. In order to study these processes at the molecular level, we have developed a simple method for the microdissection of two spatially distinct regions of the colonic mucosa; the proliferative crypt zone, and the differentiated surface epithelial cells. Our objective is to isolate specific crypt and surface epithelial cell populations from mouse colonic mucosa for the isolation of RNA and protein.

Kolon doku kesitleri histolojik değerlendirme ve H &amp; E 13 boyamak için işlenmiştir. Mukoza geleneksel kesit görünüşüdür Şekil 2A&#39;da görülmektedir. Bazal alanlar ağırlıklı olarak dairesel muskularis oluşan muskularis eksterna, içerirler. Lümene doğru ilerleyerek, muscularis mukoza kript baz epitel hücreleri bitişik belirgindir, ara hücreleri doku ortasında, ve son olarak, yüzey hücre popülasyonları bağırsak lümenini karşı karşıyadır. Burada tarif edilen seri kesit yöntemi muscularis mukoza (Şekil 2C) ve ardından boyuna ve dairesel muscularis ilk (Şekil 2B) karşılaşılan şekilde bir yönlendirme korur. Görüntünün sol üst dışı kas interstisyel hücrelerin görünümünü unutmayın. Aşağı analiz aşağıda açıklanan için, kas bölümleri atılır. sonraki bölümlerde epitel hücreleri ve interstisyel doku içerirler (lamina propria), Kript baz hücreleri (Şekil 2D) ile başlanarak. Nedeniyle yakından paketlenmiş çekirdeklere koyu görünür kriptalarının, çoğunda merkezi lümenin olmadığına dikkat edin. Bu tabakalar, proliferatif bir bölme ihtiva etmektedir. geçiş hücreler sıkı belirgin santral lümen (Şekil 2E) ile bezlerini dolu görünür. Son olarak, yüzey hücre popülasyonları yüzü (Şekil 2F) tr inceledi epitel tek tabaka alanları ile, düzensiz bir yapıya sahiptir. (Burada 14 tarif edildiği gibi), yukarıda tarif edildiği gibi seri bölümler, aynı zamanda immüno-floresan etiketlemesini ve konfokal mikroskopi için işlemden geçirilebilir. Şekil 2G çekirdekleri (mavi) ve hücre-hücre birleşme kısmı proteini zonula için boyanmış, daha sonra sabit ve% 100 metanol geçirgenleştirildi ve izole crypts gösterir occludens 1 (ZO-1, yeşil). Geleneksel kesit yönde, crypt ve yüzey hücre (Şekil 2G aynı anda izlenebilir </strong&gt;). Not ZO-1 junctional leke hatları olduğunu kolon crypt lümen. Lümenin Bu Z0-1 kaplama, aynı zamanda, dairesel bezleri (Şekil 2G) merkezinde, bir geçiş hücre popülasyonlarının seri kesit örneklerde görülebilir. Gelişmiş ZO-1 leke yüzey hücre popülasyonlarının (Şekil 2I ve J) görülür. Çeşitli farklılaşma faktörleri kript-yüzey ekseni boyunca uzaysal bir şekilde ifade edilebilir olduğu bilinmektedir. Bu yüzey hücre popülasyonları açısından zenginleştirilmiş olduğu bilinen transkripsiyon faktörü Kruppel benzeri faktör 4 (Klf4) içerir. Geleneksel kesit yöntemleri kullanarak, Klf4 yüzeyi hücre popülasyonlarının (Şekil 2K) bakan lümeninin çekirdeğinde bulunan. Bu nedenle, Klf4 mRNA&#39;nm temelde, yüzey hücresi popülasyonunda ifade edilir speküle etmişlerdir. Bunu test etmek için, seri kesitler toplanmış ve yüzey, geçiş ve kript-baz örneklerinin gruba ayrıldı. Subsequediğer yönden başkaları baskın, RNA, RNeasy kolonu ve DNAz muamelesi ile ek saflaştırma, standart Trizol ekstraksiyonu kullanılarak hasat edilmiştir. RNA örnek başına toplam RNA ug 5-10 arasındaki vermiştir 5 toplanmış ardışık kısmı, toplandı. Bu numuneler daha sonra Klf4 ve bir referans gen, TATA kutusu, bağlayıcı protein 1 (TBP-1) (Şekil 2 L) 14 hem de yarı-kantitatif gerçek zamanlı PCR tabi tutuldu. Şekil 2L gösterildiği gibi, TBP-1 normale döndükten sonra, yüzey hücreleri kript hücrelerde ifade edilir 8 kat Klf4 mRNA kadar ifade etmek için bulunmuştur. Benzer şekilde, Klf4 protein seviyeleri kript yüzeyi eksen boyunca mekansal düzenleme arzettiği bulunmuştur. 4 ° C&#39;de 20 dakika süreyle liziz tamponu içinde, yukarıda tarif edilen ve daha sonra kuluçkaya yatırılır olarak seri bölümler havuzlandı. Bu örnek başına protein 200-250 mikrogram arasında vermiştir. Numuneler daha sonra, SDS-PAGE (Şekil 2 M) 15 analizler tabi tutulmuştur. Şekil 2M gösterildiği gibi, Klf4 srotein seviyeleri önemli ölçüde yüzey hücre popülasyonlarının daha yüksektir. Yukarıdaki bulgular kemirgen kolon mukozasından yüzey ve kript epitel hücrelerinin büyük miktarda izole etmek, bu protokolün yeteneğini göstermek. <img alt="Şekil 1" src="/files/ftp_upload/53112/53112fig1.jpg" /> Şekil 1: (A) şematik gösteren fare kolon mukozası ve dış kas tabakaları. Bizim yöntemi seri cryosectioning (10 um her) tarafından ayrı yüzey hücre ve kript-baz hücre popülasyonlarının toplamayı hedefliyor. Dış kas tabakaları atılır. (B) kript yüksekliği kolon (kript-baz ve yüzey tabakalara arasındaki mesafe) uzunluğu boyunca değişir. Veri noktaları bireysel kript ölçümleri ve semboller biyolojik çoğaltır bildiren (n = 4). (C) Kolon bölümleri, toplanan ikiye, ve bir silikon diseksiyon çanak üzerine tutturulmuş. Se (d) bir dokuanüsten 3 cm kadar traş makinesi bıçaklara arasında sıkıştırılmış ve kuru buz üzerinde dondurulmuştur BÖLÜMLERE GÖRE R. (E) Doku daha sonra önceden tesviye Ekim blok üzerine monte edilir. (F) Cryosections kaldırıldı ve görsel denetlenir. <img alt="Şekil 2," src="/files/ftp_upload/53112/53112fig2.jpg" /> Şekil 2:. Örnek veriler dairesel muscularis (cm) gösteren enine kesitte hematoksilin-eosin ile boyandı (A), kalın bağırsak dokusunda, muscularis mukoza (mm), kript-nokta hücreleri, geçici hücre ve yüzey hücreleri. (B - C) kolon kas tabakası. (D) Crypt-baz hücreleri. Merkezi bir lümen olmadığına dikkat edin. (E) Geçiş hücreleri. (F) Yüzey hücreleri. İzole kolon kript (G) İmmünfloresan boyama. ZO-1 (yeşil) ve çekirdek (mavi) kesit olarak görülmektedir. (HI) ZO-1 ve geçiş ve yüzey hücrelerinde nükleer boyanma. (J) ZO-1 boyama büyütülmüş görünümü. (K) Klf4 (yeşil) yüzey hücre popülasyonlarında zenginleştirilmiştir. (L) üç bölmeleri arasında Klf4 mRNA seviyelerinin real-time PCR değerlendirmesi. (E) bu hücre popülasyonunda Klf4 proteini düzeylerinin Western blot analizleri.

Watch this Scientific Journal Video about Cryosectioning Method for Microdissection of Murine Colonic Mucosa at JoVE.com

Cryosectioning Method for Microdissection of Murine Colonic Mucosa

Here we describe a simple method for the isolation of spatially distinct murine colonic epithelial surface cells from the underlying crypt-base cells.

Fare Kolon Mukozanın Mikrodisseksiyon için Cryosectioning Yöntemi

The colonic mucosal tissue provides a vital barrier to luminal antigens. This barrier is composed of a monolayer of simple columnar epithelial cells. The ...

cryosectioning-method-for-microdissection-of-murine-colonic-mucosa

Research

JoVE Journal

Biology

17.2K Görüntüleme.  Emory University, Atlanta, Georgia. Here we describe a simple method for the isolation of spatially distinct murine colonic epithelial surface cells from the underlying crypt-base cells.

Video: Cryosectioning Method for Microdissection of Murine Colonic Mucosa

Flash Freezing and Cryosectioning E12.5 Mouse Brain

Demonstrated in this video are the techniques for flash freezing and sectioning embryonic brain tissue from mouse. Useful tips for using the cryostat are given, including troubleshooting methods that can be used while cutting to ensure that the resultant tissues sections are free of cracks and other distortions.

Flaş Dondurma ve E12.5 Fare Beyin Cryosectioning

Biyoloji

Laser Capture Microdissection of Mammalian Tissue

Laser capture microscopy, also known as laser microdissection (LMD), enables the user to isolate small numbers of cells or tissues from frozen or formalin-fixed, paraffin-embedded tissue sections. LMD techniques rely on a thermo labile membrane placed either on top of, or underneath, the tissue section. In one method, focused laser energy is used to melt the membrane onto the underlying cells, which can then be lifted out of the tissue section. In the other, the laser energy vaporizes the foil along a path "drawn" on the tissue, allowing the selected cells to fall into a collection device. Each technique allows the selection of cells with a minimum resolution of several microns. DNA, RNA, protein, and lipid samples may be isolated and analyzed from micro-dissected samples. In this video, we demonstrate the use of the Leica AS-LMD laser microdissection instrument in seven segments, including an introduction to the principles of LMD, initializing the instrument for use, general considerations for sample preparation, mounting the specimen and setting up capture tubes, aligning the microscope, adjusting the capture controls, and capturing tissue specimens. Laser-capture micro-dissection enables the investigator to isolate samples of pure cell populations as small as a few cell-equivalents. This allows the analysis of cells of interest that are free of neighboring contaminants, which may confound experimental results.

Memeli Doku Lazer Yakalama Mikrodisseksiyon

Laser capture microscopy, also known as laser microdissection (LMD), enables the user to isolate small numbers of cells or tissues from frozen or ...

Microdissection of Zebrafish Embryonic Eye Tissues

Zebrafish is a popular animal model for research on eye development because of its rapid ex utero development and good fecundity. By 3 days post fertilization (dpf), the larvae will show the first visual response. Many genes have been identified to control a proper eye development, but we are far from a complete understanding of the underlying genetic architecture. Whole genome gene expression profiling is a useful tool to elucidate genetic regulatory network for eye development. However, the small size of the embryonic eye in zebrafish makes it challenging to obtain intact and pure eye tissues for expression analysis. For example, the anterior-posterior length of the eye between day 2 and 3 is only approximately 200-300 &mu;m, while the diameter of the lens is less 100 &mu;m. Also, the retinal pigment epithelium (RPE) underlying the retina is just a single-layer epithelium. While gene expression profiles can be obtained from the whole embryo, they do not accurately represent the expression of these tissues. Therefore pure tissue must be obtained for a successful gene expression profiling of eye development. To address this issue, we have developed an approach to microdissect intact retina and retina with RPE attached from 1-3 dpf, which cover major stages of eye morphogenesis. All procedures can be done with fine forceps and general laboratory supplies under standard stereomicroscopes. For retinal dissection, the single-layer RPE is removed and peeled off by brushing action and the preferential adherence of the RPE remnants to the surface of the culture plate for dissection. For RPE-attached retinal dissection, the adherence of RPE to the dissection plate is removed before the dissection so that the RPE can be completely preserved with the retina. A careful lifting action of this tissue can efficiently separate the presumptive choroid and sclera. The lens can be removed in both cases by a chemically etched tungsten needle. In short, our approach can obtain intact eye tissues and has been successfully utilized to study tissue-specific expression profiles of zebrafish retina1, 2 and retinal pigment epithelium3.

This article describes an approach to microdissect zebrafish retinas with and without retinal pigment epithelium attached, from one to three days postfertilization embryos.

Zebra balığı Embriyonik Göz Dokular, Mikrodisseksiyon

Zebrafish is a popular animal model for research on eye development because of its rapid ex utero development and good fecundity. By 3 days post ...

Microdissection of Black Widow Spider Silk-producing Glands

Modern spiders spin high-performance silk fibers with a broad range of biological functions, including locomotion, prey capture and protection of developing offspring 1,2. Spiders accomplish these tasks by spinning several distinct fiber types that have diverse mechanical properties. Such specialization of fiber types has occurred through the evolution of different silk-producing glands, which function as small biofactories. These biofactories manufacture and store large quantities of silk proteins for fiber production. Through a complex series of biochemical events, these silk proteins are converted from a liquid into a solid material upon extrusion.
Mechanical studies have demonstrated that spider silks are stronger than high-tensile steel 3. Analyses to understand the relationship between the structure and function of spider silk threads have revealed that spider silk consists largely of proteins, or fibroins, that have block repeats within their protein sequences 4. Common molecular signatures that contribute to the incredible tensile strength and extensibility of spider silks are being unraveled through the analyses of translated silk cDNAs. Given the extraordinary material properties of spider silks, research labs across the globe are racing to understand and mimic the spinning process to produce synthetic silk fibers for commercial, military and industrial applications. One of the main challenges to spinning artificial spider silk in the research lab involves a complete understanding of the biochemical processes that occur during extrusion of the fibers from the silk-producing glands.
Here we present a method for the isolation of the seven different silk-producing glands from the cobweaving black widow spider, which includes the major and minor ampullate glands [manufactures dragline and scaffolding silk] 5,6, tubuliform [synthesizes egg case silk] 7,8, flagelliform [unknown function in cob-weavers], aggregate [makes glue silk], aciniform [synthesizes prey wrapping and egg case threads] 9 and pyriform [produces attachment disc silk] 10. This approach is based upon anesthetizing the spider with carbon dioxide gas, subsequent separation of the cephalothorax from the abdomen, and microdissection of the abdomen to obtain the silk-producing glands. Following the separation of the different silk-producing glands, these tissues can be used to retrieve different macromolecules for distinct biochemical analyses, including quantitative real-time PCR, northern- and western blotting, mass spectrometry (MS or MS/MS) analyses to identify new silk protein sequences, search for proteins that participate in the silk assembly pathway, or use the intact tissue for cell culture or histological experiments.

Here we describe an efficient strategy to remove the silk-producing glands from the abdomen of female black widow spiders. This procedure allows the rapid isolation of the seven distinct silk-producing glands in a highly purified fashion, an important process for investigators studying spider silk production and fiber assembly.

Black Widow Spider İpek üreten Bezler, Mikrodisseksiyon

Modern spiders spin high-performance silk fibers with a broad range of biological functions, including locomotion, prey capture and protection of ...

A Novel Method for the Culture and Polarized Stimulation of Human Intestinal Mucosa Explants

Few models currently exist to realistically simulate the complex human intestine's micro-environment, where a variety of interactions take place. Proper homeostasis directly depends on these interactions, as they shape an entire immunological response inducing tolerance against food antigens while at the same time mounting effective immune responses against pathogenic microbes accidentally ingested with food.
Intestinal homeostasis is preserved also through various complex interactions between the microbiota (including food-associated beneficial bacterial strains) and the host, that regulate the attachment/degradation of mucus, the production of antimicrobial peptides by the epithelial barrier, and the "education" of epithelial cells' that controls the tolerogenic or immunogenic phenotype of unique, gut-resident lymphoid cells' populations. These interactions have been so far very difficult to reproduce with in vitro assays using either cultured cell lines or peripheral blood mononuclear cells. In addition, mouse models differ substantially in components of the intestinal mucosa (mucus layer organization, commensal bacteria community) with respect to the human gut. Thus, studies of a variety of treatments to be brought in the clinics for important stress-related or pathological conditions such as irritable bowel syndrome, inflammatory bowel disease or colorectal cancer have been difficult to carry out.
To address these issues, we developed a novel system that enables us to stimulate explants of human intestinal mucosa that retain their in situ conditioning by the host microbiota and immune response, in a polarized fashion. Polarized apical stimulation is of great importance for the outcome of the elicited immune response. It has been repeatedly shown that the same stimuli can produce completely different responses when they bypass the apical face of the intestinal epithelium, stimulating epithelial cells basolaterally or coming into direct contact with lamina propria components, switching the phenotype from tolerogenic to immunogenic and causing unnecessary and excessive inflammation in the area.
We achieved polarized stimulation by gluing a cave cylinder which delimited the area of stimulation on the apical face of the mucosa as will be described in the protocol. We used this model to examine, among others, differential effects of three different Lactobacilli strains. We show that this model system is very powerful to assess the immunomodulatory properties of probiotics in healthy and disease conditions.

We introduce a novel method for the maintenance of human intestinal mucosa in culture and monitoring of the response to various types of stimuli over at least 24 hrs. With our method, the polarity of the tissue is maintained, allowing for a physiological stimulation via the apical route.

İnsan bağırsak mukozasının eksplantlar Kültür ve Polarize Uyarım için Yeni Bir Yöntem

Few models currently exist to realistically simulate the complex human intestine's micro-environment, where a variety of interactions take place. Proper ...

Cryosectioning Yeast Communities for Examining Fluorescence Patterns

Microbes typically live in communities. The spatial organization of cells within a community is believed to impact the survival and function of the community1. Optical sectioning techniques, including confocal and two-photon microscopy, have proven useful for observing spatial organization of bacterial and archaeal communities2,3. A combination of confocal imaging and physical sectioning of yeast colonies has revealed internal organization of cells4. However, direct optical sectioning using confocal or two-photon microscopy has been only able to reach a few cell layers deep into yeast colonies. This limitation is likely because of strong scattering of light from yeast cells4.
Here, we present a method based on fixing and cryosectioning to obtain spatial distribution of fluorescent cells within Saccharomyces cerevisiae communities. We use methanol as the fixative agent to preserve the spatial distribution of cells. Fixed communities are infiltrated with OCT compound, frozen, and cryosectioned in a cryostat. Fluorescence imaging of the sections reveals the internal organization of fluorescent cells within the community.
Examples of yeast communities consisting of strains expressing red and green fluorescent proteins demonstrate the potentials of the cryosectioning method to reveal the spatial distribution of fluorescent cells as well as that of gene expression within yeast colonies2,3. Even though our focus has been on Saccharomyces cerevisiae communities, the same method can potentially be applied to examine other microbial communities.

We present a protocol for freezing and cryosectioning yeast communities to observe internal patterns of fluorescent cells. The method relies on methanol-fixing and OCT-embedding to preserve the spatial distribution of cells without inactivating fluorescent proteins within a community.

Floresans Desenler incelenmesi için Maya Toplulukları Cryosectioning

Microbes typically live  in communities. The spatial organization  of cells within a community is believed to impact the survival and function of the  ...

Laser-assisted Microdissection (LAM) as a Tool for Transcriptional Profiling of Individual Cell Types

The understanding of developmental processes at the molecular level requires insights into transcriptional regulation, and thus the transcriptome, at the level of individual cell types. While the methods described here are generally applicable to a wide range of species and cell types, our research focuses on plant reproduction. Plant cultivation and seed production is of crucial importance for human and animal nutrition. A detailed understanding of the regulatory networks that govern the formation of the reproductive lineage (germline) and ultimately of seeds is a precondition for the targeted manipulation of plant reproduction. In particular, the engineering of apomixis (asexual reproduction through seeds) into crop plants promises great improvements, as it leads to the formation of clonal seeds that are genetically identical to the mother plant. Consequently, the cell types of the female germline are of major importance for the understanding and engineering of apomixis. However, as the corresponding cells are deeply embedded within the floral tissues, they are very difficult to access for experimental analyses, including cell-type specific transcriptomics. To overcome this limitation, sections of individual cells can be isolated by laser-assisted microdissection (LAM). While LAM in combination with transcriptional profiling allows the identification of genes and pathways active in any cell type with high specificity, establishing a suitable protocol can be challenging. Specifically, the quality of RNA obtained after LAM can be compromised, especially when small, single cells are targeted. To circumvent this problem, we have established a workflow for LAM that reproducibly results in high RNA quality that is well suitable for transcriptomics, as exemplified here by the isolation of cells of the female germline in apomictic Boechera. In this protocol, procedures are described for tissue preparation and LAM, also with regard to RNA extraction and quality control.

Laser-assisted Microdissection LAM as a Tool for Transcriptional Profiling of Individual Cell Types

Here we present a protocol for laser-assisted microdissection of specific plant cell types for transcriptional profiling. While the protocol is suitable for different species and cell types, the focus is on highly inaccessible cells of the female germline important for sexual and apomictic reproduction in the crucifer genus Boechera.

Bireysel Hücre Tiplerinin transkripsiyonel Profiling için bir alet olarak lazer destekli mikrodiseksiyon (LAM)

The understanding of developmental processes at the molecular level requires insights into transcriptional regulation, and thus the transcriptome, at the ...

Cryosectioning of Contiguous Regions of a Single Mouse Skeletal Muscle for Gene Expression and Histological Analyses

With this method, consecutive cryosections are collected to enable both microscopy applications for tissue histology and enrichment of RNA for gene expression using adjacent regions from a single mouse skeletal muscle. Typically, it is challenging to achieve adequate homogenization of small skeletal muscle samples because buffer volumes may be too low for efficient grinding applications, yet without sufficient mechanical disruption, the dense tissue architecture of muscle limits penetration of buffer reagents, ultimately causing low RNA yield. By following the protocol reported here, 30 &#956;m sections are collected and pooled allowing cryosectioning and subsequent needle homogenization to mechanically disrupt the muscle, increasing the surface area exposed for buffer penetration. The primary limitations of the technique are that it requires a cryostat, and it is relatively low throughput. However, high-quality RNA can be obtained from small samples of pooled muscle cryosections, making this method accessible for many different skeletal muscles and other tissues. Furthermore, this technique enables matched analyses (e.g., tissue histopathology and gene expression) from adjacent regions of a single skeletal muscle so that measurements can be directly compared across applications to reduce experimental uncertainty and to reduce replicative animal experiments necessary to source a small tissue for multiple applications.

Consecutive cryo-sections are collected to enable histological applications and enrichment of RNA for gene expression measurements using adjacent regions from a single mouse skeletal muscle. High-quality RNA is obtained from 20 - 30 mg of pooled cryosections and measurements are directly compared across applications.

Gen İfade ve histolojik Analizler Tek Fare İskelet Kası bitişik Bölgeler Cryosectioning

With this method, consecutive cryosections are collected to enable both microscopy applications for tissue histology and enrichment of RNA for gene ...

A Morphometric and Cellular Analysis Method for the Murine Mandibular Condyle

The temporomandibular joint (TMJ) has the capacity to adapt to external stimuli, and loading changes can affect the position of condyles, as well as the structural and cellular components of the mandibular condylar cartilage (MCC). This manuscript describes methods for analyzing these changes and a method for altering the loading of the TMJ in mice (i.e., compressive static TMJ loading). The structural evaluation illustrated here is a simple morphometric approach that uses the Digimizer software and is performed in radiographs of small bones. In addition, the analysis of cellular changes leading to alterations in collagen expression, bone remodeling, cell division, and proteoglycan distribution in the MCC is described. The quantification of these changes in histological sections - by counting the positive fluorescent pixels using image software and measuring the distance mapping and stained area with Digimizer - is also demonstrated. The methods shown here are not limited to the murine TMJ, but could be used on additional bones of small experimental animals and in other regions of endochondral ossification.

This manuscript presents methods for analyzing morphometric and cellular changes within the mandibular condyle of rodents.

Bir xarakteristikaları ve fare çene kemiğinde düzgün için hücresel analiz yöntemi

The temporomandibular joint (TMJ) has the capacity to adapt to external stimuli, and loading changes can affect the position of condyles, as well as the ...

Laser Capture Microdissection of Highly Pure Trabecular Meshwork from Mouse Eyes for Gene Expression Analysis

Laser capture microdissection (LCM) has allowed gene expression analysis of single cells and enriched cell populations in tissue sections. LCM is a great tool for the study of the molecular mechanisms underlying cell differentiation and the development and progression of various diseases, including glaucoma. Glaucoma, which comprises a family of progressive optic neuropathies, is the most common cause of irreversible blindness worldwide. Structural changes and damage within the trabecular meshwork (TM) can result in increased intraocular pressure (IOP), which is a major risk factor for developing glaucoma. However, the precise molecular mechanisms involved are still poorly understood. The ability to perform gene expression analysis will be crucial in obtaining further insights into the function of these cells and its role in the regulation of IOP and glaucoma development. To achieve this, a reproducible method for isolating highly enriched TM from frozen sections of mouse eyes and a method for downstream gene expression analysis, such as RT-qPCR and RNA-Seq is needed. The method described herein is developed to isolate highly pure TM from mouse eyes for downstream digital PCR and microarray analysis. In addition, this technique can be easily adapted for the isolation of other highly enriched ocular cells and cell compartments that have been difficult to isolate from mouse eyes. The combination of LCM and RNA analysis can contribute to a more comprehensive understanding of the cellular events underlying glaucoma.

Here, we describe a protocol for a reproducible laser capture microdissection (LCM) for isolating trabecular meshwork (TM) for downstream RNA analysis. The ability to analyze changes in gene expression in the TM will help in understanding the underlying molecular mechanisms of TM-related ocular diseases.

Lazer yakalama mikrodiseksiyon son derece saf trabeküler Meshwork gen ifade analizi için fare gözlerinden

Laser capture microdissection (LCM) has allowed gene expression analysis of single cells and enriched cell populations in tissue sections. LCM is a great ...