Supported by National Institutes of Health (DK55679, and DK59888 to A.N.). Emory University&#160;Integrated Cellular Imaging Microscopy Core of the Winship Cancer&#160;Institute comprehensive cancer center grant, P30CA138292, and the Crohn's and Colitis Foundation of America Career Development award to C.T.C. and Fellowship Award to A.E.F.

실험은 나이 10 12 주 사이에 C57BL / 6 마​​우스를 사용했다. 동물을 사용하는 모든 절차를 검토하고에 모리 대학 기관 동물 관리 및 사용위원회의 승인을 보건 기준의 국립 연구소에 따라 수행 하였다되었다. 1. 실험 설정 <ol><li> 의 저온는 설정 <ol><li> 마이크로톰 블레이드와 척을 포함, -20 ° C의 저온 유지 장치를 평형 (블레이드 주위에 극단적 인주의를 기울여야!). </li><li> 10월와 빈 cryomold (최적의 절단 온도 화합물)를 작성하고 -20 ° C (~ 30 분)에 평형. 금형에서 냉동 OCT를 제거하고 액체 월에 척에 고정합니다. 마이크로톰 팔 블록 / 척을 배치하고 OCT를 10 분 동안 설정할 수 있습니다. </li><li> 섹션 당 10 μm의 저온 유지 장치를 설정하고 평면 때까지 OCT의 블록을 면도. 몇 센티미터 떨어진 날로부터 마이크로톰 팔을 백업합니다. 이 시점에서 EXPER의 나머지 날 또는 척을 조정하지 마십시오iment. </li></ol></li><li> 면도날을 준비 : 샘플 당 2 면도날을 준비합니다. 금속 파일을 사용하여, 블레이드 에지의 sharped 무딘. 다음, 집게와 알루미늄 플랜지를 제거합니다. </li><li> 드라이 아이스에 파이렉스 접시 또는 기타 평평한 표면을 사전 진정. </li><li> 10 ~ 15 해부 핀 해부 접시를 준비합니다. 실리콘 가득 10cm 조직 배양 접시 50 %는 충분합니다. 실온에서 행크스 버퍼의 5 ML을 추가합니다. </li></ol> 원위부 대장 조직의 2 해부 <ol><li> 이소 플루 란 흡입 자궁 전위에 의해 장소 밀폐 된 챔버에 마우스 및 마우스 안락사 후 복부와 흉부 (12)에 70 % 에탄올을 스프레이. </li><li> 가위로 복부의 피부에 작은 절개를 한 후 절개가 복강을 노출 할 수 있습니다. 비슷한 절차는 여기에 12 설명 찾을 수 있습니다. </li><li> 항문에서 대장을 잘라 대장이 될 때까지 장간막을 떨어져 애타게. </li><li> 원위 결장을 절제항문에서 0 ~ 6cm 사이의 세그먼트. 여기서, 토굴 깊이 ~ 150 μm의 (도 1b 참조). 가위를 사용하여 길이 방향으로 결장을 열고 배설물 내용을 제거 컷. </li><li> 점막면이 위를 향하도록 해부 접시에 조직을 핀입니다. 행크스 완충액 실리콘 접시 조직 절개하여 핀 늘려서 RT (도 1C)에서 10 분 동안 휴식을 보자. 이 조직에서 주름을 제거하고 근육 층 휴식 할 수 있습니다. </li></ol> 단면 용의 저온 3. 마운트 조직 <ol><li> 조직의 원하는 섹션에서 면도날을 밀어 다음 행크스 버퍼를 붓는다. 샌드위치를​​ 만들고, 상단에 다른 면도날을 추가합니다. 조직 세그먼트를 잘라 핀을 제거합니다. 드라이 아이스에 면도날 / 조직 샌드위치를​​ 전송합니다. (5 ~ 10 분, 그림 1D) 조직이 동결하도록 허용합니다. </li><li> 면도기 / 조직 샌드위치를​​ 들고는 상단 (BL)에 손가락을 배치하여 약간 따뜻하게 할 수ADE (점막면이 위로. 이것은 기저 근육층 먼저 절단되도록 조직 배향.). 샌드위치 분리하여 조직 세그먼트의 가장자리 주위 잘랐다. 조직 세그먼트 약 0.5 센티미터 X 1cm를 잘라. 엣지 영역이 직렬 섹션 많은 조직층을 포함하는 원인 컬링하는 경향이있다. 이상 절단에서 절단보다 더 사용한다는 점에 유의주의의 측면에 잘못. </li><li> 조직의 상단에있는 얼음이 녹기 시작 때까지 조직을 따뜻하게 할 수 있습니다. 이 시점에서 신속하고 신중하게 저온 유지 장치에 OCT의 블록으로 조직을 누릅니다. </li><li> 샘플을 통해 손가락을 배치하여 블레이드를 분리합니다. 열 전달은 조직을 방해하지 않고 블레이드를 제거 할 수 있습니다. </li><li> 코트 OCT를 가진 조직과는 5 분 동안 평형. 10 μm의 (그림 1E, F)에서 섹션을 잘라. 지하실이 볼 때까지 시각적으로 섹션을 검사합니다. 1.5 ml의 튜브 또는 슬라이드에 배치 섹션. </li><li> 의 mRNA 또는 단백질, 장소 (T)의 분석을 위해5 토굴베이스, 과도 (5), 및 튜브 당 5 표면 섹션 튜브에 그 샘플. RNA 수집을위한 1 ml의에게 상업 분리 시약을 추가하고 실온에서 10 분 동안 품어. 제조업체의 지침에 따라 RNA 정화를 수행합니다. cDNA의 생성을 위해 전체 RNA의 5 ~ 10 μg의를 사용합니다. </li><li> 단백질 정제의 경우, 차가운 RIPA 0.5 ml의 5 섹션 당 버퍼 (플러스 단백질 분해 효소 억제제)를 용해 추가합니다. 얼음에서 70 % 주기로 3 회 초음파 처리. <ol><li> SDS 페이지 로딩 버퍼 (램 믈리 버퍼)에 샘플을 추가하고 10 분 동안 100 ° C에서 품어. SDS 페이지 및 전송에 따라 샘플은 다음 2 시간 동안 5 % 우유 / PBS에 차단합니다. (500 1) 4 ℃에서 O / N KLF4 항체와 인큐베이션 웨스턴 블롯 분석을 수행합니다. </li></ol></li></ol>

<ol>
	<li>Noah, T. K., Donahue, B., Shroyer, N. F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Intestinal+development+and+differentiation.">Intestinal development and differentiation.</a> Exp Cell Res. 317, 2702-2710 (2011).</li><li>Humphries, A., Wright, N. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Colonic+crypt+organization+and+tumorigenesis.">Colonic crypt organization and tumorigenesis.</a> Nat Rev Cancer. 8, 415-424 (2008).</li><li>Weber, C. R., Turner, J. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Inflammatory+bowel+disease:+is+it+really+just+another+break+in+the+wall.">Inflammatory bowel disease: is it really just another break in the wall.</a> Gut. 56, 6-8 (2007).</li><li>Bjerknes, M., Cheng, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Methods+for+the+isolation+of+intact+epithelium+from+the+mouse+intestine.">Methods for the isolation of intact epithelium from the mouse intestine.</a> Anat Rec. 199, 565-574 (1981).</li><li>Sato, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Single+Lgr5+stem+cells+build+crypt-villus+structures+in+vitro+without+a+mesenchymal+niche.">Single Lgr5 stem cells build crypt-villus structures in vitro without a mesenchymal niche.</a> Nature. 459, 262-265 (2009).</li><li>Rand, M. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Calcium+depletion+dissociates+and+activates+heterodimeric+notch+receptors.">Calcium depletion dissociates and activates heterodimeric notch receptors.</a> Mol Cell Biol. 20, 1825-1835 (2000).</li><li>Gjorevski, N., Boghaert, E., Nelson, C. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Regulation+of+Epithelial-Mesenchymal+Transition+by+Transmission+of+Mechanical+Stress+through+Epithelial+Tissues.">Regulation of Epithelial-Mesenchymal Transition by Transmission of Mechanical Stress through Epithelial Tissues.</a> Cancer Microenviron. 5, 29-38 (2012).</li><li>Lechner, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Gene+expression+pattern+of+laser+microdissected+colonic+crypts+of+adenomas+with+low+grade+dysplasia.">Gene expression pattern of laser microdissected colonic crypts of adenomas with low grade dysplasia.</a> Gut. 52, 1148-1153 (2003).</li><li>Reizel, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Colon+stem+cell+and+crypt+dynamics+exposed+by+cell+lineage+reconstruction.">Colon stem cell and crypt dynamics exposed by cell lineage reconstruction.</a> PLoS Genet. 7, e1002192 (2011).</li><li>Kosinski, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Gene+expression+patterns+of+human+colon+tops+and+basal+crypts+and+BMP+antagonists+as+intestinal+stem+cell+niche+factors.">Gene expression patterns of human colon tops and basal crypts and BMP antagonists as intestinal stem cell niche factors.</a> Proc Natl Acad Sci U S A. 104, 15418-15423 (2007).</li><li>Tamura, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Pit+pattern+and+three-dimensional+configuration+of+isolated+crypts+from+the+patients+with+colorectal+neoplasm.">Pit pattern and three-dimensional configuration of isolated crypts from the patients with colorectal neoplasm.</a> J Gastroenterol. 37, 798-806 (2002).</li><li>Geem, D., Medina-Contreras, O., Kim, W., Huang, C. S., Denning, T. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Isolation+and+characterization+of+dendritic+cells+and+macrophages+from+the+mouse+intestine.">Isolation and characterization of dendritic cells and macrophages from the mouse intestine.</a> Journal of visualized experiments : JoVE. , e4040 (2012).</li><li>Laukoetter, M. G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=JAM-A+regulates+permeability+and+inflammation+in+the+intestine+in+vivo.">JAM-A regulates permeability and inflammation in the intestine in vivo.</a> J Exp Med. 204, 3067-3076 (2007).</li><li>Neumann, P. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Gut+commensal+bacteria+and+regional+Wnt+gene+expression+in+the+proximal+versus+distal+colon.">Gut commensal bacteria and regional Wnt gene expression in the proximal versus distal colon.</a> Am J Pathol. 184, 592-599 (2014).</li><li>Capaldo, C. T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Proinflammatory+cytokine-induced+tight+junction+remodeling+through+dynamic+self-assembly+of+claudins.">Proinflammatory cytokine-induced tight junction remodeling through dynamic self-assembly of claudins.</a> Mol Biol Cell. 25, 2710-2719 (2014).</li><li>Wells, J. M., Spence, J. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=How+to+make+an+intestine.">How to make an intestine.</a> Development. 141, 752-760 (2014).</li></ol>

The authors have nothing to disclose

대장 상피 세포 증식 및 분화에 관여하는 분자 메커니즘이 제대로 이해된다. 이 대장 상피 지하실의 기지에서 줄기 세포 구획의 세포 신호 환경에 대한 우리의 이해의 간격을 포함한다. enterocyte 분화의 기초 처리에 대한 관심의 증가가있다. 예를 들어, 생체 내 분화의 이해 체외 차 장 시스템 (16)을 생산하기위한 연구에 대한 벤치 마크 필요 증가했다. 위의 절차를 추가 작업이 필요한 여러 단계가 포함되어 있습니다. 첫째, 냉동 조직 세그먼트 주위의 가장자리를 (3.2 절에서 논의 된 바와 같이)를 제거하는 해부 및 동결시 컬 조직의 가장자리로 필요합니다. 이 가장자리 결과를 이동하지 않으면 표면과 토굴 기본 세포의 혼합 인구입니다. 미리 냉장, 수평 10월 블록에 조직을 설치하는 것은 필수적이다. 티그 프로토콜은 각 풀 섹션 번호를 변경하여 원위 결장의 다른 영역에 적용 할 수있다. 도 1b에 도시 된 바와 같이 예를 들어, 점막 토굴 길이는 150-300 μm의 사이에서 변화한다. 항문에서 4cm-6cm 사이의 영역을 공부할 때 따라서, 섹션의 수가 중요한 것은 30 15 증가한다,이 프로토콜은 근위 대장에 대한 제안되지 않는다 (7 CM-9cm)에 의한 주름에 ( 시리얼 절편에 의한 별도의 표면과 토굴 기반 세포를 할 수 없도록 루멘으로 확장 plicae obliquae). 직렬 단면 기법 토굴 계를 연구 및 인간 상피 세포 집단을 표면에 사용되어왔다. 그러나, 우리의 프로토콜에 의한 쥐의 조직의 작은 크기에 필요한 추가 단계를 추가합니다. 우리는 상기 프로토콜 유전자 취급 용이 마우스 시스템에 토굴 계 및 표면 상피 세포 집단의 조사를 허용 것이라고 제안한다. 실제로, 풀 섹션 yieLD 고품질 단백질 및 RNA 적합한 하류 분석. 미래의 응용 프로그램은 세포 신호 전달 경로 또는 크로 마틴 면역의 연구를 포함 할 수있다. 그러나, 전술 한 다른 방법의 여러 원한다면, 결과 섹션 상피와 점막 고유 간질 세포의 혼합물을 포함하고 있음을 주목해야한다. 결론적으로, 여기에 설명 된 프로토콜은 뮤린 대장 점막의 공간적으로 별개의 영역에서 분자 수준의 분석을위한 신속하고 높은 수율의 방법을 제공한다.

결장 상피 라이닝 상주 ​​줄기 세포가 수일마다 한 조직 보급과 고도로 재생 조직이다. 이러한 재생 처리는 증식 성 줄기 세포 구획의 유지 보수를 필요로한다. 시간이 지남에 따라 새로 생성 된 딸 세포는 증식 잠재력을 잃고 장의 내강면을 향해 이동한다. 마이그레이션과 일치는 전구 세포는 성숙한 배리어 형성 장 세포 또는 점액 생산 배 세포로 분화. 이 분화 프로그램의 실패는 염증성 장 질환 및 결장암 2,3-에서 관찰 된 바와 같이 상피 장벽을 저하에 기여하는 것으로 생각된다. 위의 과정의 자세한 연구는 토굴베이스 및 표면 세포 인구를 분리하는 방법이 필요합니다. 여러 방법이 고유 한 장점과 단점이 각각 존재한다. 장 상피 세포의 분리를위한 현재의 방법은 채널을 포함실험 조건에 의존하는 전체 4,5- 지하실, 상피 시트, 또는 단일 세포의 분리 결과 elating 에이전트 및 기계적 해리. 이러한 높은 수율의 방법이 있습니다, 아직 세포 간 신호의 변화는 네이티브 환경 6,7를 대표하지 않을 수 있습니다 이러한 조건에서보고되었다. 레이저 캡처 미세 절제는 공간 별개의 자료의 수집을 허용하지만, 저 분자량 수익률 8,9을 달성한다. 인간 결장 조직, 일련의 수평 저온 절편 방법 10이 개발되었다. 그러나 쥐의 점막 조직이 기술의 직접 처분에 대한 엄청나게 작다. 사람에서 대장 (지하실베이스 및 표면 세포 사이의 먼) 장 토굴 길이는 μm의 100-1,000 ~ 11 사이의 다릅니다. 마우스에서, 지하실 길이는 μm의 50-300 ~ 사이 (그림 1A 참조)이다. 쥐 지하실의 작은 크기는 솔라에 도전을 선물한다기존의 프로토콜을 사용하여 두 세포 집단의 기. 우리는 이제 저렴한 비용으로, 토굴베이스의 분리를위한 높은 수율 방법을 설명하고 쥐의 대장 조직에서 상피 세포 인구 표면. 이러한 방식으로 수확 된 조직을 면역 염색 한 다음, RT-PCR (실시간 중합 효소 연쇄 반응) 또는 웨스턴 블 롯팅을 포함하여 표준 하류 애플리케이션들에 의해 분석 될 수있다.

<table border="0" cellpadding="0" cellspacing="0">
	<tbody>
		<tr>
			<td>Microtome</td>
			<td>Leica Biosystems, Nussloch Germany</td>
			<td>CM 1510-3</td>
			<td></td>
		</tr>
		<tr>
			<td>MyiQ real time PCR detector</td>
			<td>BioRad</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>LSM 510&#160;</td>
			<td>Carl Zeiss</td>
			<td></td>
			<td>Confocal microscope</td>
		</tr>
		<tr>
			<td>Materials</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>OCT</td>
			<td>Tissue-Tek, Sakura Finetek, Torrance CA</td>
			<td>4583</td>
			<td></td>
		</tr>
		<tr>
			<td>cryo-mold</td>
			<td>Tissue-Tek, Sakura Finetek, Torrance CA</td>
			<td>4557</td>
			<td>25mmx20mmx5mm</td>
		</tr>
		<tr>
			<td>High profile microtome blade</td>
			<td>Leica Biosystems, Nussloch germany</td>
			<td>818</td>
			<td></td>
		</tr>
		<tr>
			<td>GEM industrial blades</td>
			<td>American Safety Razor Blades</td>
			<td>62-0314</td>
			<td></td>
		</tr>
		<tr>
			<td>Sylgard silicon elastomere base</td>
			<td>Dow Corning, Midland MI</td>
			<td>3097358</td>
			<td></td>
		</tr>
		<tr>
			<td>27 1/2 g needle</td>
			<td>Becton-Dickinson, Franklin Lakes, NJ</td>
			<td>305109</td>
			<td>pins for dissection</td>
		</tr>
		<tr>
			<td>TRizol</td>
			<td>Life Technologies</td>
			<td>15596018</td>
			<td></td>
		</tr>
		<tr>
			<td>Rneasy</td>
			<td>Qiagen</td>
			<td>74104</td>
			<td></td>
		</tr>
		<tr>
			<td>DNAse</td>
			<td>Qiagen</td>
			<td>79254</td>
			<td></td>
		</tr>
		<tr>
			<td>Reagents</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Antibody ZO-1</td>
			<td>Invitrogen&#160;</td>
			<td>187430</td>
			<td></td>
		</tr>
		<tr>
			<td>Antibody KLF4</td>
			<td>Cell Signaling</td>
			<td>4038S</td>
			<td></td>
		</tr>
		<tr>
			<td>Antibody mGAPDH</td>
			<td>Sigma</td>
			<td>G8795</td>
			<td></td>
		</tr>
		<tr>
			<td>Antibody Secondary Alexa conjugate</td>
			<td>Invitrogen</td>
			<td>A11034</td>
			<td>488 anti-rabbit</td>
		</tr>
		<tr>
			<td>Antibody Secondary HRP conjugate</td>
			<td>Jackson</td>
			<td>111/115-001-003</td>
			<td>rabbit/mouse&#160;</td>
		</tr>
		<tr>
			<td>Topro-3</td>
			<td>Invitrogen</td>
			<td>T3605</td>
			<td></td>
		</tr>
		<tr>
			<td>HANKs balanced salt buffer</td>
			<td>Life Technologies</td>
			<td>14025092</td>
			<td></td>
		</tr>
		<tr>
			<td>RIPA lysis buffer</td>
			<td></td>
			<td></td>
			<td>50mM Tris-HCl pH 7.4 150mM NaCl 1% NP40 0.25% Na-deoxycholate</td>
		</tr>
		<tr>
			<td>PCR Primers</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>primer TBP 3&#39;</td>
			<td></td>
			<td></td>
			<td>GGAATTGTACCGCAGCTTCAAA</td>
		</tr>
		<tr>
			<td>primer TBP 5&#39;</td>
			<td></td>
			<td></td>
			<td>GATGACTGCAGCAAATCGCTT</td>
		</tr>
		<tr>
			<td>primer KLF4 3&#39;</td>
			<td></td>
			<td></td>
			<td>TGTGACTATGCAGGCTGTGGCAAA</td>
		</tr>
		<tr>
			<td>primer KLF4 5&#39;</td>
			<td></td>
			<td></td>
			<td>ACAGTGGTAAGGTTTCTCGCCTGT</td>
		</tr>
	</tbody>
</table>

cryosectioning method for microdissection of murine colonic mucosa

The colonic mucosal tissue provides a vital barrier to luminal antigens. This barrier is composed of a monolayer of simple columnar epithelial cells. The colonic epithelium is dynamically turned over and epithelial cells are generated in the stem cell containing crypts of Lieberk&#252;hn. Progenitor cells produced in the crypt-bases migrate toward the luminal surface, undergoing a process of cellular differentiation before being shed into the gut lumen. In order to study these processes at the molecular level, we have developed a simple method for the microdissection of two spatially distinct regions of the colonic mucosa; the proliferative crypt zone, and the differentiated surface epithelial cells. Our objective is to isolate specific crypt and surface epithelial cell populations from mouse colonic mucosa for the isolation of RNA and protein.

대장 조직 섹션은 조직 학적 평가와 H &amp; E (13)를 염색 처리했다. 점막 전통적인 단면도는도 2a에서 볼 수있다. 기저 영역은 주로 원형 근층 구성 근층의 실외가 포함되어 있습니다. 루멘을 향해 진행되어, 근층 점막이 토굴 계 상피 세포에 인접 명백, 전이 세포는 조직의 중간에 있고, 마지막으로 표면 세포 집단은 장내 루멘에 직면한다. 여기에 설명 된 일련 절편 방법은 점막 근육 판 (도 2C)이어서 종 및 원형 근층 처음 (도 2B)에 발생되도록 배향을 유지한다. 화상의 상부 좌측 비 - 근육 간질 세포의 모양을 참고. 다운 스트림 분석 아래에 설명을 위해, 근육 부분은 삭제됩니다. 다음 섹션은 상피 세포 및 간질 조직을 포함 (고유 층), 토굴 기반 세포 (그림 2D)로 시작. 인해 치밀한 핵으로 어둡게 나타나는 지하실, 대부분의 중앙 루멘의 부재를 참고. 이 층은 증식 성 구획을 포함합니다. 전환 세포는 단단히 눈에 띄는 중앙 루멘 (그림 2E)과 땀샘을 포장 나타납니다. 마지막으로, 표면의 세포 집단은 얼굴 (그림 2 층) KO 볼 상피 단층 지역으로, 불규칙적 인 구조를 가지고있다. (여기에서 (14)의 설명 참조) 전술 한 바와 같이 직렬 섹션은 또한 면역 표지 및 공 초점 현미경에 대해 처리 될 수있다.도 2G는 핵 (청색) 및 세포 - 세포 접합 단백질 Zonula 스테인드이어서 고정 및 100 % 메탄올 투과성이 고립 된 소낭을 보여 Occludens 1 (ZO-1, 녹색). 기존의 단면 방향에서, 지하실 및 표면 세포 (그림 2G를 동시에 볼 수 있습니다 </stronG&gt;). 참고 ZO-1 접합부 얼룩 라인이 대장 토굴의 루멘. 루멘이 Z0-1 라이닝 또한 원형 땀샘 (도 2G)의 중심에, 이행 세포 개체군의 직렬 단면 시료에서 볼 수있다. 향상된 ZO-1 얼룩 표면 세포 집단 (그림 2I 및 J)에서 볼 수있다. 몇몇 분화 인자 토굴 투면 축을 따라 시공간 방식으로 발현되는 것으로 알려져있다. 이것은 표면의 세포 집단이 풍부한 것으로 알려진 전사 인자 크 룹펠 같은 인자 4 (KLF4)를 포함한다. 전통적인 단면 처리 방법을 사용하여, KLF4 표면 세포 집단 (도 2K)를 대향 루멘의 핵에서 발견된다. 따라서 우리는 KLF4 mRNA를 주로 표면의 세포 집단으로 표현 될 것이라고 추측했다. 이를 테스트하려면, 직렬 섹션 수집 및 표면, 전이, 그리고 토굴베이스 샘플로 분류 하였다. Subsequently, RNA를 분리하고, RNeasy 열 및 DNase의 처리에 의해 추가로 정제하여, 표준 트리 졸 추출을 사용하여 수확했다. RNA를 샘플 당 총 RNA의 μg의 5 ~ 10 사이에 굴복 5 풀링 연속 섹션에서 수집되었다. 이 샘플은 다음과 KLF4 기준 유전자, TATA 박스 결합 단백질 1 (TBP-1) (도 2L) (14) 모두에 대해 반 정량적 실시간 PCR을 실시 하였다. 도 2L에 나타내는 바와 같이, TBP-1로 정규화 한 후, 세포 표면 토굴 세포에서 발현되는 8 배까지 KLF4 mRNA를 발현하는 것으로 확인되었다. 마찬가지로 KLF4 단백질 수준 토굴면 축을 따라 공간적 조절을 나타내는 것으로 밝혀졌다. 4 ° C에서 20 분 동안 용해 완충액에서 상술하고 인큐베이션 시리얼 섹션 모았다. 이 샘플 당 단백질의 200-250 μg의 사이에 굴복. 샘플은 SDS-PAGE (도 2M) (15)에 의해 분석을 실시 하였다. 도 2M에 도시 된 바와 같이, 피 KLF4rotein 레벨은 극적 표면 세포 집단에서 더 높다. 상기 결과는 뮤린 결장 점막 표면과 토굴 상피 세포 대량 분리하는이 프로토콜의 능력을 입증한다. <img alt="그림 1" src="/files/ftp_upload/53112/53112fig1.jpg" /> 그림 1 : (A) 도식 보여주는 쥐의 대장 점막 및 외부 근육 층. 우리의 방법은 시리얼 냉동 절편 (10 μm의 각)에 의해 분리 된 표면 셀과 토굴 기반 세포 인구를 수집하는 것을 목표로하고있다. 외부 근육 층은 삭제됩니다. (B) 크립트 높이가 콜론 (토굴베이스 및 표면 층 사이의 거리)의 길이를 따라 달라집니다. 데이터 포인트는 개별 토굴 측정 및 심볼 생물학적 복제를 나타내는 표시 (N = 4). (C) 결장 세그먼트 수집 타개 및 실리콘 해부 접시 상에 고정. SE (D) 조직항문에서 약 3cm가 면도날에 사이에 누를 드라이 아이스에 냉동되어 gment. (E) 조직은 사전 평탄화 OCT 블록에 장착된다. (F) 저온부 제거하고 시각적으로 검사한다. <img alt="그림 2" src="/files/ftp_upload/53112/53112fig2.jpg" /> 그림 2. 대표 데이터 원형 근층 (cm)를 보여주는 단면도 헤 마톡 실린 - 에오신 염색 (A) 결장 조직 근층 점막 (mm), 토굴 계 세포 전이 세포 및 표면 세포. (B - C) 대장 근육 층. (D) 크립트 기반 세포. 중앙 루멘의 부재를 참고. (E) 과도 세포. (F) 표면 세포. 격리 된 대장 지하실의 (G) 면역 형광 염색법. ZO-1 (녹색) 및 핵 (청색)의 단면이 관찰된다. (안녕) ZO-1과 이행 및 표면 세포에서 핵 염색. (J) ZO-1 염색의 확대도. (K) KLF4 (녹색)는 표면의 세포 집단에 충실. (L) 세 구획 사이의 KLF4 mRNA 수준의 실시간 PCR 평가. (M)이 세포 집단에서 KLF4 단백질 수준의 웨스턴 블롯 분석.

Watch this Scientific Journal Video about Cryosectioning Method for Microdissection of Murine Colonic Mucosa at JoVE.com

Cryosectioning Method for Microdissection of Murine Colonic Mucosa

Here we describe a simple method for the isolation of spatially distinct murine colonic epithelial surface cells from the underlying crypt-base cells.

쥐 대장 점막의 이외에 Microdissection을위한 냉동 절편 방법

The colonic mucosal tissue provides a vital barrier to luminal antigens. This barrier is composed of a monolayer of simple columnar epithelial cells. The ...

cryosectioning-method-for-microdissection-of-murine-colonic-mucosa

Research

JoVE Journal

Biology

17.2K 조회수.  Emory University, Atlanta, Georgia. Here we describe a simple method for the isolation of spatially distinct murine colonic epithelial surface cells from the underlying crypt-base cells.

비디오: Cryosectioning Method for Microdissection of Murine Colonic Mucosa

Flash Freezing and Cryosectioning E12.5 Mouse Brain

Demonstrated in this video are the techniques for flash freezing and sectioning embryonic brain tissue from mouse. Useful tips for using the cryostat are given, including troubleshooting methods that can be used while cutting to ensure that the resultant tissues sections are free of cracks and other distortions.

플래시 동결 E12.5 마우스 브레인 Cryosectioning

연구

생물학

Laser Capture Microdissection of Mammalian Tissue

Laser capture microscopy, also known as laser microdissection (LMD), enables the user to isolate small numbers of cells or tissues from frozen or formalin-fixed, paraffin-embedded tissue sections. LMD techniques rely on a thermo labile membrane placed either on top of, or underneath, the tissue section. In one method, focused laser energy is used to melt the membrane onto the underlying cells, which can then be lifted out of the tissue section. In the other, the laser energy vaporizes the foil along a path "drawn" on the tissue, allowing the selected cells to fall into a collection device. Each technique allows the selection of cells with a minimum resolution of several microns. DNA, RNA, protein, and lipid samples may be isolated and analyzed from micro-dissected samples. In this video, we demonstrate the use of the Leica AS-LMD laser microdissection instrument in seven segments, including an introduction to the principles of LMD, initializing the instrument for use, general considerations for sample preparation, mounting the specimen and setting up capture tubes, aligning the microscope, adjusting the capture controls, and capturing tissue specimens. Laser-capture micro-dissection enables the investigator to isolate samples of pure cell populations as small as a few cell-equivalents. This allows the analysis of cells of interest that are free of neighboring contaminants, which may confound experimental results.

포유 동물 조직의 레이저 캡처 Microdissection

Laser capture microscopy, also known as laser microdissection (LMD), enables the user to isolate small numbers of cells or tissues from frozen or ...

Microdissection of Zebrafish Embryonic Eye Tissues

Zebrafish is a popular animal model for research on eye development because of its rapid ex utero development and good fecundity. By 3 days post fertilization (dpf), the larvae will show the first visual response. Many genes have been identified to control a proper eye development, but we are far from a complete understanding of the underlying genetic architecture. Whole genome gene expression profiling is a useful tool to elucidate genetic regulatory network for eye development. However, the small size of the embryonic eye in zebrafish makes it challenging to obtain intact and pure eye tissues for expression analysis. For example, the anterior-posterior length of the eye between day 2 and 3 is only approximately 200-300 &mu;m, while the diameter of the lens is less 100 &mu;m. Also, the retinal pigment epithelium (RPE) underlying the retina is just a single-layer epithelium. While gene expression profiles can be obtained from the whole embryo, they do not accurately represent the expression of these tissues. Therefore pure tissue must be obtained for a successful gene expression profiling of eye development. To address this issue, we have developed an approach to microdissect intact retina and retina with RPE attached from 1-3 dpf, which cover major stages of eye morphogenesis. All procedures can be done with fine forceps and general laboratory supplies under standard stereomicroscopes. For retinal dissection, the single-layer RPE is removed and peeled off by brushing action and the preferential adherence of the RPE remnants to the surface of the culture plate for dissection. For RPE-attached retinal dissection, the adherence of RPE to the dissection plate is removed before the dissection so that the RPE can be completely preserved with the retina. A careful lifting action of this tissue can efficiently separate the presumptive choroid and sclera. The lens can be removed in both cases by a chemically etched tungsten needle. In short, our approach can obtain intact eye tissues and has been successfully utilized to study tissue-specific expression profiles of zebrafish retina1, 2 and retinal pigment epithelium3.

This article describes an approach to microdissect zebrafish retinas with and without retinal pigment epithelium attached, from one to three days postfertilization embryos.

Zebrafish 배아 눈 조직의 Microdissection

Zebrafish is a popular animal model for research on eye development because of its rapid ex utero development and good fecundity. By 3 days post ...

Microdissection of Black Widow Spider Silk-producing Glands

Modern spiders spin high-performance silk fibers with a broad range of biological functions, including locomotion, prey capture and protection of developing offspring 1,2. Spiders accomplish these tasks by spinning several distinct fiber types that have diverse mechanical properties. Such specialization of fiber types has occurred through the evolution of different silk-producing glands, which function as small biofactories. These biofactories manufacture and store large quantities of silk proteins for fiber production. Through a complex series of biochemical events, these silk proteins are converted from a liquid into a solid material upon extrusion.
Mechanical studies have demonstrated that spider silks are stronger than high-tensile steel 3. Analyses to understand the relationship between the structure and function of spider silk threads have revealed that spider silk consists largely of proteins, or fibroins, that have block repeats within their protein sequences 4. Common molecular signatures that contribute to the incredible tensile strength and extensibility of spider silks are being unraveled through the analyses of translated silk cDNAs. Given the extraordinary material properties of spider silks, research labs across the globe are racing to understand and mimic the spinning process to produce synthetic silk fibers for commercial, military and industrial applications. One of the main challenges to spinning artificial spider silk in the research lab involves a complete understanding of the biochemical processes that occur during extrusion of the fibers from the silk-producing glands.
Here we present a method for the isolation of the seven different silk-producing glands from the cobweaving black widow spider, which includes the major and minor ampullate glands [manufactures dragline and scaffolding silk] 5,6, tubuliform [synthesizes egg case silk] 7,8, flagelliform [unknown function in cob-weavers], aggregate [makes glue silk], aciniform [synthesizes prey wrapping and egg case threads] 9 and pyriform [produces attachment disc silk] 10. This approach is based upon anesthetizing the spider with carbon dioxide gas, subsequent separation of the cephalothorax from the abdomen, and microdissection of the abdomen to obtain the silk-producing glands. Following the separation of the different silk-producing glands, these tissues can be used to retrieve different macromolecules for distinct biochemical analyses, including quantitative real-time PCR, northern- and western blotting, mass spectrometry (MS or MS/MS) analyses to identify new silk protein sequences, search for proteins that participate in the silk assembly pathway, or use the intact tissue for cell culture or histological experiments.

Here we describe an efficient strategy to remove the silk-producing glands from the abdomen of female black widow spiders. This procedure allows the rapid isolation of the seven distinct silk-producing glands in a highly purified fashion, an important process for investigators studying spider silk production and fiber assembly.

블랙 위도우 스파이더 실크 생산 땀샘의 Microdissection

Modern spiders spin high-performance silk fibers with a broad range of biological functions, including locomotion, prey capture and protection of ...

A Novel Method for the Culture and Polarized Stimulation of Human Intestinal Mucosa Explants

Few models currently exist to realistically simulate the complex human intestine's micro-environment, where a variety of interactions take place. Proper homeostasis directly depends on these interactions, as they shape an entire immunological response inducing tolerance against food antigens while at the same time mounting effective immune responses against pathogenic microbes accidentally ingested with food.
Intestinal homeostasis is preserved also through various complex interactions between the microbiota (including food-associated beneficial bacterial strains) and the host, that regulate the attachment/degradation of mucus, the production of antimicrobial peptides by the epithelial barrier, and the "education" of epithelial cells' that controls the tolerogenic or immunogenic phenotype of unique, gut-resident lymphoid cells' populations. These interactions have been so far very difficult to reproduce with in vitro assays using either cultured cell lines or peripheral blood mononuclear cells. In addition, mouse models differ substantially in components of the intestinal mucosa (mucus layer organization, commensal bacteria community) with respect to the human gut. Thus, studies of a variety of treatments to be brought in the clinics for important stress-related or pathological conditions such as irritable bowel syndrome, inflammatory bowel disease or colorectal cancer have been difficult to carry out.
To address these issues, we developed a novel system that enables us to stimulate explants of human intestinal mucosa that retain their in situ conditioning by the host microbiota and immune response, in a polarized fashion. Polarized apical stimulation is of great importance for the outcome of the elicited immune response. It has been repeatedly shown that the same stimuli can produce completely different responses when they bypass the apical face of the intestinal epithelium, stimulating epithelial cells basolaterally or coming into direct contact with lamina propria components, switching the phenotype from tolerogenic to immunogenic and causing unnecessary and excessive inflammation in the area.
We achieved polarized stimulation by gluing a cave cylinder which delimited the area of stimulation on the apical face of the mucosa as will be described in the protocol. We used this model to examine, among others, differential effects of three different Lactobacilli strains. We show that this model system is very powerful to assess the immunomodulatory properties of probiotics in healthy and disease conditions.

We introduce a novel method for the maintenance of human intestinal mucosa in culture and monitoring of the response to various types of stimuli over at least 24 hrs. With our method, the polarity of the tissue is maintained, allowing for a physiological stimulation via the apical route.

인간의 장내 점막의 Explants의 문화와 편광 자극을위한 새로운 방법

Few models currently exist to realistically simulate the complex human intestine's micro-environment, where a variety of interactions take place. Proper ...

Cryosectioning Yeast Communities for Examining Fluorescence Patterns

Microbes typically live in communities. The spatial organization of cells within a community is believed to impact the survival and function of the community1. Optical sectioning techniques, including confocal and two-photon microscopy, have proven useful for observing spatial organization of bacterial and archaeal communities2,3. A combination of confocal imaging and physical sectioning of yeast colonies has revealed internal organization of cells4. However, direct optical sectioning using confocal or two-photon microscopy has been only able to reach a few cell layers deep into yeast colonies. This limitation is likely because of strong scattering of light from yeast cells4.
Here, we present a method based on fixing and cryosectioning to obtain spatial distribution of fluorescent cells within Saccharomyces cerevisiae communities. We use methanol as the fixative agent to preserve the spatial distribution of cells. Fixed communities are infiltrated with OCT compound, frozen, and cryosectioned in a cryostat. Fluorescence imaging of the sections reveals the internal organization of fluorescent cells within the community.
Examples of yeast communities consisting of strains expressing red and green fluorescent proteins demonstrate the potentials of the cryosectioning method to reveal the spatial distribution of fluorescent cells as well as that of gene expression within yeast colonies2,3. Even though our focus has been on Saccharomyces cerevisiae communities, the same method can potentially be applied to examine other microbial communities.

We present a protocol for freezing and cryosectioning yeast communities to observe internal patterns of fluorescent cells. The method relies on methanol-fixing and OCT-embedding to preserve the spatial distribution of cells without inactivating fluorescent proteins within a community.

형광 패턴 검사를위한 효모 커뮤니티 Cryosectioning

Microbes typically live  in communities. The spatial organization  of cells within a community is believed to impact the survival and function of the  ...

Isolation of Murine Valve Endothelial Cells

Normal valve structures consist of stratified layers of specialized extracellular matrix (ECM) interspersed with valve interstitial cells (VICs) and surrounded by a monolayer of valve endothelial cells (VECs). VECs play essential roles in establishing the valve structures during embryonic development, and are important for maintaining life-long valve integrity and function. In contrast to a continuous endothelium over the surface of healthy valve leaflets, VEC disruption is commonly observed in malfunctioning valves and is associated with pathological processes that promote valve disease and dysfunction. Despite the clinical relevance, focused studies determining the contribution of VECs to development and disease processes are limited. The isolation of VECs from animal models would allow for cell-specific experimentation. VECs have been isolated from large animal adult models but due to their small population size, fragileness, and lack of specific markers, no reports of VEC isolations in embryos or adult small animal models have been reported. Here we describe a novel method that allows for the direct isolation of VECs from mice at embryonic and adult stages. Utilizing the Tie2-GFP reporter model that labels all endothelial cells with Green Fluorescent Protein (GFP), we have been successful in isolating GFP-positive (and negative) cells from the semilunar and atrioventricular valve regions using fluorescence activated cell sorting (FACS). Isolated GFP-positive VECs are enriched for endothelial markers, including CD31 and von Willebrand Factor (vWF), and retain endothelial cell expression when cultured; while, GFP-negative cells exhibit molecular profiles and cell shapes consistent with VIC phenotypes. The ability to isolate embryonic and adult murine VECs allows for previously unattainable molecular and functional studies to be carried out on a specific valve cell population, which will greatly improve our understanding of valve development and disease mechanisms.

The ability to isolate heart valve endothelial cells (VECs) is critical for understanding mechanisms of valve development, maintenance, and disease. Here we describe the isolation of VECs from embryonic and adult Tie2-GFP mice using FACS that will allow for studies determining the contribution of VECs in developmental and disease processes.

쥐과 밸브 내피 세포의 분리

Normal valve structures consist of stratified layers of specialized extracellular matrix (ECM) interspersed with valve interstitial cells (VICs) and ...

Laser-assisted Microdissection (LAM) as a Tool for Transcriptional Profiling of Individual Cell Types

The understanding of developmental processes at the molecular level requires insights into transcriptional regulation, and thus the transcriptome, at the level of individual cell types. While the methods described here are generally applicable to a wide range of species and cell types, our research focuses on plant reproduction. Plant cultivation and seed production is of crucial importance for human and animal nutrition. A detailed understanding of the regulatory networks that govern the formation of the reproductive lineage (germline) and ultimately of seeds is a precondition for the targeted manipulation of plant reproduction. In particular, the engineering of apomixis (asexual reproduction through seeds) into crop plants promises great improvements, as it leads to the formation of clonal seeds that are genetically identical to the mother plant. Consequently, the cell types of the female germline are of major importance for the understanding and engineering of apomixis. However, as the corresponding cells are deeply embedded within the floral tissues, they are very difficult to access for experimental analyses, including cell-type specific transcriptomics. To overcome this limitation, sections of individual cells can be isolated by laser-assisted microdissection (LAM). While LAM in combination with transcriptional profiling allows the identification of genes and pathways active in any cell type with high specificity, establishing a suitable protocol can be challenging. Specifically, the quality of RNA obtained after LAM can be compromised, especially when small, single cells are targeted. To circumvent this problem, we have established a workflow for LAM that reproducibly results in high RNA quality that is well suitable for transcriptomics, as exemplified here by the isolation of cells of the female germline in apomictic Boechera. In this protocol, procedures are described for tissue preparation and LAM, also with regard to RNA extraction and quality control.

Laser-assisted Microdissection LAM as a Tool for Transcriptional Profiling of Individual Cell Types

Here we present a protocol for laser-assisted microdissection of specific plant cell types for transcriptional profiling. While the protocol is suitable for different species and cell types, the focus is on highly inaccessible cells of the female germline important for sexual and apomictic reproduction in the crucifer genus Boechera.

개별 세포 유형의 전사 프로파일 링을위한 도구로 레이저를 이용한 이외에 Microdissection (LAM)

The understanding of developmental processes at the molecular level requires insights into transcriptional regulation, and thus the transcriptome, at the ...

Cryosectioning of Contiguous Regions of a Single Mouse Skeletal Muscle for Gene Expression and Histological Analyses

With this method, consecutive cryosections are collected to enable both microscopy applications for tissue histology and enrichment of RNA for gene expression using adjacent regions from a single mouse skeletal muscle. Typically, it is challenging to achieve adequate homogenization of small skeletal muscle samples because buffer volumes may be too low for efficient grinding applications, yet without sufficient mechanical disruption, the dense tissue architecture of muscle limits penetration of buffer reagents, ultimately causing low RNA yield. By following the protocol reported here, 30 &#956;m sections are collected and pooled allowing cryosectioning and subsequent needle homogenization to mechanically disrupt the muscle, increasing the surface area exposed for buffer penetration. The primary limitations of the technique are that it requires a cryostat, and it is relatively low throughput. However, high-quality RNA can be obtained from small samples of pooled muscle cryosections, making this method accessible for many different skeletal muscles and other tissues. Furthermore, this technique enables matched analyses (e.g., tissue histopathology and gene expression) from adjacent regions of a single skeletal muscle so that measurements can be directly compared across applications to reduce experimental uncertainty and to reduce replicative animal experiments necessary to source a small tissue for multiple applications.

Consecutive cryo-sections are collected to enable histological applications and enrichment of RNA for gene expression measurements using adjacent regions from a single mouse skeletal muscle. High-quality RNA is obtained from 20 - 30 mg of pooled cryosections and measurements are directly compared across applications.

유전자 발현 및 조직 학적 분석을위한 단일 마우스 골격근의 연속 지역의 냉동 절편

With this method, consecutive cryosections are collected to enable both microscopy applications for tissue histology and enrichment of RNA for gene ...

A Morphometric and Cellular Analysis Method for the Murine Mandibular Condyle

The temporomandibular joint (TMJ) has the capacity to adapt to external stimuli, and loading changes can affect the position of condyles, as well as the structural and cellular components of the mandibular condylar cartilage (MCC). This manuscript describes methods for analyzing these changes and a method for altering the loading of the TMJ in mice (i.e., compressive static TMJ loading). The structural evaluation illustrated here is a simple morphometric approach that uses the Digimizer software and is performed in radiographs of small bones. In addition, the analysis of cellular changes leading to alterations in collagen expression, bone remodeling, cell division, and proteoglycan distribution in the MCC is described. The quantification of these changes in histological sections - by counting the positive fluorescent pixels using image software and measuring the distance mapping and stained area with Digimizer - is also demonstrated. The methods shown here are not limited to the murine TMJ, but could be used on additional bones of small experimental animals and in other regions of endochondral ossification.

This manuscript presents methods for analyzing morphometric and cellular changes within the mandibular condyle of rodents.

형태학 및 Murine 악의 관절 돌기 세포 분석 방법

The temporomandibular joint (TMJ) has the capacity to adapt to external stimuli, and loading changes can affect the position of condyles, as well as the ...