Supported by National Institutes of Health (DK55679, and DK59888 to A.N.). Emory University&#160;Integrated Cellular Imaging Microscopy Core of the Winship Cancer&#160;Institute comprehensive cancer center grant, P30CA138292, and the Crohn's and Colitis Foundation of America Career Development award to C.T.C. and Fellowship Award to A.E.F.

تجارب استخدمت C57BL / 6 الفئران بين 10 و 12 أسبوعا من العمر. تم استعراض جميع الإجراءات باستخدام الحيوانات التي وافقت عليها لجنة جامعة إيموري المؤسسي رعاية الحيوان واستخدام وتم إجراء فقا لالمعاهد الوطنية للمعايير الصحية. 1. الإعداد التجريبي <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> إعداد ناظم البرد <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> تتوازن ناظم البرد إلى -20 ° C، بما في ذلك شفرة مشراح وخراطيش (ممارسة الحذر الشديد في جميع أنحاء شفرة!). </li><li style=";text-align:right;direction:rtl"> ملء cryomold فارغ أكتوبر (الأمثل مركب قطع درجة الحرارة) وتتوازن إلى -20 ° C (~ 30 دقيقة). إزالة أكتوبر المجمدة من العفن وإصلاحه على لتشاك مع السائل أكتوبر وضع كتلة / تشوك في الذراع مشراح والسماح للأكتوبر لضبط لمدة 10 دقيقة. </li><li style=";text-align:right;direction:rtl"> تعيين ناظم البرد إلى 10 ميكرون لكل قسم ويحلق كتلة أكتوبر حتى أنها مسطحة. دعم ذراع مشراح بعيدا عن شفرة من قبل عدة سنتيمترات. في هذه المرحلة لا ضبط شفرة أو ظرف للفترة المتبقية من والخبيرiment. </li></ol></li><li style=";text-align:right;direction:rtl"> إعداد شفرات الحلاقة: إعداد 2 شفرات الحلاقة في العينة. باستخدام ملف المعدنية، مملة حافة sharped من ريش. المقبل، وإزالة شفة الألومنيوم مع ملقط. </li><li style=";text-align:right;direction:rtl"> قبل البرد طبق بيركس أو أي سطح مستو على الثلج الجاف. </li><li style=";text-align:right;direction:rtl"> إعداد طبق تشريح مع 10-15 دبابيس تشريح. وهناك صحن 10 سم زراعة الأنسجة 50٪ مليئة السيليكون تكفي. إضافة 5 مل من العازلة هانكس في RT. </li></ol> 2. تشريح القاصي القولون الأنسجة <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> مكان الفئران في غرفة مغلقة والموت ببطء الفئران عن طريق استنشاق الأيزوفلورين وخلع عنق الرحم، ثم رش 70٪ من الإيثانول على 12 البطن والصدر. </li><li style=";text-align:right;direction:rtl"> إجراء شق صغير في جلد البطن مع مقص ومن ثم إجراء شق لكشف التجويف البريتوني. ويمكن الاطلاع على إجراءات مماثلة وصفها هنا 12. </li><li style=";text-align:right;direction:rtl"> قطع الأمعاء الغليظة على حافة الشرج وندف بعيدا مساريق حتى القولون مجانا. </li><li style=";text-align:right;direction:rtl"> استئصال القولون القاصيالجزء بين 0 و 6 سم من فتحة الشرج. هنا، وعمق سرداب هو ~ 150 ميكرون (انظر الشكل 1B). خفض فتح القولون باستخدام مقص طوليا وإزالة محتويات البراز. </li><li style=";text-align:right;direction:rtl"> دبوس الأنسجة إلى الطبق تشريح مع سطح الغشاء المخاطي مواجهة. تمتد النسيج باستخدام دبابيس تشريح على طبق السيليكون في المخزن هانكس وترك الباقي لمدة 10 دقيقة في RT (الشكل 1C). هذا يزيل طيات من الأنسجة ويسمح للطبقات العضلات على الاسترخاء. </li></ol> 3. جبل الأنسجة على ناظم البرد لباجتزاء <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> مرر شفرة حلاقة تحت القسم المطلوب من الأنسجة ومن ثم تخلصي من عازلة هانكس. إضافة شفرة حلاقة أخرى إلى الأعلى، مما يجعل شطيرة. قطع الجزء الأنسجة وإزالة المسامير. نقل شطيرة شفرة حلاقة / الأنسجة إلى الثلج الجاف. السماح للأنسجة لتجميد (5-10 دقيقة، 1D الشكل). </li><li style=";text-align:right;direction:rtl"> التقاط الحلاقة / شطيرة الأنسجة والسماح لها دافئ قليلا من خلال وضع الاصبع على BL الأعلىADE (الجانب المخاطية يصل، وهذا يوجه النسيج بحيث يتم مقطوع طبقات العضلات القاعدية أولا). فصل ساندويتش وخفض حول حواف الجزء الأنسجة. قطع شريحة الأنسجة حوالي 0.5 سم × 1 سم. المناطق حافة لديهم ميل إلى حليقة، مما تسبب في مسلسل أقسام تحتوي على العديد من طبقات الأنسجة. لاحظ أن الإفراط في قطع هو أفضل من دون قطع، لذلك يتجه الى جانب الحذر. </li><li style=";text-align:right;direction:rtl"> السماح للأنسجة لتدفئة حتى يبدأ الجليد على قمة الأنسجة في الذوبان. في هذه المرحلة بسرعة وبدقة الضغط على الأنسجة في كتلة أكتوبر في ناظم البرد. </li><li style=";text-align:right;direction:rtl"> إزالة شفرة من خلال وضع الاصبع على العينة. ونقل الحرارة يسمح لك لإزالة شفرة دون تعطيل الأنسجة. </li><li style=";text-align:right;direction:rtl"> معطف النسيج مع أكتوبر ويوازن لمدة 5 دقائق. قطع المقاطع في 10 ميكرون (الشكل 1E، F). تفقد البصر الأقسام حتى ينظر الخبايا. أقسام مكان في 1.5 مل أنابيب أو على الشرائح. </li><li style=";text-align:right;direction:rtl"> لتحليل مرنا أو البروتين، مكان رانه العينات في الأنابيب مع 5 سرداب قاعدة، 5 الانتقالي، و 5 أقسام السطح في أنبوب. لجمع RNA إضافة 1 مل العزلة كاشف التجاري واحتضانها في RT لمدة 10 دقيقة. أداء تنقية RNA وفقا لتعليمات الشركة الصانعة. استخدام 5-10 ميكروغرام من الحمض النووي الريبي مجموع لتوليد كدنا]. </li><li style=";text-align:right;direction:rtl"> لتنقية البروتين، إضافة 0.5 مل من RIPA الباردة العازلة تحلل (بالإضافة إلى مثبطات الأنزيم البروتيني) في 5 أقسام. يصوتن 3 مرات في دورة 70٪، على الجليد. <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> إضافة إلى عينات SDS العازلة تحميل الصفحة (العازلة Laemmli)، واحتضان عند 100 درجة مئوية لمدة 10 دقيقة. العينات الخاضعة للSDS PAGE ونقلها، ثم يعثرا في الحليب 5٪ / برنامج تلفزيوني لمدة 2 ساعة. إجراء تحليل لطخة غربية تليها الحضانة مع الأجسام المضادة KLF4 (1: 500) O / N عند 4 درجات مئوية. </li></ol></li></ol>

<ol>
	<li>Noah, T. K., Donahue, B., Shroyer, N. F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Intestinal+development+and+differentiation.">Intestinal development and differentiation.</a> Exp Cell Res. 317, 2702-2710 (2011).</li><li>Humphries, A., Wright, N. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Colonic+crypt+organization+and+tumorigenesis.">Colonic crypt organization and tumorigenesis.</a> Nat Rev Cancer. 8, 415-424 (2008).</li><li>Weber, C. R., Turner, J. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Inflammatory+bowel+disease:+is+it+really+just+another+break+in+the+wall.">Inflammatory bowel disease: is it really just another break in the wall.</a> Gut. 56, 6-8 (2007).</li><li>Bjerknes, M., Cheng, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Methods+for+the+isolation+of+intact+epithelium+from+the+mouse+intestine.">Methods for the isolation of intact epithelium from the mouse intestine.</a> Anat Rec. 199, 565-574 (1981).</li><li>Sato, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Single+Lgr5+stem+cells+build+crypt-villus+structures+in+vitro+without+a+mesenchymal+niche.">Single Lgr5 stem cells build crypt-villus structures in vitro without a mesenchymal niche.</a> Nature. 459, 262-265 (2009).</li><li>Rand, M. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Calcium+depletion+dissociates+and+activates+heterodimeric+notch+receptors.">Calcium depletion dissociates and activates heterodimeric notch receptors.</a> Mol Cell Biol. 20, 1825-1835 (2000).</li><li>Gjorevski, N., Boghaert, E., Nelson, C. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Regulation+of+Epithelial-Mesenchymal+Transition+by+Transmission+of+Mechanical+Stress+through+Epithelial+Tissues.">Regulation of Epithelial-Mesenchymal Transition by Transmission of Mechanical Stress through Epithelial Tissues.</a> Cancer Microenviron. 5, 29-38 (2012).</li><li>Lechner, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Gene+expression+pattern+of+laser+microdissected+colonic+crypts+of+adenomas+with+low+grade+dysplasia.">Gene expression pattern of laser microdissected colonic crypts of adenomas with low grade dysplasia.</a> Gut. 52, 1148-1153 (2003).</li><li>Reizel, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Colon+stem+cell+and+crypt+dynamics+exposed+by+cell+lineage+reconstruction.">Colon stem cell and crypt dynamics exposed by cell lineage reconstruction.</a> PLoS Genet. 7, e1002192 (2011).</li><li>Kosinski, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Gene+expression+patterns+of+human+colon+tops+and+basal+crypts+and+BMP+antagonists+as+intestinal+stem+cell+niche+factors.">Gene expression patterns of human colon tops and basal crypts and BMP antagonists as intestinal stem cell niche factors.</a> Proc Natl Acad Sci U S A. 104, 15418-15423 (2007).</li><li>Tamura, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Pit+pattern+and+three-dimensional+configuration+of+isolated+crypts+from+the+patients+with+colorectal+neoplasm.">Pit pattern and three-dimensional configuration of isolated crypts from the patients with colorectal neoplasm.</a> J Gastroenterol. 37, 798-806 (2002).</li><li>Geem, D., Medina-Contreras, O., Kim, W., Huang, C. S., Denning, T. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Isolation+and+characterization+of+dendritic+cells+and+macrophages+from+the+mouse+intestine.">Isolation and characterization of dendritic cells and macrophages from the mouse intestine.</a> Journal of visualized experiments : JoVE. , e4040 (2012).</li><li>Laukoetter, M. G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=JAM-A+regulates+permeability+and+inflammation+in+the+intestine+in+vivo.">JAM-A regulates permeability and inflammation in the intestine in vivo.</a> J Exp Med. 204, 3067-3076 (2007).</li><li>Neumann, P. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Gut+commensal+bacteria+and+regional+Wnt+gene+expression+in+the+proximal+versus+distal+colon.">Gut commensal bacteria and regional Wnt gene expression in the proximal versus distal colon.</a> Am J Pathol. 184, 592-599 (2014).</li><li>Capaldo, C. T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Proinflammatory+cytokine-induced+tight+junction+remodeling+through+dynamic+self-assembly+of+claudins.">Proinflammatory cytokine-induced tight junction remodeling through dynamic self-assembly of claudins.</a> Mol Biol Cell. 25, 2710-2719 (2014).</li><li>Wells, J. M., Spence, J. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=How+to+make+an+intestine.">How to make an intestine.</a> Development. 141, 752-760 (2014).</li></ol>

The authors have nothing to disclose

غير مفهومة الآليات الجزيئية المشاركة في القولون تكاثر الخلايا الظهارية والتمايز. وهذا يشمل فجوات في فهمنا للبيئة الإشارات الخلوية من مقصورة الخلايا الجذعية في قاعدة الخبايا الظهارية القولون. وهناك أيضا اهتمام متزايد في العمليات التي تكمن وراء خلية معوية التمايز. على سبيل المثال، زيادة مطلوب فهم في الجسم الحي التمايز كمقياس للدراسات تهدف الى انتاج في المختبر أنظمة المعوية الابتدائية 16. يحتوي الإجراء أعلاه العديد من الخطوات التي تتطلب المزيد من الاهتمام. أولا، وإزالة الحواف حول قطاع الأنسجة المجمدة (كما هو مبين في القسم 3.2) مطلوب كما حواف الأنسجة حليقة أثناء تشريح والتجمد. الفشل في نقل هذه النتائج حواف هو يسكنها خليط من الخلايا السطحية وقاعدة سرداب. تركيب الأنسجة على قبل المبردة، أكتوبر كتلة تعادل الضروري أيضا. تيبروتوكول له يمكن أن تتكيف مع مناطق أخرى من القولون البعيدة عن طريق تغيير عدد من المقاطع في كل تجمع. على سبيل المثال، كما هو مبين في الشكل 1B، المخاطية طول سرداب يتراوح بين 150-300 ميكرون. لذا، عند دراسة المنطقة الواقعة بين 4 سم 6 سم من فتحة الشرج، ينبغي زيادة عدد الفروع من 15 إلى 30. الأهم من ذلك، لا اقترح هذا البروتوكول لالقولون الداني (7 سم 9 سم) وذلك بسبب طيات ( الثنيات المائلة) التي تمتد إلى التجويف مما يجعل من المستحيل خلايا منفصلة السطحية وسرداب قاعدة من قبل باجتزاء المسلسل. وقد استخدمت تقنيات باجتزاء مسلسل لدراسة سرداب قاعدة وسطح السكان الخلايا الظهارية في البشر. ومع ذلك، لدينا بروتوكول يضيف خطوات إضافية مطلوبة نظرا لصغر حجم أنسجة الفئران. نقترح أن البروتوكول المذكور أعلاه سيسمح للتحقيق في سرداب قاعدة والسكان الخلايا الظهارية السطحية في أنظمة الماوس لين العريكة وراثيا. في الواقع، yie أقسام المجمعةدينار بروتين عالي الجودة وRNA تحليل المصب مناسبة. ويمكن أن تشمل التطبيقات المستقبلية دراسة مسارات الإشارات الخلوية أو لونين مناعي. ومع ذلك، تجدر الإشارة إلى أنه، مثل العديد من الطرق البديلة المذكورة أعلاه، تحتوي على أقسام أدى مزيج من الخلايا الظهارية الصفيحة المخصوصة والخلالي. في الختام، بروتوكول الموصوفة هنا يوفر، طريقة العائد المرتفع السريع لتحليل العمليات الجزيئية في مناطق مختلفة مكانيا من الغشاء المخاطي للقولون الفئران.

بطانة القولون الظهارية هي الأنسجة التجدد للغاية، مع الخلايا الجذعية المقيمة تجديد الأنسجة كل بضعة أيام 1. هذه عملية تجديد تتطلب الحفاظ على التكاثري مقصورة الخلايا الجذعية. مع مرور الوقت، فإن الخلايا ابنة المنتجة حديثا تفقد إمكانية التكاثري، وتهاجر نحو السطح اللمعية من الأمعاء. تتزامن مع الهجرة، الخلايا الاصلية تفرق في المعوية لتشكيل حاجز ناضجة أو الخلايا المنتجة للكأس المخاطية. ويعتقد أن فشل هذا البرنامج التمايز للمساهمة في خطر حاجز الظهارية مثل ما لوحظ في مرض التهاب الأمعاء وسرطان القولون 2،3. سوف دراسة مفصلة عن العمليات المذكورة أعلاه تتطلب منهجيات لعزل سرداب قاعدة والخلايا السطحية السكان. توجد أساليب متعددة، ولكل منها مزايا وعيوب فريدة من نوعها. الأساليب الحالية لعزل الخلايا الظهارية في الأمعاء تشمل الفصلوكلاء الإنتشاء والبراءة الميكانيكية، مما أدى إلى عزل الخبايا بأكملها، ورقة الظهارية، أو خلايا واحدة، تعتمد على الظروف التجريبية 4،5. هذه هي أساليب عالية الغلة، ولكن تم الإبلاغ عن التغييرات في إشارة بين الخلايا في ظل هذه الظروف التي قد لا تمثل البيئة المحلية 6،7. القبض على الليزر تسليخ مجهري يسمح لجمع المواد المكانية متميزة، ولكن يحقق الجزيئي المنخفض 8،9 الغلة. في أنسجة القولون الإنسان، مسلسل الطرق cryosectioning الأفقية وقد وضعت 10. ومع ذلك، والأنسجة المخاطية الفئران صغيرة باهظة للاعتماد المباشر لهذه التقنية. في البشر، وأطوال سرداب الأمعاء (والبعيدة بين سرداب قاعدة والخلايا السطحية) في القولون تتفاوت بين ~ 100-1،000 ميكرون 11. في الفئران، وأطوال سرداب ما بين 50-300 ميكرون ~ (انظر الشكل 1A). صغر حجم الخبايا الفئران تحديا لايزولانشوئها من هؤلاء السكان اثنين من خلية باستخدام بروتوكولات القائمة. نحن الآن وصف منخفضة التكلفة، وطريقة العائد المرتفع لعزل سرداب قاعدة وسطح السكان الخلايا الظهارية في أنسجة القولون الفئران. الأنسجة التي تحصد في هذه الطريقة قد ثم يتم تحليلها من قبل عدد من التطبيقات المصب القياسية، بما في ذلك تلطيخ المناعي، RT-PCR (في الوقت الحقيقي، البلمرة المتسلسل) أو النشاف الغربي.

<table border="0" cellpadding="0" cellspacing="0">
	<tbody>
		<tr>
			<td>Microtome</td>
			<td>Leica Biosystems, Nussloch Germany</td>
			<td>CM 1510-3</td>
			<td></td>
		</tr>
		<tr>
			<td>MyiQ real time PCR detector</td>
			<td>BioRad</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>LSM 510&#160;</td>
			<td>Carl Zeiss</td>
			<td></td>
			<td>Confocal microscope</td>
		</tr>
		<tr>
			<td>Materials</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>OCT</td>
			<td>Tissue-Tek, Sakura Finetek, Torrance CA</td>
			<td>4583</td>
			<td></td>
		</tr>
		<tr>
			<td>cryo-mold</td>
			<td>Tissue-Tek, Sakura Finetek, Torrance CA</td>
			<td>4557</td>
			<td>25mmx20mmx5mm</td>
		</tr>
		<tr>
			<td>High profile microtome blade</td>
			<td>Leica Biosystems, Nussloch germany</td>
			<td>818</td>
			<td></td>
		</tr>
		<tr>
			<td>GEM industrial blades</td>
			<td>American Safety Razor Blades</td>
			<td>62-0314</td>
			<td></td>
		</tr>
		<tr>
			<td>Sylgard silicon elastomere base</td>
			<td>Dow Corning, Midland MI</td>
			<td>3097358</td>
			<td></td>
		</tr>
		<tr>
			<td>27 1/2 g needle</td>
			<td>Becton-Dickinson, Franklin Lakes, NJ</td>
			<td>305109</td>
			<td>pins for dissection</td>
		</tr>
		<tr>
			<td>TRizol</td>
			<td>Life Technologies</td>
			<td>15596018</td>
			<td></td>
		</tr>
		<tr>
			<td>Rneasy</td>
			<td>Qiagen</td>
			<td>74104</td>
			<td></td>
		</tr>
		<tr>
			<td>DNAse</td>
			<td>Qiagen</td>
			<td>79254</td>
			<td></td>
		</tr>
		<tr>
			<td>Reagents</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Antibody ZO-1</td>
			<td>Invitrogen&#160;</td>
			<td>187430</td>
			<td></td>
		</tr>
		<tr>
			<td>Antibody KLF4</td>
			<td>Cell Signaling</td>
			<td>4038S</td>
			<td></td>
		</tr>
		<tr>
			<td>Antibody mGAPDH</td>
			<td>Sigma</td>
			<td>G8795</td>
			<td></td>
		</tr>
		<tr>
			<td>Antibody Secondary Alexa conjugate</td>
			<td>Invitrogen</td>
			<td>A11034</td>
			<td>488 anti-rabbit</td>
		</tr>
		<tr>
			<td>Antibody Secondary HRP conjugate</td>
			<td>Jackson</td>
			<td>111/115-001-003</td>
			<td>rabbit/mouse&#160;</td>
		</tr>
		<tr>
			<td>Topro-3</td>
			<td>Invitrogen</td>
			<td>T3605</td>
			<td></td>
		</tr>
		<tr>
			<td>HANKs balanced salt buffer</td>
			<td>Life Technologies</td>
			<td>14025092</td>
			<td></td>
		</tr>
		<tr>
			<td>RIPA lysis buffer</td>
			<td></td>
			<td></td>
			<td>50mM Tris-HCl pH 7.4 150mM NaCl 1% NP40 0.25% Na-deoxycholate</td>
		</tr>
		<tr>
			<td>PCR Primers</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>primer TBP 3&#39;</td>
			<td></td>
			<td></td>
			<td>GGAATTGTACCGCAGCTTCAAA</td>
		</tr>
		<tr>
			<td>primer TBP 5&#39;</td>
			<td></td>
			<td></td>
			<td>GATGACTGCAGCAAATCGCTT</td>
		</tr>
		<tr>
			<td>primer KLF4 3&#39;</td>
			<td></td>
			<td></td>
			<td>TGTGACTATGCAGGCTGTGGCAAA</td>
		</tr>
		<tr>
			<td>primer KLF4 5&#39;</td>
			<td></td>
			<td></td>
			<td>ACAGTGGTAAGGTTTCTCGCCTGT</td>
		</tr>
	</tbody>
</table>

cryosectioning method for microdissection of murine colonic mucosa

The colonic mucosal tissue provides a vital barrier to luminal antigens. This barrier is composed of a monolayer of simple columnar epithelial cells. The colonic epithelium is dynamically turned over and epithelial cells are generated in the stem cell containing crypts of Lieberk&#252;hn. Progenitor cells produced in the crypt-bases migrate toward the luminal surface, undergoing a process of cellular differentiation before being shed into the gut lumen. In order to study these processes at the molecular level, we have developed a simple method for the microdissection of two spatially distinct regions of the colonic mucosa; the proliferative crypt zone, and the differentiated surface epithelial cells. Our objective is to isolate specific crypt and surface epithelial cell populations from mouse colonic mucosa for the isolation of RNA and protein.

تم تجهيز أقسام الأنسجة القولون لتقييم النسيجي وH &amp; E تلطيخ 13. وينظر الى عرض المقطع العرضي التقليدي للالغشاء المخاطي في الشكل 2A. المناطق القاعدية تحتوي على الط العضلية، وتتكون أساسا من العضلية الدائرية. وانطلاقا نحو التجويف، والعضلية المخاطية واضح المتاخمة للخلايا الظهارية-سرداب قاعدة والخلايا الانتقالية هي في منتصف الأنسجة، وأخيرا، يواجه سكان الخلية سطح التجويف الأمعاء. طريقة باجتزاء المسلسل هو موضح هنا يؤكد هذا التوجه بحيث العضلية الطولية والدائرية واجهت أول (الشكل 2B)، تليها العضلية المخاطية (الشكل 2C). لاحظ ظهور خلايا الخلالية غير العضلات في الجزء العلوي الأيسر من الصورة. لوصف تحليل المصب أدناه، يتم تجاهل أقسام العضلات. الأقسام اللاحقة تحتوي على الخلايا الظهارية والنسيج الخلالي (الصفيحة المخصوصة)، بدءا من خلايا سرداب قاعدة (الشكل 2D). لاحظ عدم وجود التجويف المركزي في معظم الخبايا، التي يبدو أغمق بسبب نوى معبأة بشكل وثيق. هذه الطبقات تحتوي على مقصورة التكاثري. الخلايا الانتقالية تظهر معبأة بإحكام الغدد مع شمعة وسط بارزة (الشكل 2E). وأخيرا، السكان خلية السطح لديها بنية غير منتظمة، مع مناطق أحادي الطبقة الظهارية ينظر أون الوجه (الشكل 2F). ويمكن أيضا معالجة مسلسل أقسام على النحو المبين أعلاه لوضع العلامات المناعي والفحص المجهري متحد البؤر (كما هو موضح هنا 14). الشكل 2G معارض الخبايا معزولة الثابتة وpermeabilized في الميثانول بنسبة 100٪ وبعد ذلك الملون للنوى (الأزرق) والبروتين تقاطع خلية خلية نطيقة النطيقة 1 (ZO-1، الأخضر). في الاتجاه باجتزاء التقليدية، ويمكن أن ينظر خلية سرداب والسطحية في وقت واحد (الشكل 2G </stronز&gt;). لاحظ أن ZO-1 خطوط موصلي وصمة عار لمعة من سرداب القولون. ويمكن أيضا أن ينظر إلى هذه البطانة Z0-1 من التجويف في عينات مقطوع المسلسل من السكان الخلايا الانتقالية، في مركز الغدد دائرية الشكل (2G). ويعتبر تعزيز ZO-1 وصمة عار في السكان الخلية السطحية (الشكل 2I وJ). ومن المعروف أن عدة عوامل التمايز أن يتم التعبير عنها بطريقة الزمانية المكانية على طول محور سرداب إلى السطح. ويشمل هذا العامل عامل النسخ Kruppel الشبيهة 4 (KLF4)، والذي يعرف لتخصيبه في السكان الخلية السطح. باستخدام أساليب باجتزاء التقليدية، وجدت KLF4 في نوى التجويف التي تواجه سكان الخلية السطحية (الشكل 2K). وبالتالي فإننا تكهن بأن KLF4 مرنا سيتم التعبير عنه في الغالب في السكان الخلية السطح. لاختبار هذا، وقد تم جمع الأجزاء المتسلسلة وتجميعها في العينات السطحية، الانتقالية، وسرداب قاعدة. Subsequently، كان حصادها RNA باستخدام استخراج Trizol القياسية، مع تنقية إضافية عن طريق العمود RNeasy والعلاج الدناز. وقد تم جمع الحمض النووي الريبي من 5 أقسام متتالية المجمعة، والتي أسفرت عن بين 5-10 ميكروغرام من الحمض النووي الريبي مجموع لكل عينة. ثم تم إخضاع هذه العينات لنصف الكمية في الوقت الحقيقي PCR لكلا KLF4 والجين المرجعية، TATA مربع بروتين ملزمة 1 (TBP-1) (الشكل 2L) 14. كما هو مبين في الشكل 2L، بعد تطبيع لTBP-1، تم العثور على الخلايا السطحية للتعبير عن ما يصل إلى 8 أضعاف KLF4 مرنا التي يعبر عنها في خلايا سرداب. وبالمثل، تم العثور على مستويات البروتين KLF4 لعرض التنظيم المكاني على طول محور سرداب أرض. وكان يتم تجميع الأجزاء المتسلسلة كما هو موضح أعلاه ثم حضنت في تحلل العازلة لمدة 20 دقيقة على 4 درجات مئوية. ونتجت عن ذلك بين 200-250 ميكروغرام من البروتين لكل عينة. عينات ثم تعرض تحليلها من قبل SDS-PAGE (الشكل 2M) 15. كما هو مبين في الشكل 2M، KLF4 صمستويات rotein هي أعلى بشكل كبير في أعداد الخلايا السطحية. النتائج المذكورة أعلاه تدل على قدرة هذا البروتوكول لعزل كميات كبيرة من المياه السطحية والخلايا الظهارية سرداب من الغشاء المخاطي للقولون الفئران. <img alt="الشكل 1" src="/files/ftp_upload/53112/53112fig1.jpg" /> الشكل 1: (A) عرض تخطيطي الغشاء المخاطي للقولون الفئران وطبقات العضلات الخارجية. ويهدف لدينا وسيلة لجمع الخلايا السطحية وسرداب قاعدة السكان خلية منفصلة من قبل cryosectioning التسلسلي (10 ميكرون لكل منهما). يتم تجاهل طبقات العضلات الخارجية. (B) القبو ارتفاع يتفاوت على طول القولون (المسافة بين سرداب قاعدة وسطح طبقات). نقاط البيانات تشير القياسات سرداب الفردية والرموز تشير مكررات البيولوجية (ن = 4). (C) شرائح القولون التي تم جمعها، أوصال، ويشبك على طبق السيليكون تشريح. (D) والأنسجة ذاتهاgment الضغط حوالي 3 سم من فتحة الشرج بين لشفرات الحلاقة والمجمدة على الثلج الجاف. (E) الأنسجة ثم يتم تركيبه على التعادل قبل كتلة أكتوبر. تتم إزالة (F) Cryosections وتفقد البصر. <img alt="الرقم 2" src="/files/ftp_upload/53112/53112fig2.jpg" /> الشكل 2: بيانات تمثيلية (A) أنسجة القولون ملطخة الهيماتوكسيلين-يوزين في المقطع العرضي تبين العضلية الدائرية (سم)، والعضلية المخاطية (مم)، وخلايا سرداب قاعدة والخلايا الانتقالية، والخلايا السطحية. (B - C) طبقات العضلات القولون. (D) خلايا القبو قاعدة. لاحظ عدم وجود التجويف المركزي. (E) الخلايا الانتقالية. (F) الخلايا السطحية. (G) المناعي تلطيخ من الخبايا القولون المعزولة. ويلاحظ ZO-1 (الخضراء) ونوى (الأزرق) في المقطع العرضي. (مرحبا) ZO-1 وتلطيخ النووي في الخلايا الانتقالية والسطحية. (J) صورة مكبرة من ZO-1 تلطيخ. (K) KLF4 (الأخضر) غير المخصب في السكان الخلية السطح. (L) في الوقت الحقيقي PCR تقييم مستويات KLF4 مرنا بين المقصورات الثلاث. (M) تحليل لطخة غربية من مستويات البروتين KLF4 في هؤلاء السكان الخلية.

Watch this Scientific Journal Video about Cryosectioning Method for Microdissection of Murine Colonic Mucosa at JoVE.com

Cryosectioning Method for Microdissection of Murine Colonic Mucosa

Here we describe a simple method for the isolation of spatially distinct murine colonic epithelial surface cells from the underlying crypt-base cells.

الطريقة Cryosectioning لتسليخ مجهري الفئران القولون الغشاء المخاطي

The colonic mucosal tissue provides a vital barrier to luminal antigens. This barrier is composed of a monolayer of simple columnar epithelial cells. The ...

cryosectioning-method-for-microdissection-of-murine-colonic-mucosa

Research

JoVE Journal

Biology

17.1K Views.  Emory University, Atlanta, Georgia. Here we describe a simple method for the isolation of spatially distinct murine colonic epithelial surface cells from the underlying crypt-base cells.

Video: Cryosectioning Method for Microdissection of Murine Colonic Mucosa

Flash Freezing and Cryosectioning E12.5 Mouse Brain

Demonstrated in this video are the techniques for flash freezing and sectioning embryonic brain tissue from mouse. Useful tips for using the cryostat are given, including troubleshooting methods that can be used while cutting to ensure that the resultant tissues sections are free of cracks and other distortions.

فلاش التجميد وCryosectioning E12.5 مخ الفأر

Laser Capture Microdissection of Mammalian Tissue

Laser capture microscopy, also known as laser microdissection (LMD), enables the user to isolate small numbers of cells or tissues from frozen or formalin-fixed, paraffin-embedded tissue sections. LMD techniques rely on a thermo labile membrane placed either on top of, or underneath, the tissue section. In one method, focused laser energy is used to melt the membrane onto the underlying cells, which can then be lifted out of the tissue section. In the other, the laser energy vaporizes the foil along a path "drawn" on the tissue, allowing the selected cells to fall into a collection device. Each technique allows the selection of cells with a minimum resolution of several microns. DNA, RNA, protein, and lipid samples may be isolated and analyzed from micro-dissected samples. In this video, we demonstrate the use of the Leica AS-LMD laser microdissection instrument in seven segments, including an introduction to the principles of LMD, initializing the instrument for use, general considerations for sample preparation, mounting the specimen and setting up capture tubes, aligning the microscope, adjusting the capture controls, and capturing tissue specimens. Laser-capture micro-dissection enables the investigator to isolate samples of pure cell populations as small as a few cell-equivalents. This allows the analysis of cells of interest that are free of neighboring contaminants, which may confound experimental results.

الليزر Microdissection القبض على أنسجة الثدييات

Laser capture microscopy, also known as laser microdissection (LMD), enables the user to isolate small numbers of cells or tissues from frozen or ...

Microdissection of Zebrafish Embryonic Eye Tissues

Zebrafish is a popular animal model for research on eye development because of its rapid ex utero development and good fecundity. By 3 days post fertilization (dpf), the larvae will show the first visual response. Many genes have been identified to control a proper eye development, but we are far from a complete understanding of the underlying genetic architecture. Whole genome gene expression profiling is a useful tool to elucidate genetic regulatory network for eye development. However, the small size of the embryonic eye in zebrafish makes it challenging to obtain intact and pure eye tissues for expression analysis. For example, the anterior-posterior length of the eye between day 2 and 3 is only approximately 200-300 &mu;m, while the diameter of the lens is less 100 &mu;m. Also, the retinal pigment epithelium (RPE) underlying the retina is just a single-layer epithelium. While gene expression profiles can be obtained from the whole embryo, they do not accurately represent the expression of these tissues. Therefore pure tissue must be obtained for a successful gene expression profiling of eye development. To address this issue, we have developed an approach to microdissect intact retina and retina with RPE attached from 1-3 dpf, which cover major stages of eye morphogenesis. All procedures can be done with fine forceps and general laboratory supplies under standard stereomicroscopes. For retinal dissection, the single-layer RPE is removed and peeled off by brushing action and the preferential adherence of the RPE remnants to the surface of the culture plate for dissection. For RPE-attached retinal dissection, the adherence of RPE to the dissection plate is removed before the dissection so that the RPE can be completely preserved with the retina. A careful lifting action of this tissue can efficiently separate the presumptive choroid and sclera. The lens can be removed in both cases by a chemically etched tungsten needle. In short, our approach can obtain intact eye tissues and has been successfully utilized to study tissue-specific expression profiles of zebrafish retina1, 2 and retinal pigment epithelium3.

This article describes an approach to microdissect zebrafish retinas with and without retinal pigment epithelium attached, from one to three days postfertilization embryos.

Microdissection من الأنسجة الجنينية العين اسماك الزرد

Zebrafish is a popular animal model for research on eye development because of its rapid ex utero development and good fecundity. By 3 days post ...

Microdissection of Black Widow Spider Silk-producing Glands

Modern spiders spin high-performance silk fibers with a broad range of biological functions, including locomotion, prey capture and protection of developing offspring 1,2. Spiders accomplish these tasks by spinning several distinct fiber types that have diverse mechanical properties. Such specialization of fiber types has occurred through the evolution of different silk-producing glands, which function as small biofactories. These biofactories manufacture and store large quantities of silk proteins for fiber production. Through a complex series of biochemical events, these silk proteins are converted from a liquid into a solid material upon extrusion.
Mechanical studies have demonstrated that spider silks are stronger than high-tensile steel 3. Analyses to understand the relationship between the structure and function of spider silk threads have revealed that spider silk consists largely of proteins, or fibroins, that have block repeats within their protein sequences 4. Common molecular signatures that contribute to the incredible tensile strength and extensibility of spider silks are being unraveled through the analyses of translated silk cDNAs. Given the extraordinary material properties of spider silks, research labs across the globe are racing to understand and mimic the spinning process to produce synthetic silk fibers for commercial, military and industrial applications. One of the main challenges to spinning artificial spider silk in the research lab involves a complete understanding of the biochemical processes that occur during extrusion of the fibers from the silk-producing glands.
Here we present a method for the isolation of the seven different silk-producing glands from the cobweaving black widow spider, which includes the major and minor ampullate glands [manufactures dragline and scaffolding silk] 5,6, tubuliform [synthesizes egg case silk] 7,8, flagelliform [unknown function in cob-weavers], aggregate [makes glue silk], aciniform [synthesizes prey wrapping and egg case threads] 9 and pyriform [produces attachment disc silk] 10. This approach is based upon anesthetizing the spider with carbon dioxide gas, subsequent separation of the cephalothorax from the abdomen, and microdissection of the abdomen to obtain the silk-producing glands. Following the separation of the different silk-producing glands, these tissues can be used to retrieve different macromolecules for distinct biochemical analyses, including quantitative real-time PCR, northern- and western blotting, mass spectrometry (MS or MS/MS) analyses to identify new silk protein sequences, search for proteins that participate in the silk assembly pathway, or use the intact tissue for cell culture or histological experiments.

Here we describe an efficient strategy to remove the silk-producing glands from the abdomen of female black widow spiders. This procedure allows the rapid isolation of the seven distinct silk-producing glands in a highly purified fashion, an important process for investigators studying spider silk production and fiber assembly.

Microdissection الغدد الارملة السوداء الحرير المنتجة العنكبوت

Modern spiders spin high-performance silk fibers with a broad range of biological functions, including locomotion, prey capture and protection of ...

A Novel Method for the Culture and Polarized Stimulation of Human Intestinal Mucosa Explants

Few models currently exist to realistically simulate the complex human intestine's micro-environment, where a variety of interactions take place. Proper homeostasis directly depends on these interactions, as they shape an entire immunological response inducing tolerance against food antigens while at the same time mounting effective immune responses against pathogenic microbes accidentally ingested with food.
Intestinal homeostasis is preserved also through various complex interactions between the microbiota (including food-associated beneficial bacterial strains) and the host, that regulate the attachment/degradation of mucus, the production of antimicrobial peptides by the epithelial barrier, and the "education" of epithelial cells' that controls the tolerogenic or immunogenic phenotype of unique, gut-resident lymphoid cells' populations. These interactions have been so far very difficult to reproduce with in vitro assays using either cultured cell lines or peripheral blood mononuclear cells. In addition, mouse models differ substantially in components of the intestinal mucosa (mucus layer organization, commensal bacteria community) with respect to the human gut. Thus, studies of a variety of treatments to be brought in the clinics for important stress-related or pathological conditions such as irritable bowel syndrome, inflammatory bowel disease or colorectal cancer have been difficult to carry out.
To address these issues, we developed a novel system that enables us to stimulate explants of human intestinal mucosa that retain their in situ conditioning by the host microbiota and immune response, in a polarized fashion. Polarized apical stimulation is of great importance for the outcome of the elicited immune response. It has been repeatedly shown that the same stimuli can produce completely different responses when they bypass the apical face of the intestinal epithelium, stimulating epithelial cells basolaterally or coming into direct contact with lamina propria components, switching the phenotype from tolerogenic to immunogenic and causing unnecessary and excessive inflammation in the area.
We achieved polarized stimulation by gluing a cave cylinder which delimited the area of stimulation on the apical face of the mucosa as will be described in the protocol. We used this model to examine, among others, differential effects of three different Lactobacilli strains. We show that this model system is very powerful to assess the immunomodulatory properties of probiotics in healthy and disease conditions.

We introduce a novel method for the maintenance of human intestinal mucosa in culture and monitoring of the response to various types of stimuli over at least 24 hrs. With our method, the polarity of the tissue is maintained, allowing for a physiological stimulation via the apical route.

طريقة مبتكرة لثقافة الاستقطاب وتحفيز من explants الإنسان مخاطية الأمعاء

Few models currently exist to realistically simulate the complex human intestine's micro-environment, where a variety of interactions take place. Proper ...

Cryosectioning Yeast Communities for Examining Fluorescence Patterns

Microbes typically live in communities. The spatial organization of cells within a community is believed to impact the survival and function of the community1. Optical sectioning techniques, including confocal and two-photon microscopy, have proven useful for observing spatial organization of bacterial and archaeal communities2,3. A combination of confocal imaging and physical sectioning of yeast colonies has revealed internal organization of cells4. However, direct optical sectioning using confocal or two-photon microscopy has been only able to reach a few cell layers deep into yeast colonies. This limitation is likely because of strong scattering of light from yeast cells4.
Here, we present a method based on fixing and cryosectioning to obtain spatial distribution of fluorescent cells within Saccharomyces cerevisiae communities. We use methanol as the fixative agent to preserve the spatial distribution of cells. Fixed communities are infiltrated with OCT compound, frozen, and cryosectioned in a cryostat. Fluorescence imaging of the sections reveals the internal organization of fluorescent cells within the community.
Examples of yeast communities consisting of strains expressing red and green fluorescent proteins demonstrate the potentials of the cryosectioning method to reveal the spatial distribution of fluorescent cells as well as that of gene expression within yeast colonies2,3. Even though our focus has been on Saccharomyces cerevisiae communities, the same method can potentially be applied to examine other microbial communities.

We present a protocol for freezing and cryosectioning yeast communities to observe internal patterns of fluorescent cells. The method relies on methanol-fixing and OCT-embedding to preserve the spatial distribution of cells without inactivating fluorescent proteins within a community.

Cryosectioning المجتمعات الخميرة لفحص أنماط الإسفار

Microbes typically live  in communities. The spatial organization  of cells within a community is believed to impact the survival and function of the  ...

Laser-assisted Microdissection (LAM) as a Tool for Transcriptional Profiling of Individual Cell Types

The understanding of developmental processes at the molecular level requires insights into transcriptional regulation, and thus the transcriptome, at the level of individual cell types. While the methods described here are generally applicable to a wide range of species and cell types, our research focuses on plant reproduction. Plant cultivation and seed production is of crucial importance for human and animal nutrition. A detailed understanding of the regulatory networks that govern the formation of the reproductive lineage (germline) and ultimately of seeds is a precondition for the targeted manipulation of plant reproduction. In particular, the engineering of apomixis (asexual reproduction through seeds) into crop plants promises great improvements, as it leads to the formation of clonal seeds that are genetically identical to the mother plant. Consequently, the cell types of the female germline are of major importance for the understanding and engineering of apomixis. However, as the corresponding cells are deeply embedded within the floral tissues, they are very difficult to access for experimental analyses, including cell-type specific transcriptomics. To overcome this limitation, sections of individual cells can be isolated by laser-assisted microdissection (LAM). While LAM in combination with transcriptional profiling allows the identification of genes and pathways active in any cell type with high specificity, establishing a suitable protocol can be challenging. Specifically, the quality of RNA obtained after LAM can be compromised, especially when small, single cells are targeted. To circumvent this problem, we have established a workflow for LAM that reproducibly results in high RNA quality that is well suitable for transcriptomics, as exemplified here by the isolation of cells of the female germline in apomictic Boechera. In this protocol, procedures are described for tissue preparation and LAM, also with regard to RNA extraction and quality control.

Laser-assisted Microdissection LAM as a Tool for Transcriptional Profiling of Individual Cell Types

Here we present a protocol for laser-assisted microdissection of specific plant cell types for transcriptional profiling. While the protocol is suitable for different species and cell types, the focus is on highly inaccessible cells of the female germline important for sexual and apomictic reproduction in the crucifer genus Boechera.

بمساعدة الليزر تسليخ مجهري (لام) كأداة للالترانسكربتي التنميط من أنواع الخلايا الفردية

The understanding of developmental processes at the molecular level requires insights into transcriptional regulation, and thus the transcriptome, at the ...

Cryosectioning of Contiguous Regions of a Single Mouse Skeletal Muscle for Gene Expression and Histological Analyses

With this method, consecutive cryosections are collected to enable both microscopy applications for tissue histology and enrichment of RNA for gene expression using adjacent regions from a single mouse skeletal muscle. Typically, it is challenging to achieve adequate homogenization of small skeletal muscle samples because buffer volumes may be too low for efficient grinding applications, yet without sufficient mechanical disruption, the dense tissue architecture of muscle limits penetration of buffer reagents, ultimately causing low RNA yield. By following the protocol reported here, 30 &#956;m sections are collected and pooled allowing cryosectioning and subsequent needle homogenization to mechanically disrupt the muscle, increasing the surface area exposed for buffer penetration. The primary limitations of the technique are that it requires a cryostat, and it is relatively low throughput. However, high-quality RNA can be obtained from small samples of pooled muscle cryosections, making this method accessible for many different skeletal muscles and other tissues. Furthermore, this technique enables matched analyses (e.g., tissue histopathology and gene expression) from adjacent regions of a single skeletal muscle so that measurements can be directly compared across applications to reduce experimental uncertainty and to reduce replicative animal experiments necessary to source a small tissue for multiple applications.

Consecutive cryo-sections are collected to enable histological applications and enrichment of RNA for gene expression measurements using adjacent regions from a single mouse skeletal muscle. High-quality RNA is obtained from 20 - 30 mg of pooled cryosections and measurements are directly compared across applications.

Cryosectioning المناطق المتاخمة من العضلات الهيكلية واحدة فأرة للالتعبير الجيني والتحليلات النسيجية

With this method, consecutive cryosections are collected to enable both microscopy applications for tissue histology and enrichment of RNA for gene ...

A Morphometric and Cellular Analysis Method for the Murine Mandibular Condyle

The temporomandibular joint (TMJ) has the capacity to adapt to external stimuli, and loading changes can affect the position of condyles, as well as the structural and cellular components of the mandibular condylar cartilage (MCC). This manuscript describes methods for analyzing these changes and a method for altering the loading of the TMJ in mice (i.e., compressive static TMJ loading). The structural evaluation illustrated here is a simple morphometric approach that uses the Digimizer software and is performed in radiographs of small bones. In addition, the analysis of cellular changes leading to alterations in collagen expression, bone remodeling, cell division, and proteoglycan distribution in the MCC is described. The quantification of these changes in histological sections - by counting the positive fluorescent pixels using image software and measuring the distance mapping and stained area with Digimizer - is also demonstrated. The methods shown here are not limited to the murine TMJ, but could be used on additional bones of small experimental animals and in other regions of endochondral ossification.

This manuscript presents methods for analyzing morphometric and cellular changes within the mandibular condyle of rodents.

شكلي وطريقة التحليل الخلوي للقمة الفك السفلي مورين

The temporomandibular joint (TMJ) has the capacity to adapt to external stimuli, and loading changes can affect the position of condyles, as well as the ...

Laser Capture Microdissection of Highly Pure Trabecular Meshwork from Mouse Eyes for Gene Expression Analysis

Laser capture microdissection (LCM) has allowed gene expression analysis of single cells and enriched cell populations in tissue sections. LCM is a great tool for the study of the molecular mechanisms underlying cell differentiation and the development and progression of various diseases, including glaucoma. Glaucoma, which comprises a family of progressive optic neuropathies, is the most common cause of irreversible blindness worldwide. Structural changes and damage within the trabecular meshwork (TM) can result in increased intraocular pressure (IOP), which is a major risk factor for developing glaucoma. However, the precise molecular mechanisms involved are still poorly understood. The ability to perform gene expression analysis will be crucial in obtaining further insights into the function of these cells and its role in the regulation of IOP and glaucoma development. To achieve this, a reproducible method for isolating highly enriched TM from frozen sections of mouse eyes and a method for downstream gene expression analysis, such as RT-qPCR and RNA-Seq is needed. The method described herein is developed to isolate highly pure TM from mouse eyes for downstream digital PCR and microarray analysis. In addition, this technique can be easily adapted for the isolation of other highly enriched ocular cells and cell compartments that have been difficult to isolate from mouse eyes. The combination of LCM and RNA analysis can contribute to a more comprehensive understanding of the cellular events underlying glaucoma.

Here, we describe a protocol for a reproducible laser capture microdissection (LCM) for isolating trabecular meshwork (TM) for downstream RNA analysis. The ability to analyze changes in gene expression in the TM will help in understanding the underlying molecular mechanisms of TM-related ocular diseases.

ليزر التقاط ميكروديسيكشن من ميشوورك ترابيكولار نقية جداً من عيون الماوس لتحليل التعبير الجيني

Laser capture microdissection (LCM) has allowed gene expression analysis of single cells and enriched cell populations in tissue sections. LCM is a great ...