Supported by National Institutes of Health (DK55679, and DK59888 to A.N.). Emory University&#160;Integrated Cellular Imaging Microscopy Core of the Winship Cancer&#160;Institute comprehensive cancer center grant, P30CA138292, and the Crohn's and Colitis Foundation of America Career Development award to C.T.C. and Fellowship Award to A.E.F.

Des expériences utilisés souris C57BL / 6 entre 10 et 12 semaines d&#39;âge. Toutes les procédures utilisant des animaux ont été examinés et approuvés par le Comité de soin et l&#39;utilisation Emory University animaux dans les institutions et ont été effectués selon les National Institutes of Health critères. 1. Configuration expérimentale <ol><li> Configuration du cryostat <ol><li> Equilibrer cryostat à -20 ° C, y compris la lame de microtome et mandrins (extrême prudence autour de la lame!). </li><li> Remplissez un cryomoule vide avec OCT (Optimal composé coupe de la température) et équilibrer à -20 ° C (~ 30 minutes). Retirer les PTOM congelé du moule et le fixer sur le mandrin avec OCT liquide. Placez le bloc / mandrin dans le bras microtome et permettre l&#39;OPO à définir pour 10 min. </li><li> Régler le cryostat à 10 um par section et de se raser le bloc octobre jusqu&#39;à ce qu&#39;il soit plat. Sauvegardez le bras microtome loin de la lame de plusieurs centimètres. À ce stade, ne réglez pas la lame ou le mandrin pour le reste de l&#39;expermode de. </li></ol></li><li> Préparer les lames de rasoir: Préparer deux lames de rasoir par échantillon. Utilisation d&#39;un fichier de métal, terne le bord aiguisé de lames. Ensuite, retirez la bride en aluminium avec une pince. </li><li> Pré-refroidir un plat en pyrex ou toute autre surface plane sur glace sèche. </li><li> Préparer un plat de dissection avec 10-15 repères de la dissection. A 10 cm de boîte de culture tissulaire de 50% rempli de silicium est suffisante. Ajouter 5 ml de tampon de Hanks à la température ambiante. </li></ol> 2. Dissection du côlon distal Tissue <ol><li> La place des souris dans une chambre étanche et souris euthanasier par inhalation isoflurane et dislocation cervicale, puis pulvériser éthanol à 70% sur l&#39;abdomen et le thorax 12. </li><li> Faire une petite incision dans la peau de l&#39;abdomen avec des ciseaux et ensuite faire une incision pour exposer la cavité péritonéale. Des procédures similaires peuvent être trouvés ici décrit 12. </li><li> Couper le gros intestin à la marge de l&#39;anus et de démêler le mésentère jusqu&#39;à ce que le colon est libre. </li><li> Exciser un côlon distalsegment compris entre 0 et 6 cm de l&#39;anus. Ici, la profondeur de la crypte est ~ 150 um (voir la figure 1B). Couper ouvrir le côlon longitudinalement l&#39;aide de ciseaux et retirer le contenu fécaux. </li><li> Pin le tissu à plat de la dissection avec la surface de la muqueuse vers le haut. Étirer les tissus en utilisant des broches de dissection sur un plat de silicium dans un tampon Hanks et laisser reposer pendant 10 min à température ambiante (figure 1C). Cela supprime les plis du tissu et permet aux couches musculaires de se détendre. </li></ol> 3. Montez tissus sur le cryostat pour la coupe <ol><li> Faites glisser une lame de rasoir dans la section souhaitée de tissu, puis verser le tampon de Hanks. Ajouter une autre lame de rasoir pour le haut, faire un sandwich. Couper le segment de tissu et de retirer les broches. Transférez le sandwich lame de rasoir / tissu à la glace sèche. Laisser le tissu de geler (5-10 min, figure 1D). </li><li> Ramassez le rasoir / sandwich tissu et lui permettre de se réchauffer légèrement en plaçant un doigt sur le bl hautade (côté muqueuse vers le haut. Ceci oriente le tissu de sorte que les couches basales musculaires sont sectionnés premier.). Séparer le sandwich et couper sur les bords du segment de tissu. Couper un segment de tissu d&#39;environ, 0,5 cm x 1 cm. zones de bord ont tendance à se gondoler, ce qui provoque des coupes en série pour contenir de nombreuses couches de tissu. Notez que plus la coupe est meilleure que sous-coupe, de sorte pécher par excès de prudence. </li><li> Laisser le tissu à chauffer jusqu&#39;à ce que la glace sur le dessus du tissu commence à fondre. A ce point rapidement et presser délicatement le tissu dans le bloc PTOM du cryostat. </li><li> Retirez la lame en plaçant un doigt sur l&#39;échantillon. Le transfert de chaleur vous permettra de retirer la lame sans perturber le tissu. </li><li> Enduire le tissu avec PTOM et équilibrer pendant 5 min. Couper des sections à 10 um (figure 1E, F). Inspecter visuellement les sections jusqu&#39;à ce que les cryptes sont vus. sections de placer dans une tubes de 1,5 ml ou sur diapositives. </li><li> Pour l&#39;analyse de l&#39;ARNm ou de protéines, endroit til échantillons dans des tubes avec 5 crypte base, 5 transition, et 5 sections de surface par tube. Pour la collecte de l&#39;ARN ajouter 1 ml de réactif d&#39;isolement commercial et incuber à température ambiante pendant 10 min. Effectuer la purification de l&#39;ARN selon les instructions du fabricant. Utilisation 5-10 ug d&#39;ARN total pour la production d&#39;ADNc. </li><li> Pour la purification des protéines, ajouter 0,5 ml de RIPA froid tampon de lyse (plus les inhibiteurs de protéase) pour 5 sections. Soniquer trois fois à un cycle de 70%, sur de la glace. <ol><li> Ajouter échantillons à SDS PAGE tampon de chargement (tampon Laemmli) et incuber à 100 ° C pendant 10 min. Échantillons soumis à SDS-PAGE et de transfert, puis bloquent dans 5% de lait / PBS pendant 2 heures. Effectuer une analyse western blot suivie d&#39;une incubation avec des anticorps Klf4 (1: 500) O / N à 4 ° C. </li></ol></li></ol>

<ol>
	<li>Noah, T. K., Donahue, B., Shroyer, N. F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Intestinal+development+and+differentiation.">Intestinal development and differentiation.</a> Exp Cell Res. 317, 2702-2710 (2011).</li><li>Humphries, A., Wright, N. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Colonic+crypt+organization+and+tumorigenesis.">Colonic crypt organization and tumorigenesis.</a> Nat Rev Cancer. 8, 415-424 (2008).</li><li>Weber, C. R., Turner, J. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Inflammatory+bowel+disease:+is+it+really+just+another+break+in+the+wall.">Inflammatory bowel disease: is it really just another break in the wall.</a> Gut. 56, 6-8 (2007).</li><li>Bjerknes, M., Cheng, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Methods+for+the+isolation+of+intact+epithelium+from+the+mouse+intestine.">Methods for the isolation of intact epithelium from the mouse intestine.</a> Anat Rec. 199, 565-574 (1981).</li><li>Sato, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Single+Lgr5+stem+cells+build+crypt-villus+structures+in+vitro+without+a+mesenchymal+niche.">Single Lgr5 stem cells build crypt-villus structures in vitro without a mesenchymal niche.</a> Nature. 459, 262-265 (2009).</li><li>Rand, M. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Calcium+depletion+dissociates+and+activates+heterodimeric+notch+receptors.">Calcium depletion dissociates and activates heterodimeric notch receptors.</a> Mol Cell Biol. 20, 1825-1835 (2000).</li><li>Gjorevski, N., Boghaert, E., Nelson, C. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Regulation+of+Epithelial-Mesenchymal+Transition+by+Transmission+of+Mechanical+Stress+through+Epithelial+Tissues.">Regulation of Epithelial-Mesenchymal Transition by Transmission of Mechanical Stress through Epithelial Tissues.</a> Cancer Microenviron. 5, 29-38 (2012).</li><li>Lechner, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Gene+expression+pattern+of+laser+microdissected+colonic+crypts+of+adenomas+with+low+grade+dysplasia.">Gene expression pattern of laser microdissected colonic crypts of adenomas with low grade dysplasia.</a> Gut. 52, 1148-1153 (2003).</li><li>Reizel, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Colon+stem+cell+and+crypt+dynamics+exposed+by+cell+lineage+reconstruction.">Colon stem cell and crypt dynamics exposed by cell lineage reconstruction.</a> PLoS Genet. 7, e1002192 (2011).</li><li>Kosinski, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Gene+expression+patterns+of+human+colon+tops+and+basal+crypts+and+BMP+antagonists+as+intestinal+stem+cell+niche+factors.">Gene expression patterns of human colon tops and basal crypts and BMP antagonists as intestinal stem cell niche factors.</a> Proc Natl Acad Sci U S A. 104, 15418-15423 (2007).</li><li>Tamura, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Pit+pattern+and+three-dimensional+configuration+of+isolated+crypts+from+the+patients+with+colorectal+neoplasm.">Pit pattern and three-dimensional configuration of isolated crypts from the patients with colorectal neoplasm.</a> J Gastroenterol. 37, 798-806 (2002).</li><li>Geem, D., Medina-Contreras, O., Kim, W., Huang, C. S., Denning, T. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Isolation+and+characterization+of+dendritic+cells+and+macrophages+from+the+mouse+intestine.">Isolation and characterization of dendritic cells and macrophages from the mouse intestine.</a> Journal of visualized experiments : JoVE. , e4040 (2012).</li><li>Laukoetter, M. G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=JAM-A+regulates+permeability+and+inflammation+in+the+intestine+in+vivo.">JAM-A regulates permeability and inflammation in the intestine in vivo.</a> J Exp Med. 204, 3067-3076 (2007).</li><li>Neumann, P. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Gut+commensal+bacteria+and+regional+Wnt+gene+expression+in+the+proximal+versus+distal+colon.">Gut commensal bacteria and regional Wnt gene expression in the proximal versus distal colon.</a> Am J Pathol. 184, 592-599 (2014).</li><li>Capaldo, C. T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Proinflammatory+cytokine-induced+tight+junction+remodeling+through+dynamic+self-assembly+of+claudins.">Proinflammatory cytokine-induced tight junction remodeling through dynamic self-assembly of claudins.</a> Mol Biol Cell. 25, 2710-2719 (2014).</li><li>Wells, J. M., Spence, J. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=How+to+make+an+intestine.">How to make an intestine.</a> Development. 141, 752-760 (2014).</li></ol>

The authors have nothing to disclose

Les mécanismes moléculaires impliqués dans le côlon prolifération des cellules épithéliales et la différenciation sont mal comprises. Cela comprend lacunes dans notre compréhension de l&#39;environnement de la signalisation cellulaire du compartiment des cellules souches à la base des cryptes épithéliales du côlon. Il ya également un intérêt croissant dans les processus qui sous-tendent la différenciation des entérocytes. Par exemple, une meilleure compréhension de la différenciation in vivo est requise comme une référence pour les études visant à produire in vitro des systèmes intestinaux primaires 16. La procédure ci-dessus contient plusieurs mesures qui nécessitent une attention particulière. Tout d&#39;abord, enlever les bords autour du segment de tissu congelé (tel que discuté à la section 3.2) est nécessaire que les bords de tissus papillotes pendant la dissection et la congélation. Si vous ne déplacez ces arêtes résultats est une population mixte de cellules de surface et de base crypte. Montage du tissu sur un pré-réfrigérés, EAO bloc nivelé est également essentiel. Tson protocole peut être adapté à d&#39;autres régions du côlon distal en modifiant le nombre de sections dans chaque pool. Par exemple, comme représenté sur la figure 1B, la longueur de la muqueuse crypte varie entre 150 à 300 um. Par conséquent, lorsque l&#39;on étudie la zone comprise entre 4 cm-6 cm de l&#39;anus, le nombre de sections doit être augmentée de 15 à 30. Il est important, ce protocole est pas suggéré pour le côlon proximal (7 cm 9 cm) en raison des plis ( plicae obliquae) qui étendent dans la lumière qui rend impossible de surface et de la crypte à base de cellules séparées par sectionnement série. Techniques de coupes sériées ont été utilisés pour étudier la crypte-base et la surface populations de cellules épithéliales chez l&#39;homme. Cependant, notre protocole ajoute des étapes supplémentaires qui sont nécessaires en raison de la petite taille du tissu murin. Nous proposons que le protocole ci-dessus permettra de l&#39;enquête de base et crypte-population de cellules épithéliales de surface dans les systèmes de souris génétiquement traitables. En effet, les sections regroupées Yield protéines de haute qualité et d&#39;analyse en aval appropriée de l&#39;ARN. Les applications futures pourraient inclure l&#39;étude des voies de signalisation cellulaire ou immunoprécipitation de la chromatine. Toutefois, il convient de noter que, comme plusieurs des méthodes décrites ci-dessus, les sections résultantes contiennent un mélange de cellules épithéliales lamina propria et interstitielles. En conclusion, le protocole décrit ici fournit un procédé de production rapide, haut pour l&#39;analyse de processus moléculaires dans des régions spatialement distinctes de la muqueuse du côlon murin.

L&#39;épithélium colique est un tissu très régénérative, avec des cellules souches résidentes reconstitution du tissu tous les quelques jours 1. Ce processus de régénération nécessite le maintien d&#39;un compartiment de cellules souches proliférative. Avec le temps, les cellules filles nouvellement produits perdent leur potentiel de prolifération et de la migration vers la surface luminale de l&#39;intestin. Coïncidant avec la migration, les cellules progénitrices se différencient en entérocytes de barrière formant matures ou cellules muqueuses caliciformes productrices. Le défaut de ce programme de différenciation est considérée comme compromise contribuer à barrière epitheliale comme cela est observé dans la maladie inflammatoire de l&#39;intestin et du côlon 2,3. Une étude détaillée des processus ci-dessus, il faudra des méthodes pour isoler les populations crypte-base et cellulaires de surface. Plusieurs méthodes existent, chacune avec des avantages uniques et des inconvénients. Les méthodes actuelles pour l&#39;isolement de cellules épithéliales intestinales comprennent chagents exaltants et dissociation mécanique, ce qui entraîne l&#39;isolement des cryptes entiers, des feuilles epitheliales ou des cellules individuelles en fonction des conditions expérimentales 4,5. Ce sont des méthodes à haut rendement, mais les changements dans la signalisation intracellulaire ont été rapportés dans ces conditions, qui peuvent ne pas représenter l&#39;environnement natif 6,7. microdissection laser permet la collecte de matériau distinct spatiale, mais réalise moléculaire faible rendement 8,9. Dans les tissus du côlon humain, les méthodes de cryosectioning horizontaux de série ont été mis au point 10. Cependant, tissus murins muqueuses sont prohibitifs petit pour l&#39;appropriation directe de cette technique. Chez les humains, les longueurs de la crypte intestinale (la distance entre la crypte-base et cellules de surface) dans le côlon varient entre ~ 100-1000 um 11. Chez les souris, les longueurs sont comprises entre crypte ~ 50 à 300 pm (voir la figure 1A). La petite taille des cryptes murins représente un défi pour l&#39;isolation de ces deux populations de cellules en utilisant des protocoles existants. Nous décrivons maintenant un faible coût, la méthode à haut rendement pour l&#39;isolement de crypte-base et la surface population de cellules épithéliales dans les tissus du côlon murin. Tissus récoltés de cette manière peut ensuite être analysé par un certain nombre d&#39;applications en aval, y compris les types immunofluorescence, une RT-PCR en temps réel (-Polymerase Chain Reaction) ou transfert de Western.

<table border="0" cellpadding="0" cellspacing="0">
	<tbody>
		<tr>
			<td>Microtome</td>
			<td>Leica Biosystems, Nussloch Germany</td>
			<td>CM 1510-3</td>
			<td></td>
		</tr>
		<tr>
			<td>MyiQ real time PCR detector</td>
			<td>BioRad</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>LSM 510&#160;</td>
			<td>Carl Zeiss</td>
			<td></td>
			<td>Confocal microscope</td>
		</tr>
		<tr>
			<td>Materials</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>OCT</td>
			<td>Tissue-Tek, Sakura Finetek, Torrance CA</td>
			<td>4583</td>
			<td></td>
		</tr>
		<tr>
			<td>cryo-mold</td>
			<td>Tissue-Tek, Sakura Finetek, Torrance CA</td>
			<td>4557</td>
			<td>25mmx20mmx5mm</td>
		</tr>
		<tr>
			<td>High profile microtome blade</td>
			<td>Leica Biosystems, Nussloch germany</td>
			<td>818</td>
			<td></td>
		</tr>
		<tr>
			<td>GEM industrial blades</td>
			<td>American Safety Razor Blades</td>
			<td>62-0314</td>
			<td></td>
		</tr>
		<tr>
			<td>Sylgard silicon elastomere base</td>
			<td>Dow Corning, Midland MI</td>
			<td>3097358</td>
			<td></td>
		</tr>
		<tr>
			<td>27 1/2 g needle</td>
			<td>Becton-Dickinson, Franklin Lakes, NJ</td>
			<td>305109</td>
			<td>pins for dissection</td>
		</tr>
		<tr>
			<td>TRizol</td>
			<td>Life Technologies</td>
			<td>15596018</td>
			<td></td>
		</tr>
		<tr>
			<td>Rneasy</td>
			<td>Qiagen</td>
			<td>74104</td>
			<td></td>
		</tr>
		<tr>
			<td>DNAse</td>
			<td>Qiagen</td>
			<td>79254</td>
			<td></td>
		</tr>
		<tr>
			<td>Reagents</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Antibody ZO-1</td>
			<td>Invitrogen&#160;</td>
			<td>187430</td>
			<td></td>
		</tr>
		<tr>
			<td>Antibody KLF4</td>
			<td>Cell Signaling</td>
			<td>4038S</td>
			<td></td>
		</tr>
		<tr>
			<td>Antibody mGAPDH</td>
			<td>Sigma</td>
			<td>G8795</td>
			<td></td>
		</tr>
		<tr>
			<td>Antibody Secondary Alexa conjugate</td>
			<td>Invitrogen</td>
			<td>A11034</td>
			<td>488 anti-rabbit</td>
		</tr>
		<tr>
			<td>Antibody Secondary HRP conjugate</td>
			<td>Jackson</td>
			<td>111/115-001-003</td>
			<td>rabbit/mouse&#160;</td>
		</tr>
		<tr>
			<td>Topro-3</td>
			<td>Invitrogen</td>
			<td>T3605</td>
			<td></td>
		</tr>
		<tr>
			<td>HANKs balanced salt buffer</td>
			<td>Life Technologies</td>
			<td>14025092</td>
			<td></td>
		</tr>
		<tr>
			<td>RIPA lysis buffer</td>
			<td></td>
			<td></td>
			<td>50mM Tris-HCl pH 7.4 150mM NaCl 1% NP40 0.25% Na-deoxycholate</td>
		</tr>
		<tr>
			<td>PCR Primers</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>primer TBP 3&#39;</td>
			<td></td>
			<td></td>
			<td>GGAATTGTACCGCAGCTTCAAA</td>
		</tr>
		<tr>
			<td>primer TBP 5&#39;</td>
			<td></td>
			<td></td>
			<td>GATGACTGCAGCAAATCGCTT</td>
		</tr>
		<tr>
			<td>primer KLF4 3&#39;</td>
			<td></td>
			<td></td>
			<td>TGTGACTATGCAGGCTGTGGCAAA</td>
		</tr>
		<tr>
			<td>primer KLF4 5&#39;</td>
			<td></td>
			<td></td>
			<td>ACAGTGGTAAGGTTTCTCGCCTGT</td>
		</tr>
	</tbody>
</table>

cryosectioning method for microdissection of murine colonic mucosa

The colonic mucosal tissue provides a vital barrier to luminal antigens. This barrier is composed of a monolayer of simple columnar epithelial cells. The colonic epithelium is dynamically turned over and epithelial cells are generated in the stem cell containing crypts of Lieberk&#252;hn. Progenitor cells produced in the crypt-bases migrate toward the luminal surface, undergoing a process of cellular differentiation before being shed into the gut lumen. In order to study these processes at the molecular level, we have developed a simple method for the microdissection of two spatially distinct regions of the colonic mucosa; the proliferative crypt zone, and the differentiated surface epithelial cells. Our objective is to isolate specific crypt and surface epithelial cell populations from mouse colonic mucosa for the isolation of RNA and protein.

Coupes de tissus du côlon ont été traitées pour l&#39;évaluation histologique et la coloration H &amp; E 13. Une vue en coupe transversale traditionnelle de la muqueuse est vu sur la figure 2A. Zones basales contiennent l&#39;externe de la musculeuse, composée principalement de la musculeuse circulaires. En procédant vers la lumière, de la muqueuse musculaire est évident adjacente aux cellules epitheliales cryptiques-base et les cellules de transition sont au milieu du tissu, et enfin, des populations de cellules de surface font face à la lumière intestinale. La méthode décrite ici coupes sériées maintient une orientation telle que la musculeuse longitudinales et circulaires se rencontrent d&#39;abord (figure 2B), suivie de la muscularis mucosa (figure 2C). On note l&#39;apparition de cellules interstitielles non-musculaires en haut à gauche de l&#39;image. Pour l&#39;analyse en aval décrit ci-dessous, les sections de muscles sont écartés. Les sections suivantes contiennent des cellules épithéliales et tissu interstitiel (lamina propria), En commençant par les cellules crypte-base (Figure 2D). Noter l&#39;absence d&#39;une lumière centrale dans la plupart des cryptes, qui apparaissent plus foncées dues aux noyaux serrés. Ces couches contiennent du compartiment prolifératif. Les cellules transitoires apparaissent comme serrés glandes avec lumens centraux importants (figure 2E). Enfin, les populations de cellules de surface ont une structure irrégulière, avec des zones de la monocouche épithéliale vu de face (figure 2F). Des coupes en série comme décrit ci-dessus peuvent également être traitées à l&#39;étiquetage d&#39;immunofluorescence et la microscopie confocale (comme décrit ici 14). Figure 2G montre cryptes isolées fixes et perméabilisées dans 100% de méthanol et ensuite colorées pour les noyaux (bleu) et la protéine de jonction cellule-cellule Zonula occludens 1 (ZO-1, vert). Dans l&#39;orientation de sectionnement traditionnelle, cellule crypte et la surface peut être consulté simultanément (Figure 2G </strong&gt;). On notera que les ZO-1 lignes de jonction de teinture de la lumière de la crypte du côlon. Ce revêtement Z0-1 de la lumière peut également être vu dans les échantillons de série en coupe de populations de cellules de transition, dans le centre des glandes circulaires (figure 2G). Enhanced ZO-1 tache est vu dans des populations cellulaires de surface (Figure 2I et J). Plusieurs facteurs de différenciation sont connues pour être exprimées d&#39;une manière spatio-temporelle le long de l&#39;axe crypte-à-surface. Cela comprend le facteur facteur de transcription Kruppel-like 4 (KLF4), qui est connu pour être enrichi dans des populations cellulaires de surface. En utilisant des méthodes traditionnelles de sectionnement, KLF4 se trouve dans les noyaux de lumière faisant face populations cellulaires de surface (Figure 2K). On a donc supposé que KLF4 ARNm serait exprimé de manière prédominante dans des populations cellulaires de surface. Pour tester cela, des coupes en série ont été collectés et regroupés dans des échantillons de surface, de transition, et la crypte-base. Subsequently, l&#39;ARN a été récolté en utilisant l&#39;extraction Trizol standard, avec une purification supplémentaire par colonne RNeasy et le traitement DNAse. L&#39;ARN a été recueilli à partir de 5 sections consécutives en gestion commune, qui a donné entre 5-10 ug d&#39;ARN total par échantillon. Ces échantillons ont ensuite été soumis à la PCR en temps réel semi-quantitative pour les deux KLF4 et un gène de référence, TATA liaison box protein 1 (TBP-1) (Figure 2L) 14. Comme représenté sur la figure 2L, après normalisation de la TBP-1, des cellules de surface se sont révélés exprimer jusqu&#39;à huit fois la KLF4 ARNm qui est exprimée dans les cellules cryptiques. De même, les niveaux de protéine Klf4 ont été trouvés à exposer régulation spatiale long de l&#39;axe crypte-surface. Des coupes sériées ont été réunies comme décrit ci-dessus, puis incubées dans du tampon de lyse pendant 20 min à 4 ° C. Cela a donné entre 200-250 pg de protéine par échantillon. Les échantillons ont ensuite été soumis analyse par SDS-PAGE (Figure 2 M) 15. Comme le montre la Figure 2 M, p KLF4rotein niveaux sont considérablement plus élevés dans les populations de cellules de surface. Les résultats ci-dessus démontrent la capacité de ce protocole pour isoler de grandes quantités de surface et les cellules épithéliales des cryptes de la muqueuse du côlon murin. <img alt="Figure 1" src="/files/ftp_upload/53112/53112fig1.jpg" /> Figure 1: (A) Schéma démontrant muqueuse du côlon murin et des couches de muscles externes. Notre méthode vise à recueillir des populations de cellules distinctes de cellules de surface et de la crypte-base par cryosectioning série (10 um chacun). Les couches musculaires externes sont éliminés. Hauteur (B) crypte varie sur la longueur du côlon (distance entre les couches à base de cryptes et de surface). Les points de données indiquent les mesures et les symboles de la crypte individuels indiquent répétitions biologiques (n = 4). (C) des segments de Colon recueillies, bissectées et épinglés sur un plat de silicium dissection. (D) Un tissu soigment environ 3 cm de l&#39;anus est pressé entre deux lames de rasoir et de la gelée sur glace sèche. (E) Le tissu est ensuite monté sur un bloc octobre pré-nivelé. (F) cryosections sont enlevés et inspecté visuellement. <img alt="Figure 2" src="/files/ftp_upload/53112/53112fig2.jpg" /> Figure 2:. Les données représentatives (A) des tissus du côlon colorées à l&#39;hématoxyline-éosine en coupe montrant la musculeuse circulaires (cm), la muqueuse de la musculeuse (mm), les cellules crypte-base, cellules transitoires, et les cellules de surface. (B - C) des couches musculaires du côlon. (D) des cellules Crypt-base. Noter l&#39;absence d&#39;une lumière centrale. (E) Les cellules transitionnelles. (F) cellules de surface. (G) Immunofluorescence des cryptes coliques isolés. ZO-1 (vert) et noyaux (bleu) sont observées en coupe. (SALUT) ZO-1 et coloration nucléaire dans les cellules de transition et de surface. (J) de la vue agrandie de ZO-1 coloration. (K) KLF4 (vert) est enrichi en des populations cellulaires de surface. (L) en temps réel PCR évaluation des niveaux d&#39;ARNm KLF4 entre les trois compartiments. (M) Western blot de l&#39;analyse des taux de protéines Klf4 dans ces populations de cellules.

Watch this Scientific Journal Video about Cryosectioning Method for Microdissection of Murine Colonic Mucosa at JoVE.com

Cryosectioning Method for Microdissection of Murine Colonic Mucosa

Here we describe a simple method for the isolation of spatially distinct murine colonic epithelial surface cells from the underlying crypt-base cells.

Cryosectioning Méthode de microdissection de murin côlon Muqueuse

The colonic mucosal tissue provides a vital barrier to luminal antigens. This barrier is composed of a monolayer of simple columnar epithelial cells. The ...

cryosectioning-method-for-microdissection-of-murine-colonic-mucosa

Research

JoVE Journal

Biology

17.2K vues.  Emory University, Atlanta, Georgia. Here we describe a simple method for the isolation of spatially distinct murine colonic epithelial surface cells from the underlying crypt-base cells.

Vidéo: Cryosectioning Method for Microdissection of Murine Colonic Mucosa

Flash Freezing and Cryosectioning E12.5 Mouse Brain

Demonstrated in this video are the techniques for flash freezing and sectioning embryonic brain tissue from mouse. Useful tips for using the cryostat are given, including troubleshooting methods that can be used while cutting to ensure that the resultant tissues sections are free of cracks and other distortions.

Flash de congélation et Cryosectioning E12.5 cerveau de souris

Recherche

Biologie

Laser Capture Microdissection of Mammalian Tissue

Laser capture microscopy, also known as laser microdissection (LMD), enables the user to isolate small numbers of cells or tissues from frozen or formalin-fixed, paraffin-embedded tissue sections. LMD techniques rely on a thermo labile membrane placed either on top of, or underneath, the tissue section. In one method, focused laser energy is used to melt the membrane onto the underlying cells, which can then be lifted out of the tissue section. In the other, the laser energy vaporizes the foil along a path "drawn" on the tissue, allowing the selected cells to fall into a collection device. Each technique allows the selection of cells with a minimum resolution of several microns. DNA, RNA, protein, and lipid samples may be isolated and analyzed from micro-dissected samples. In this video, we demonstrate the use of the Leica AS-LMD laser microdissection instrument in seven segments, including an introduction to the principles of LMD, initializing the instrument for use, general considerations for sample preparation, mounting the specimen and setting up capture tubes, aligning the microscope, adjusting the capture controls, and capturing tissue specimens. Laser-capture micro-dissection enables the investigator to isolate samples of pure cell populations as small as a few cell-equivalents. This allows the analysis of cells of interest that are free of neighboring contaminants, which may confound experimental results.

Microdissection laser des tissus de mammifères

Laser capture microscopy, also known as laser microdissection (LMD), enables the user to isolate small numbers of cells or tissues from frozen or ...

Microdissection of Zebrafish Embryonic Eye Tissues

Zebrafish is a popular animal model for research on eye development because of its rapid ex utero development and good fecundity. By 3 days post fertilization (dpf), the larvae will show the first visual response. Many genes have been identified to control a proper eye development, but we are far from a complete understanding of the underlying genetic architecture. Whole genome gene expression profiling is a useful tool to elucidate genetic regulatory network for eye development. However, the small size of the embryonic eye in zebrafish makes it challenging to obtain intact and pure eye tissues for expression analysis. For example, the anterior-posterior length of the eye between day 2 and 3 is only approximately 200-300 &mu;m, while the diameter of the lens is less 100 &mu;m. Also, the retinal pigment epithelium (RPE) underlying the retina is just a single-layer epithelium. While gene expression profiles can be obtained from the whole embryo, they do not accurately represent the expression of these tissues. Therefore pure tissue must be obtained for a successful gene expression profiling of eye development. To address this issue, we have developed an approach to microdissect intact retina and retina with RPE attached from 1-3 dpf, which cover major stages of eye morphogenesis. All procedures can be done with fine forceps and general laboratory supplies under standard stereomicroscopes. For retinal dissection, the single-layer RPE is removed and peeled off by brushing action and the preferential adherence of the RPE remnants to the surface of the culture plate for dissection. For RPE-attached retinal dissection, the adherence of RPE to the dissection plate is removed before the dissection so that the RPE can be completely preserved with the retina. A careful lifting action of this tissue can efficiently separate the presumptive choroid and sclera. The lens can be removed in both cases by a chemically etched tungsten needle. In short, our approach can obtain intact eye tissues and has been successfully utilized to study tissue-specific expression profiles of zebrafish retina1, 2 and retinal pigment epithelium3.

This article describes an approach to microdissect zebrafish retinas with and without retinal pigment epithelium attached, from one to three days postfertilization embryos.

Microdissection de tissus embryonnaires Zebrafish Eye

Zebrafish is a popular animal model for research on eye development because of its rapid ex utero development and good fecundity. By 3 days post ...

Microdissection of Black Widow Spider Silk-producing Glands

Modern spiders spin high-performance silk fibers with a broad range of biological functions, including locomotion, prey capture and protection of developing offspring 1,2. Spiders accomplish these tasks by spinning several distinct fiber types that have diverse mechanical properties. Such specialization of fiber types has occurred through the evolution of different silk-producing glands, which function as small biofactories. These biofactories manufacture and store large quantities of silk proteins for fiber production. Through a complex series of biochemical events, these silk proteins are converted from a liquid into a solid material upon extrusion.
Mechanical studies have demonstrated that spider silks are stronger than high-tensile steel 3. Analyses to understand the relationship between the structure and function of spider silk threads have revealed that spider silk consists largely of proteins, or fibroins, that have block repeats within their protein sequences 4. Common molecular signatures that contribute to the incredible tensile strength and extensibility of spider silks are being unraveled through the analyses of translated silk cDNAs. Given the extraordinary material properties of spider silks, research labs across the globe are racing to understand and mimic the spinning process to produce synthetic silk fibers for commercial, military and industrial applications. One of the main challenges to spinning artificial spider silk in the research lab involves a complete understanding of the biochemical processes that occur during extrusion of the fibers from the silk-producing glands.
Here we present a method for the isolation of the seven different silk-producing glands from the cobweaving black widow spider, which includes the major and minor ampullate glands [manufactures dragline and scaffolding silk] 5,6, tubuliform [synthesizes egg case silk] 7,8, flagelliform [unknown function in cob-weavers], aggregate [makes glue silk], aciniform [synthesizes prey wrapping and egg case threads] 9 and pyriform [produces attachment disc silk] 10. This approach is based upon anesthetizing the spider with carbon dioxide gas, subsequent separation of the cephalothorax from the abdomen, and microdissection of the abdomen to obtain the silk-producing glands. Following the separation of the different silk-producing glands, these tissues can be used to retrieve different macromolecules for distinct biochemical analyses, including quantitative real-time PCR, northern- and western blotting, mass spectrometry (MS or MS/MS) analyses to identify new silk protein sequences, search for proteins that participate in the silk assembly pathway, or use the intact tissue for cell culture or histological experiments.

Here we describe an efficient strategy to remove the silk-producing glands from the abdomen of female black widow spiders. This procedure allows the rapid isolation of the seven distinct silk-producing glands in a highly purified fashion, an important process for investigators studying spider silk production and fiber assembly.

Microdissection de Black Widow Soie d&#39;araignée des glandes productrices

Modern spiders spin high-performance silk fibers with a broad range of biological functions, including locomotion, prey capture and protection of ...

A Novel Method for the Culture and Polarized Stimulation of Human Intestinal Mucosa Explants

Few models currently exist to realistically simulate the complex human intestine's micro-environment, where a variety of interactions take place. Proper homeostasis directly depends on these interactions, as they shape an entire immunological response inducing tolerance against food antigens while at the same time mounting effective immune responses against pathogenic microbes accidentally ingested with food.
Intestinal homeostasis is preserved also through various complex interactions between the microbiota (including food-associated beneficial bacterial strains) and the host, that regulate the attachment/degradation of mucus, the production of antimicrobial peptides by the epithelial barrier, and the "education" of epithelial cells' that controls the tolerogenic or immunogenic phenotype of unique, gut-resident lymphoid cells' populations. These interactions have been so far very difficult to reproduce with in vitro assays using either cultured cell lines or peripheral blood mononuclear cells. In addition, mouse models differ substantially in components of the intestinal mucosa (mucus layer organization, commensal bacteria community) with respect to the human gut. Thus, studies of a variety of treatments to be brought in the clinics for important stress-related or pathological conditions such as irritable bowel syndrome, inflammatory bowel disease or colorectal cancer have been difficult to carry out.
To address these issues, we developed a novel system that enables us to stimulate explants of human intestinal mucosa that retain their in situ conditioning by the host microbiota and immune response, in a polarized fashion. Polarized apical stimulation is of great importance for the outcome of the elicited immune response. It has been repeatedly shown that the same stimuli can produce completely different responses when they bypass the apical face of the intestinal epithelium, stimulating epithelial cells basolaterally or coming into direct contact with lamina propria components, switching the phenotype from tolerogenic to immunogenic and causing unnecessary and excessive inflammation in the area.
We achieved polarized stimulation by gluing a cave cylinder which delimited the area of stimulation on the apical face of the mucosa as will be described in the protocol. We used this model to examine, among others, differential effects of three different Lactobacilli strains. We show that this model system is very powerful to assess the immunomodulatory properties of probiotics in healthy and disease conditions.

We introduce a novel method for the maintenance of human intestinal mucosa in culture and monitoring of the response to various types of stimuli over at least 24 hrs. With our method, the polarity of the tissue is maintained, allowing for a physiological stimulation via the apical route.

Une nouvelle méthode pour la Culture et polarisé stimulation des explants de muqueuse intestinale de l&#39;homme

Few models currently exist to realistically simulate the complex human intestine's micro-environment, where a variety of interactions take place. Proper ...

Cryosectioning Yeast Communities for Examining Fluorescence Patterns

Microbes typically live in communities. The spatial organization of cells within a community is believed to impact the survival and function of the community1. Optical sectioning techniques, including confocal and two-photon microscopy, have proven useful for observing spatial organization of bacterial and archaeal communities2,3. A combination of confocal imaging and physical sectioning of yeast colonies has revealed internal organization of cells4. However, direct optical sectioning using confocal or two-photon microscopy has been only able to reach a few cell layers deep into yeast colonies. This limitation is likely because of strong scattering of light from yeast cells4.
Here, we present a method based on fixing and cryosectioning to obtain spatial distribution of fluorescent cells within Saccharomyces cerevisiae communities. We use methanol as the fixative agent to preserve the spatial distribution of cells. Fixed communities are infiltrated with OCT compound, frozen, and cryosectioned in a cryostat. Fluorescence imaging of the sections reveals the internal organization of fluorescent cells within the community.
Examples of yeast communities consisting of strains expressing red and green fluorescent proteins demonstrate the potentials of the cryosectioning method to reveal the spatial distribution of fluorescent cells as well as that of gene expression within yeast colonies2,3. Even though our focus has been on Saccharomyces cerevisiae communities, the same method can potentially be applied to examine other microbial communities.

We present a protocol for freezing and cryosectioning yeast communities to observe internal patterns of fluorescent cells. The method relies on methanol-fixing and OCT-embedding to preserve the spatial distribution of cells without inactivating fluorescent proteins within a community.

Découpe au cryostat Communautés de levure pour examen des caractéristiques de fluorescence

Microbes typically live  in communities. The spatial organization  of cells within a community is believed to impact the survival and function of the  ...

Isolation of Murine Valve Endothelial Cells

Normal valve structures consist of stratified layers of specialized extracellular matrix (ECM) interspersed with valve interstitial cells (VICs) and surrounded by a monolayer of valve endothelial cells (VECs). VECs play essential roles in establishing the valve structures during embryonic development, and are important for maintaining life-long valve integrity and function. In contrast to a continuous endothelium over the surface of healthy valve leaflets, VEC disruption is commonly observed in malfunctioning valves and is associated with pathological processes that promote valve disease and dysfunction. Despite the clinical relevance, focused studies determining the contribution of VECs to development and disease processes are limited. The isolation of VECs from animal models would allow for cell-specific experimentation. VECs have been isolated from large animal adult models but due to their small population size, fragileness, and lack of specific markers, no reports of VEC isolations in embryos or adult small animal models have been reported. Here we describe a novel method that allows for the direct isolation of VECs from mice at embryonic and adult stages. Utilizing the Tie2-GFP reporter model that labels all endothelial cells with Green Fluorescent Protein (GFP), we have been successful in isolating GFP-positive (and negative) cells from the semilunar and atrioventricular valve regions using fluorescence activated cell sorting (FACS). Isolated GFP-positive VECs are enriched for endothelial markers, including CD31 and von Willebrand Factor (vWF), and retain endothelial cell expression when cultured; while, GFP-negative cells exhibit molecular profiles and cell shapes consistent with VIC phenotypes. The ability to isolate embryonic and adult murine VECs allows for previously unattainable molecular and functional studies to be carried out on a specific valve cell population, which will greatly improve our understanding of valve development and disease mechanisms.

The ability to isolate heart valve endothelial cells (VECs) is critical for understanding mechanisms of valve development, maintenance, and disease. Here we describe the isolation of VECs from embryonic and adult Tie2-GFP mice using FACS that will allow for studies determining the contribution of VECs in developmental and disease processes.

Isolement des cellules endothéliales murines Valve

Normal valve structures consist of stratified layers of specialized extracellular matrix (ECM) interspersed with valve interstitial cells (VICs) and ...

Laser-assisted Microdissection (LAM) as a Tool for Transcriptional Profiling of Individual Cell Types

The understanding of developmental processes at the molecular level requires insights into transcriptional regulation, and thus the transcriptome, at the level of individual cell types. While the methods described here are generally applicable to a wide range of species and cell types, our research focuses on plant reproduction. Plant cultivation and seed production is of crucial importance for human and animal nutrition. A detailed understanding of the regulatory networks that govern the formation of the reproductive lineage (germline) and ultimately of seeds is a precondition for the targeted manipulation of plant reproduction. In particular, the engineering of apomixis (asexual reproduction through seeds) into crop plants promises great improvements, as it leads to the formation of clonal seeds that are genetically identical to the mother plant. Consequently, the cell types of the female germline are of major importance for the understanding and engineering of apomixis. However, as the corresponding cells are deeply embedded within the floral tissues, they are very difficult to access for experimental analyses, including cell-type specific transcriptomics. To overcome this limitation, sections of individual cells can be isolated by laser-assisted microdissection (LAM). While LAM in combination with transcriptional profiling allows the identification of genes and pathways active in any cell type with high specificity, establishing a suitable protocol can be challenging. Specifically, the quality of RNA obtained after LAM can be compromised, especially when small, single cells are targeted. To circumvent this problem, we have established a workflow for LAM that reproducibly results in high RNA quality that is well suitable for transcriptomics, as exemplified here by the isolation of cells of the female germline in apomictic Boechera. In this protocol, procedures are described for tissue preparation and LAM, also with regard to RNA extraction and quality control.

Laser-assisted Microdissection LAM as a Tool for Transcriptional Profiling of Individual Cell Types

Here we present a protocol for laser-assisted microdissection of specific plant cell types for transcriptional profiling. While the protocol is suitable for different species and cell types, the focus is on highly inaccessible cells of the female germline important for sexual and apomictic reproduction in the crucifer genus Boechera.

assistée par laser microdissection (LAM) comme outil de profilage transcriptionnel des types cellulaires individuels

The understanding of developmental processes at the molecular level requires insights into transcriptional regulation, and thus the transcriptome, at the ...

Cryosectioning of Contiguous Regions of a Single Mouse Skeletal Muscle for Gene Expression and Histological Analyses

With this method, consecutive cryosections are collected to enable both microscopy applications for tissue histology and enrichment of RNA for gene expression using adjacent regions from a single mouse skeletal muscle. Typically, it is challenging to achieve adequate homogenization of small skeletal muscle samples because buffer volumes may be too low for efficient grinding applications, yet without sufficient mechanical disruption, the dense tissue architecture of muscle limits penetration of buffer reagents, ultimately causing low RNA yield. By following the protocol reported here, 30 &#956;m sections are collected and pooled allowing cryosectioning and subsequent needle homogenization to mechanically disrupt the muscle, increasing the surface area exposed for buffer penetration. The primary limitations of the technique are that it requires a cryostat, and it is relatively low throughput. However, high-quality RNA can be obtained from small samples of pooled muscle cryosections, making this method accessible for many different skeletal muscles and other tissues. Furthermore, this technique enables matched analyses (e.g., tissue histopathology and gene expression) from adjacent regions of a single skeletal muscle so that measurements can be directly compared across applications to reduce experimental uncertainty and to reduce replicative animal experiments necessary to source a small tissue for multiple applications.

Consecutive cryo-sections are collected to enable histological applications and enrichment of RNA for gene expression measurements using adjacent regions from a single mouse skeletal muscle. High-quality RNA is obtained from 20 - 30 mg of pooled cryosections and measurements are directly compared across applications.

Cryosectioning de contigües Les régions d&#39;un muscle squelettique de souris unique pour l&#39;expression génique et analyses histologiques

With this method, consecutive cryosections are collected to enable both microscopy applications for tissue histology and enrichment of RNA for gene ...

A Morphometric and Cellular Analysis Method for the Murine Mandibular Condyle

The temporomandibular joint (TMJ) has the capacity to adapt to external stimuli, and loading changes can affect the position of condyles, as well as the structural and cellular components of the mandibular condylar cartilage (MCC). This manuscript describes methods for analyzing these changes and a method for altering the loading of the TMJ in mice (i.e., compressive static TMJ loading). The structural evaluation illustrated here is a simple morphometric approach that uses the Digimizer software and is performed in radiographs of small bones. In addition, the analysis of cellular changes leading to alterations in collagen expression, bone remodeling, cell division, and proteoglycan distribution in the MCC is described. The quantification of these changes in histological sections - by counting the positive fluorescent pixels using image software and measuring the distance mapping and stained area with Digimizer - is also demonstrated. The methods shown here are not limited to the murine TMJ, but could be used on additional bones of small experimental animals and in other regions of endochondral ossification.

This manuscript presents methods for analyzing morphometric and cellular changes within the mandibular condyle of rodents.

Une méthode d’analyse cellulaire pour le Condyle mandibulaire murin et morphométriques

The temporomandibular joint (TMJ) has the capacity to adapt to external stimuli, and loading changes can affect the position of condyles, as well as the ...