Supported by National Institutes of Health (DK55679, and DK59888 to A.N.). Emory University&#160;Integrated Cellular Imaging Microscopy Core of the Winship Cancer&#160;Institute comprehensive cancer center grant, P30CA138292, and the Crohn's and Colitis Foundation of America Career Development award to C.T.C. and Fellowship Award to A.E.F.

Los experimentos utilizaron ratones C57BL / 6 entre 10 y 12 semanas de edad. Todos los procedimientos que utilizan los animales fueron revisados ​​y aprobados por el Comité de Cuidado y Uso de Emory Universidad Institucional Animal y se llevaron a cabo de acuerdo con los Institutos Nacionales de Salud criterios. 1. Configuración Experimental <ol><li> Configuración del criostato <ol><li> Equilibrar criostato a -20 ° C, incluyendo la hoja microtomo y mandriles (tener mucho cuidado alrededor de la hoja!). </li><li> Llenar un vacío con criomolde octubre (compuesto óptimo de corte de la temperatura) y equilibrar a -20 ° C (~ 30 min). Retire la congelada octubre del molde y fijarla en el plato con OCT líquido. Coloque el bloque / tirada en el brazo microtomo y permitir que los PTU se asiente durante 10 min. </li><li> Ajuste el criostato a 10 micras por sección y afeitar el bloque de octubre hasta que es plana. Copia el brazo microtomo lejos de la hoja por varios centímetros. En este punto, no ajuste la cuchilla o tenazas para el resto de la experiment. </li></ol></li><li> Preparar las hojas de afeitar: Prepare 2 hojas de afeitar por muestra. Usando una lima de metal, sin brillo el borde afilado de cuchillas. A continuación, retire la brida de aluminio con unas pinzas. </li><li> Pre-enfriar un plato de Pyrex u otra superficie plana en hielo seco. </li><li> Preparar un plato de disección con 10-15 pines de disección. Un 10 cm placa de cultivo tisular de 50% lleno de silicio será suficiente. Añadir 5 ml de tampón de Hanks a TA. </li></ol> 2. Disección de colon distal de Tejidos <ol><li> Coloque los ratones en una cámara sellada y la eutanasia a los ratones por inhalación de isoflurano y dislocación cervical, y luego rociar etanol al 70% en el abdomen y el tórax 12. </li><li> Haga una pequeña incisión en la piel del abdomen con unas tijeras y luego hacer una incisión para exponer la cavidad peritoneal. Procedimientos similares se pueden encontrar aquí descrito 12. </li><li> Cortar el intestino grueso en el borde anal y desmenuzar el mesenterio hasta que el colon es gratuita. </li><li> Extirpar un colon distalsegmento entre 0 y 6 cm del ano. Aquí, la profundidad de las criptas es de ~ 150 micras (véase la Figura 1B). Corte abierto el colon longitudinalmente con unas tijeras y retire los contenidos fecales. </li><li> Pin el tejido para el plato de disección con la superficie de la mucosa hacia arriba. Estire los tejidos utilizando pasadores de disección en un plato de silicio en tampón Hanks y dejar reposar durante 10 minutos a temperatura ambiente (Figura 1C). Esto elimina los pliegues del tejido y permite que las capas de músculo se relaje. </li></ol> 3. Monte de Tejidos en el criostato de seccionamiento <ol><li> Deslizar una hoja de afeitar en la sección deseada de tejido y luego verter fuera el tampón de Hanks. Añadir otra hoja de afeitar para la parte superior, haciendo un sandwich. Cortar el segmento de tejido y quitar los pasadores. Transferir el sándwich cuchilla de afeitar / tejido para hielo seco. Permitir que el tejido se congele (5-10 min, la Figura 1D). </li><li> Recoge la navaja / sándwich de tejidos y deje que se caliente un poco colocando un dedo en el bl superiorade (lado de la mucosa hacia arriba. Esto orienta el tejido de modo que las capas musculares basales se seccionan primero.). Separar el sándwich y cortar alrededor de los bordes del segmento de tejido. Cortar un segmento de tejido aproximadamente, 0,5 cm x 1 cm. Zonas de borde tienen una tendencia a curvarse, haciendo que las secciones en serie a contienen muchas capas de tejido. Tenga en cuenta que el exceso de corte es mejor que bajo el corte, por lo que errar por el lado de la precaución. </li><li> Deje que el tejido se caliente hasta que el hielo en la parte superior del tejido comienza a derretirse. En este punto de forma rápida y con cuidado presione el tejido en el bloque de octubre en el criostato. </li><li> Retire la hoja colocando un dedo sobre la muestra. La transferencia de calor le permitirá quitar la cuchilla sin alterar el tejido. </li><li> Escudo del tejido con octubre y equilibre durante 5 min. Cortar secciones a las 10 micras (Figura 1E, F). Inspeccione visualmente las secciones hasta que se ven las criptas. Coloque las secciones en unos tubos de 1,5 ml o en las diapositivas. </li><li> Para el análisis de ARNm o proteína, lugar tél muestras en tubos con 5 cripta-base, 5 de transición y 5 secciones de superficie por tubo. Para la recolección de ARN añadir 1 ml de reactivo aislamiento comercial e incubar a TA durante 10 min. Realizar la purificación del ARN según las instrucciones del fabricante. Utilice 5-10 g de ARN total para la generación de ADNc. </li><li> Para la purificación de proteínas, añadir 0,5 ml de tampón de lisis frío RIPA (más inhibidores de la proteasa) por 5 secciones. Sonicar 3 veces en un ciclo de 70%, en hielo. <ol><li> Añadir muestras a SDS buffer de carga de la página (tampón Laemmli) e incubar a 100 ° C durante 10 minutos. Muestras sujetas a SDS PAGE y transferencia, a continuación, en el bloque 5% de leche / PBS durante 2 horas. Realizar análisis de transferencia Western seguido de incubación con anticuerpos KLF4 (1: 500) O / N a 4 ° C. </li></ol></li></ol>

<ol>
	<li>Noah, T. K., Donahue, B., Shroyer, N. F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Intestinal+development+and+differentiation.">Intestinal development and differentiation.</a> Exp Cell Res. 317, 2702-2710 (2011).</li><li>Humphries, A., Wright, N. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Colonic+crypt+organization+and+tumorigenesis.">Colonic crypt organization and tumorigenesis.</a> Nat Rev Cancer. 8, 415-424 (2008).</li><li>Weber, C. R., Turner, J. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Inflammatory+bowel+disease:+is+it+really+just+another+break+in+the+wall.">Inflammatory bowel disease: is it really just another break in the wall.</a> Gut. 56, 6-8 (2007).</li><li>Bjerknes, M., Cheng, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Methods+for+the+isolation+of+intact+epithelium+from+the+mouse+intestine.">Methods for the isolation of intact epithelium from the mouse intestine.</a> Anat Rec. 199, 565-574 (1981).</li><li>Sato, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Single+Lgr5+stem+cells+build+crypt-villus+structures+in+vitro+without+a+mesenchymal+niche.">Single Lgr5 stem cells build crypt-villus structures in vitro without a mesenchymal niche.</a> Nature. 459, 262-265 (2009).</li><li>Rand, M. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Calcium+depletion+dissociates+and+activates+heterodimeric+notch+receptors.">Calcium depletion dissociates and activates heterodimeric notch receptors.</a> Mol Cell Biol. 20, 1825-1835 (2000).</li><li>Gjorevski, N., Boghaert, E., Nelson, C. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Regulation+of+Epithelial-Mesenchymal+Transition+by+Transmission+of+Mechanical+Stress+through+Epithelial+Tissues.">Regulation of Epithelial-Mesenchymal Transition by Transmission of Mechanical Stress through Epithelial Tissues.</a> Cancer Microenviron. 5, 29-38 (2012).</li><li>Lechner, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Gene+expression+pattern+of+laser+microdissected+colonic+crypts+of+adenomas+with+low+grade+dysplasia.">Gene expression pattern of laser microdissected colonic crypts of adenomas with low grade dysplasia.</a> Gut. 52, 1148-1153 (2003).</li><li>Reizel, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Colon+stem+cell+and+crypt+dynamics+exposed+by+cell+lineage+reconstruction.">Colon stem cell and crypt dynamics exposed by cell lineage reconstruction.</a> PLoS Genet. 7, e1002192 (2011).</li><li>Kosinski, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Gene+expression+patterns+of+human+colon+tops+and+basal+crypts+and+BMP+antagonists+as+intestinal+stem+cell+niche+factors.">Gene expression patterns of human colon tops and basal crypts and BMP antagonists as intestinal stem cell niche factors.</a> Proc Natl Acad Sci U S A. 104, 15418-15423 (2007).</li><li>Tamura, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Pit+pattern+and+three-dimensional+configuration+of+isolated+crypts+from+the+patients+with+colorectal+neoplasm.">Pit pattern and three-dimensional configuration of isolated crypts from the patients with colorectal neoplasm.</a> J Gastroenterol. 37, 798-806 (2002).</li><li>Geem, D., Medina-Contreras, O., Kim, W., Huang, C. S., Denning, T. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Isolation+and+characterization+of+dendritic+cells+and+macrophages+from+the+mouse+intestine.">Isolation and characterization of dendritic cells and macrophages from the mouse intestine.</a> Journal of visualized experiments : JoVE. , e4040 (2012).</li><li>Laukoetter, M. G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=JAM-A+regulates+permeability+and+inflammation+in+the+intestine+in+vivo.">JAM-A regulates permeability and inflammation in the intestine in vivo.</a> J Exp Med. 204, 3067-3076 (2007).</li><li>Neumann, P. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Gut+commensal+bacteria+and+regional+Wnt+gene+expression+in+the+proximal+versus+distal+colon.">Gut commensal bacteria and regional Wnt gene expression in the proximal versus distal colon.</a> Am J Pathol. 184, 592-599 (2014).</li><li>Capaldo, C. T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Proinflammatory+cytokine-induced+tight+junction+remodeling+through+dynamic+self-assembly+of+claudins.">Proinflammatory cytokine-induced tight junction remodeling through dynamic self-assembly of claudins.</a> Mol Biol Cell. 25, 2710-2719 (2014).</li><li>Wells, J. M., Spence, J. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=How+to+make+an+intestine.">How to make an intestine.</a> Development. 141, 752-760 (2014).</li></ol>

The authors have nothing to disclose

Los mecanismos moleculares implicados en la proliferación de células epiteliales del colon y la diferenciación son poco conocidos. Esto incluye lagunas en nuestra comprensión del entorno de señalización celular del compartimento de células madre en la base de las criptas epiteliales del colon. También hay un creciente interés en los procesos que subyacen a la diferenciación enterocito. Por ejemplo, el aumento se requiere la comprensión de la diferenciación in vivo como un punto de referencia para los estudios destinados a la producción de sistemas intestinales primarias in vitro 16. El procedimiento anterior contiene varios pasos que requieren una atención especial. En primer lugar, se requiere la eliminación de los bordes de todo el segmento de tejido congelado (como se discutió en la sección 3.2), como los bordes de tejido rizo durante la disección y la congelación. Si no se mueve estos bordes resultados es una población mixta de células de la superficie de base y cripta. Montaje del tejido en un bloque de pre-enfriado, nivelado octubre también es esencial. Tsu protocolo puede ser adaptado a otras áreas del colon distal alterando el número de secciones en cada piscina. Por ejemplo, como se muestra en la Figura 1B, la longitud de la cripta mucosal varía entre 150-300 micras. Por lo tanto, en el estudio de la región entre los 4 cm de 6 cm del ano, el número de secciones debería aumentarse de 15 a 30. Es importante destacar que este protocolo no se sugiere para el colon proximal (7 cm 9 cm) debido a los pliegues ( plicas obliquae) que se extienden hacia la luz por lo que es imposible de superficie y la cripta-base celdas separadas por seccionamiento de serie. Técnicas de seccionamiento en serie se han utilizado para estudiar cripta-base y la superficie poblaciones de células epiteliales en los seres humanos. Sin embargo, nuestro protocolo añade pasos adicionales que se requieren debido al pequeño tamaño de tejido murino. Proponemos que el protocolo anterior permitirá la investigación de la cripta-base y la población de células epiteliales superficiales en sistemas de ratón genéticamente manejables. De hecho, las secciones agrupados Yield proteínas de alta calidad y el ARN análisis de aguas abajo adecuado. Las futuras aplicaciones podrían incluir el estudio de las vías de señalización celular o inmunoprecipitación de la cromatina. Sin embargo, debe tenerse en cuenta que, al igual que varios de los métodos alternativos descritos anteriormente, las secciones resultantes contienen una mezcla de células de la lámina propia epiteliales e intersticiales. En conclusión, el protocolo descrito aquí proporciona un método rápido rendimiento, alta para el análisis de los procesos moleculares en regiones espacialmente distintas de la mucosa del colon murino.

El revestimiento epitelial del colon es un tejido altamente regenerativa, con células madre residentes reponer el tejido cada pocos días 1. Este proceso de regeneración requiere el mantenimiento de un compartimento de células madre proliferativa. Con el tiempo, las células hijas recién producidos pierden su potencial proliferativo y migran hacia la superficie luminal del intestino. Coincidiendo con la migración, las células progenitoras se diferencian en enterocitos barrera formadora maduros o mucosas células caliciformes productoras. Fracaso de este programa de diferenciación se cree que contribuyen a la barrera epitelial comprometida tal como se observa en la enfermedad inflamatoria intestinal y cáncer de colon 2,3. Estudio detallado de los procesos anteriores requerirá metodologías para aislar cripta-base y los teléfonos superficie poblaciones. Existen métodos múltiples, cada uno con sus ventajas y desventajas únicas. Los métodos actuales para el aislamiento de células epiteliales intestinales incluyen chagentes elating y disociación mecánica, lo que resulta en el aislamiento de criptas enteras, láminas epiteliales o células individuales, dependientes de las condiciones experimentales 4,5. Estos son los métodos de alto rendimiento, sin embargo, los cambios en la señalización intercelular se han reportado en estas condiciones que pueden no representar el entorno nativo de 6,7. Captura de microdisección láser permite la recolección de material distinto espacial, pero logra bajo 8,9 rendimiento molecular. En el tejido del colon humano, métodos cryosectioning horizontales de serie se han desarrollado 10. Sin embargo, los tejidos mucosos murinos son prohibitivamente pequeño para la apropiación directa de esta técnica. En los seres humanos, las longitudes de cripta intestinal (la distancia entre la cripta-base y células de la superficie) en el colon varía entre 100-1.000 micras ~ 11. En ratones, las longitudes de las criptas son entre ~ 50-300 micras (ver Figura 1A). El pequeño tamaño de las criptas murinos presenta un desafío a la isolación de estas dos poblaciones celulares utilizando protocolos existentes. Ahora describir un bajo costo, método de alto rendimiento para el aislamiento de la cripta-base y la superficie de la población de células epiteliales en el tejido del colon murino. Tejido recogido de esta manera puede entonces ser analizada por un número de aplicaciones posteriores estándar, incluyendo la tinción de inmunofluorescencia, RT-PCR (Reacción en Cadena de la Polimerasa en Tiempo Real-) o el Western Blot.

<table border="0" cellpadding="0" cellspacing="0">
	<tbody>
		<tr>
			<td>Microtome</td>
			<td>Leica Biosystems, Nussloch Germany</td>
			<td>CM 1510-3</td>
			<td></td>
		</tr>
		<tr>
			<td>MyiQ real time PCR detector</td>
			<td>BioRad</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>LSM 510&#160;</td>
			<td>Carl Zeiss</td>
			<td></td>
			<td>Confocal microscope</td>
		</tr>
		<tr>
			<td>Materials</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>OCT</td>
			<td>Tissue-Tek, Sakura Finetek, Torrance CA</td>
			<td>4583</td>
			<td></td>
		</tr>
		<tr>
			<td>cryo-mold</td>
			<td>Tissue-Tek, Sakura Finetek, Torrance CA</td>
			<td>4557</td>
			<td>25mmx20mmx5mm</td>
		</tr>
		<tr>
			<td>High profile microtome blade</td>
			<td>Leica Biosystems, Nussloch germany</td>
			<td>818</td>
			<td></td>
		</tr>
		<tr>
			<td>GEM industrial blades</td>
			<td>American Safety Razor Blades</td>
			<td>62-0314</td>
			<td></td>
		</tr>
		<tr>
			<td>Sylgard silicon elastomere base</td>
			<td>Dow Corning, Midland MI</td>
			<td>3097358</td>
			<td></td>
		</tr>
		<tr>
			<td>27 1/2 g needle</td>
			<td>Becton-Dickinson, Franklin Lakes, NJ</td>
			<td>305109</td>
			<td>pins for dissection</td>
		</tr>
		<tr>
			<td>TRizol</td>
			<td>Life Technologies</td>
			<td>15596018</td>
			<td></td>
		</tr>
		<tr>
			<td>Rneasy</td>
			<td>Qiagen</td>
			<td>74104</td>
			<td></td>
		</tr>
		<tr>
			<td>DNAse</td>
			<td>Qiagen</td>
			<td>79254</td>
			<td></td>
		</tr>
		<tr>
			<td>Reagents</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Antibody ZO-1</td>
			<td>Invitrogen&#160;</td>
			<td>187430</td>
			<td></td>
		</tr>
		<tr>
			<td>Antibody KLF4</td>
			<td>Cell Signaling</td>
			<td>4038S</td>
			<td></td>
		</tr>
		<tr>
			<td>Antibody mGAPDH</td>
			<td>Sigma</td>
			<td>G8795</td>
			<td></td>
		</tr>
		<tr>
			<td>Antibody Secondary Alexa conjugate</td>
			<td>Invitrogen</td>
			<td>A11034</td>
			<td>488 anti-rabbit</td>
		</tr>
		<tr>
			<td>Antibody Secondary HRP conjugate</td>
			<td>Jackson</td>
			<td>111/115-001-003</td>
			<td>rabbit/mouse&#160;</td>
		</tr>
		<tr>
			<td>Topro-3</td>
			<td>Invitrogen</td>
			<td>T3605</td>
			<td></td>
		</tr>
		<tr>
			<td>HANKs balanced salt buffer</td>
			<td>Life Technologies</td>
			<td>14025092</td>
			<td></td>
		</tr>
		<tr>
			<td>RIPA lysis buffer</td>
			<td></td>
			<td></td>
			<td>50mM Tris-HCl pH 7.4 150mM NaCl 1% NP40 0.25% Na-deoxycholate</td>
		</tr>
		<tr>
			<td>PCR Primers</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>primer TBP 3&#39;</td>
			<td></td>
			<td></td>
			<td>GGAATTGTACCGCAGCTTCAAA</td>
		</tr>
		<tr>
			<td>primer TBP 5&#39;</td>
			<td></td>
			<td></td>
			<td>GATGACTGCAGCAAATCGCTT</td>
		</tr>
		<tr>
			<td>primer KLF4 3&#39;</td>
			<td></td>
			<td></td>
			<td>TGTGACTATGCAGGCTGTGGCAAA</td>
		</tr>
		<tr>
			<td>primer KLF4 5&#39;</td>
			<td></td>
			<td></td>
			<td>ACAGTGGTAAGGTTTCTCGCCTGT</td>
		</tr>
	</tbody>
</table>

cryosectioning method for microdissection of murine colonic mucosa

The colonic mucosal tissue provides a vital barrier to luminal antigens. This barrier is composed of a monolayer of simple columnar epithelial cells. The colonic epithelium is dynamically turned over and epithelial cells are generated in the stem cell containing crypts of Lieberk&#252;hn. Progenitor cells produced in the crypt-bases migrate toward the luminal surface, undergoing a process of cellular differentiation before being shed into the gut lumen. In order to study these processes at the molecular level, we have developed a simple method for the microdissection of two spatially distinct regions of the colonic mucosa; the proliferative crypt zone, and the differentiated surface epithelial cells. Our objective is to isolate specific crypt and surface epithelial cell populations from mouse colonic mucosa for the isolation of RNA and protein.

Secciones de tejido del colon se procesaron para la evaluación histológica y H &amp; E tinción 13. Una vista en sección transversal tradicional de la mucosa se ​​ve en la Figura 2A. Áreas basales contienen la muscular externa, compuesta principalmente de la capa muscular circular. Procediendo hacia el lumen, la muscularis mucosa es evidente adyacente a las células epiteliales de las criptas-base, células de transición están en el medio del tejido, y, finalmente, las poblaciones celulares superficie de la cara la luz intestinal. El método de seccionamiento en serie descrito aquí mantiene una orientación tal que la capa muscular longitudinal y circular se encuentran primero (Figura 2B), seguido por la muscularis mucosa (Figura 2C). Tenga en cuenta la aparición de células intersticiales no musculares en la parte superior izquierda de la imagen. Para el análisis de aguas abajo se describe a continuación, las secciones musculares se descartan. Las secciones siguientes contienen células epiteliales y del tejido intersticial (lámina propia), A partir de las células de las criptas-base (Figura 2D). Nótese la ausencia de un lumen central en la mayoría de las criptas, que aparecen más oscuro debido a los núcleos estrechamente empaquetados. Estas capas contienen el compartimento proliferativo. Las células transicionales parecen tan apretujada glándulas con lúmenes centrales prominentes (Figura 2E). Por último, las poblaciones de células de superficie tienen una estructura irregular, con zonas de la monocapa epitelial visto en face (Figura 2F). Serial secciones descritas anteriormente también pueden ser procesados ​​para el etiquetado de inmunofluorescencia y microscopía confocal (como se describe aquí 14). Figura 2G muestra criptas aislados fijos y permeabilized en el 100% de metanol y posteriormente teñidas para núcleos (azul) y la proteína de unión célula-célula zonula occludens 1 (ZO-1, verde). En la orientación de corte tradicional, células de la cripta y la superficie se puede ver simultáneamente (Figura 2G </strong&gt;). Tenga en cuenta que las ZO-1 líneas de mancha de la unión de la luz de la cripta del colon. Este revestimiento Z0-1 de la luz también se puede ver en muestras seriadas seccionadas de las poblaciones de células de transición, en el centro de las glándulas circulares (Figura 2G). Enhanced ZO-1 mancha se ve en las poblaciones de células de superficie (Figura 2I y J). Varios factores de diferenciación son conocidos por ser expresado de una manera espaciotemporal a lo largo del eje cripta-a-superficie. Esto incluye el factor de factor de transcripción Kruppel-like 4 (KLF4), que es conocido por ser enriquecido en poblaciones de células de superficie. El uso de métodos tradicionales de seccionamiento, KLF4 se encuentra en los núcleos de lumen que enfrentan las poblaciones de células de superficie (Figura 2K). Por lo tanto, especuló que KLF4 ARNm se expresa predominantemente en las poblaciones de células superficiales. Para probar esto, se recogieron y se agrupan en muestras superficiales, de transición, y la cripta a base de secciones en serie. Subsequently, el ARN se cosechó utilizando Trizol extracción estándar, con una purificación adicional por la columna RNeasy y tratamiento con ADNasa. ARN se recogió de 5 secciones consecutivas agrupados, que arrojó entre 5-10 g de ARN total por muestra. Estas muestras se sometieron entonces a la PCR en tiempo semi-cuantitativa real para ambos KLF4 y un gen de referencia, caja TATA proteína de unión 1 (TBP-1) (Figura 2L) 14. Como se muestra en la Figura 2L, después de la normalización a TBP-1, se encontraron células de la superficie para expresar hasta 8 veces el ARNm KLF4 que se expresa en células de las criptas. Del mismo modo, se encontraron niveles de proteína KLF4 para exhibir regulación espacial a lo largo del eje cripta-superficie. Las secciones seriadas se agruparon como se describe anteriormente y luego se incubaron en tampón de lisis durante 20 min a 4 ° C. Esto produjo entre 200 a 250 g de proteína por muestra. Las muestras se sometieron entonces el análisis por SDS-PAGE (Figura 2 M) 15. Como se muestra en la Figura 2 M, p KLF4niveles rotein son dramáticamente más alta en las poblaciones de células de la superficie. Los resultados anteriores demuestran la capacidad de este protocolo para aislar grandes cantidades de células epiteliales de las criptas de la superficie y de la mucosa del colon murino. <img alt="Figura 1" src="/files/ftp_upload/53112/53112fig1.jpg" /> Figura 1: (A) que muestra esquemática murino mucosa colónica y las capas musculares externas. Nuestro método tiene como objetivo recoger las células de la superficie y la cripta de base poblaciones celulares discretas por cryosectioning serie (10 m cada uno). Las capas musculares externas se descartan. Altura (B) Cripta varía a lo largo de la longitud del colon (distancia entre las criptas-base y la superficie capas). Los puntos de datos indican las mediciones de las criptas individuales y símbolos indican réplicas biológicas (n = 4). (C) segmentos de colon recogen, se bisecaron, y puestas en una placa de silicio de disección. (D) Un tejido segment aproximadamente 3 cm del ano se presiona entre dos hojas de afeitar y el congelado en hielo seco. (E) El tejido se monta en un bloque de octubre pre-nivelado. (F) criosecciones se retiran y se inspeccionó visualmente. <img alt="Figura 2" src="/files/ftp_upload/53112/53112fig2.jpg" /> Figura 2:. Los datos representativos (A) tejido colónico se tiñeron con hematoxilina-eosina en sección transversal que muestra la capa muscular circular (cm), la muscularis mucosa (mm), células de las criptas-base, las células de transición, y las células de la superficie. (B - C) capas musculares del colon. (D) células de las criptas-base. Nótese la ausencia de un lumen central. (E) Las células de transición. (F) las células superficiales. Tinción (G) de inmunofluorescencia de las criptas del colon aisladas. ZO-1 (verde) y núcleos (azul) se observan en sección transversal. (HOLA) ZO-1 y la tinción nuclear en las células de transición y de superficie. (J) vista ampliada de ZO-1 tinción. (K) KLF4 (verde) se enriquece en las poblaciones de células de superficie. (L) La evaluación de PCR en tiempo real de los niveles de ARNm KLF4 entre los tres compartimentos. (M) Análisis de transferencia Western de los niveles de proteína KLF4 en estas poblaciones de células.

Watch this Scientific Journal Video about Cryosectioning Method for Microdissection of Murine Colonic Mucosa at JoVE.com

Cryosectioning Method for Microdissection of Murine Colonic Mucosa

Here we describe a simple method for the isolation of spatially distinct murine colonic epithelial surface cells from the underlying crypt-base cells.

Método cryosectioning para microdisección de murino mucosa colónica

The colonic mucosal tissue provides a vital barrier to luminal antigens. This barrier is composed of a monolayer of simple columnar epithelial cells. The ...

cryosectioning-method-for-microdissection-of-murine-colonic-mucosa

Research

JoVE Journal

Biology

17.2K vistas.  Emory University, Atlanta, Georgia. Here we describe a simple method for the isolation of spatially distinct murine colonic epithelial surface cells from the underlying crypt-base cells.

Video: Cryosectioning Method for Microdissection of Murine Colonic Mucosa

Flash Freezing and Cryosectioning E12.5 Mouse Brain

Demonstrated in this video are the techniques for flash freezing and sectioning embryonic brain tissue from mouse. Useful tips for using the cryostat are given, including troubleshooting methods that can be used while cutting to ensure that the resultant tissues sections are free of cracks and other distortions.

Flash de congelación y muestras criostáticas E12.5 cerebro de ratón

Investigación

Biología

Laser Capture Microdissection of Mammalian Tissue

Laser capture microscopy, also known as laser microdissection (LMD), enables the user to isolate small numbers of cells or tissues from frozen or formalin-fixed, paraffin-embedded tissue sections. LMD techniques rely on a thermo labile membrane placed either on top of, or underneath, the tissue section. In one method, focused laser energy is used to melt the membrane onto the underlying cells, which can then be lifted out of the tissue section. In the other, the laser energy vaporizes the foil along a path "drawn" on the tissue, allowing the selected cells to fall into a collection device. Each technique allows the selection of cells with a minimum resolution of several microns. DNA, RNA, protein, and lipid samples may be isolated and analyzed from micro-dissected samples. In this video, we demonstrate the use of the Leica AS-LMD laser microdissection instrument in seven segments, including an introduction to the principles of LMD, initializing the instrument for use, general considerations for sample preparation, mounting the specimen and setting up capture tubes, aligning the microscope, adjusting the capture controls, and capturing tissue specimens. Laser-capture micro-dissection enables the investigator to isolate samples of pure cell populations as small as a few cell-equivalents. This allows the analysis of cells of interest that are free of neighboring contaminants, which may confound experimental results.

Láser microdisección de captura de tejidos de mamíferos

Laser capture microscopy, also known as laser microdissection (LMD), enables the user to isolate small numbers of cells or tissues from frozen or ...

Microdissection of Zebrafish Embryonic Eye Tissues

Zebrafish is a popular animal model for research on eye development because of its rapid ex utero development and good fecundity. By 3 days post fertilization (dpf), the larvae will show the first visual response. Many genes have been identified to control a proper eye development, but we are far from a complete understanding of the underlying genetic architecture. Whole genome gene expression profiling is a useful tool to elucidate genetic regulatory network for eye development. However, the small size of the embryonic eye in zebrafish makes it challenging to obtain intact and pure eye tissues for expression analysis. For example, the anterior-posterior length of the eye between day 2 and 3 is only approximately 200-300 &mu;m, while the diameter of the lens is less 100 &mu;m. Also, the retinal pigment epithelium (RPE) underlying the retina is just a single-layer epithelium. While gene expression profiles can be obtained from the whole embryo, they do not accurately represent the expression of these tissues. Therefore pure tissue must be obtained for a successful gene expression profiling of eye development. To address this issue, we have developed an approach to microdissect intact retina and retina with RPE attached from 1-3 dpf, which cover major stages of eye morphogenesis. All procedures can be done with fine forceps and general laboratory supplies under standard stereomicroscopes. For retinal dissection, the single-layer RPE is removed and peeled off by brushing action and the preferential adherence of the RPE remnants to the surface of the culture plate for dissection. For RPE-attached retinal dissection, the adherence of RPE to the dissection plate is removed before the dissection so that the RPE can be completely preserved with the retina. A careful lifting action of this tissue can efficiently separate the presumptive choroid and sclera. The lens can be removed in both cases by a chemically etched tungsten needle. In short, our approach can obtain intact eye tissues and has been successfully utilized to study tissue-specific expression profiles of zebrafish retina1, 2 and retinal pigment epithelium3.

This article describes an approach to microdissect zebrafish retinas with and without retinal pigment epithelium attached, from one to three days postfertilization embryos.

Microdisección de los tejidos del ojo de pez cebra embrionarias

Zebrafish is a popular animal model for research on eye development because of its rapid ex utero development and good fecundity. By 3 days post ...

Microdissection of Black Widow Spider Silk-producing Glands

Modern spiders spin high-performance silk fibers with a broad range of biological functions, including locomotion, prey capture and protection of developing offspring 1,2. Spiders accomplish these tasks by spinning several distinct fiber types that have diverse mechanical properties. Such specialization of fiber types has occurred through the evolution of different silk-producing glands, which function as small biofactories. These biofactories manufacture and store large quantities of silk proteins for fiber production. Through a complex series of biochemical events, these silk proteins are converted from a liquid into a solid material upon extrusion.
Mechanical studies have demonstrated that spider silks are stronger than high-tensile steel 3. Analyses to understand the relationship between the structure and function of spider silk threads have revealed that spider silk consists largely of proteins, or fibroins, that have block repeats within their protein sequences 4. Common molecular signatures that contribute to the incredible tensile strength and extensibility of spider silks are being unraveled through the analyses of translated silk cDNAs. Given the extraordinary material properties of spider silks, research labs across the globe are racing to understand and mimic the spinning process to produce synthetic silk fibers for commercial, military and industrial applications. One of the main challenges to spinning artificial spider silk in the research lab involves a complete understanding of the biochemical processes that occur during extrusion of the fibers from the silk-producing glands.
Here we present a method for the isolation of the seven different silk-producing glands from the cobweaving black widow spider, which includes the major and minor ampullate glands [manufactures dragline and scaffolding silk] 5,6, tubuliform [synthesizes egg case silk] 7,8, flagelliform [unknown function in cob-weavers], aggregate [makes glue silk], aciniform [synthesizes prey wrapping and egg case threads] 9 and pyriform [produces attachment disc silk] 10. This approach is based upon anesthetizing the spider with carbon dioxide gas, subsequent separation of the cephalothorax from the abdomen, and microdissection of the abdomen to obtain the silk-producing glands. Following the separation of the different silk-producing glands, these tissues can be used to retrieve different macromolecules for distinct biochemical analyses, including quantitative real-time PCR, northern- and western blotting, mass spectrometry (MS or MS/MS) analyses to identify new silk protein sequences, search for proteins that participate in the silk assembly pathway, or use the intact tissue for cell culture or histological experiments.

Here we describe an efficient strategy to remove the silk-producing glands from the abdomen of female black widow spiders. This procedure allows the rapid isolation of the seven distinct silk-producing glands in a highly purified fashion, an important process for investigators studying spider silk production and fiber assembly.

Microdisección de Negro Araña Viuda producción de las glándulas de seda

Modern spiders spin high-performance silk fibers with a broad range of biological functions, including locomotion, prey capture and protection of ...

A Novel Method for the Culture and Polarized Stimulation of Human Intestinal Mucosa Explants

Few models currently exist to realistically simulate the complex human intestine's micro-environment, where a variety of interactions take place. Proper homeostasis directly depends on these interactions, as they shape an entire immunological response inducing tolerance against food antigens while at the same time mounting effective immune responses against pathogenic microbes accidentally ingested with food.
Intestinal homeostasis is preserved also through various complex interactions between the microbiota (including food-associated beneficial bacterial strains) and the host, that regulate the attachment/degradation of mucus, the production of antimicrobial peptides by the epithelial barrier, and the "education" of epithelial cells' that controls the tolerogenic or immunogenic phenotype of unique, gut-resident lymphoid cells' populations. These interactions have been so far very difficult to reproduce with in vitro assays using either cultured cell lines or peripheral blood mononuclear cells. In addition, mouse models differ substantially in components of the intestinal mucosa (mucus layer organization, commensal bacteria community) with respect to the human gut. Thus, studies of a variety of treatments to be brought in the clinics for important stress-related or pathological conditions such as irritable bowel syndrome, inflammatory bowel disease or colorectal cancer have been difficult to carry out.
To address these issues, we developed a novel system that enables us to stimulate explants of human intestinal mucosa that retain their in situ conditioning by the host microbiota and immune response, in a polarized fashion. Polarized apical stimulation is of great importance for the outcome of the elicited immune response. It has been repeatedly shown that the same stimuli can produce completely different responses when they bypass the apical face of the intestinal epithelium, stimulating epithelial cells basolaterally or coming into direct contact with lamina propria components, switching the phenotype from tolerogenic to immunogenic and causing unnecessary and excessive inflammation in the area.
We achieved polarized stimulation by gluing a cave cylinder which delimited the area of stimulation on the apical face of the mucosa as will be described in the protocol. We used this model to examine, among others, differential effects of three different Lactobacilli strains. We show that this model system is very powerful to assess the immunomodulatory properties of probiotics in healthy and disease conditions.

We introduce a novel method for the maintenance of human intestinal mucosa in culture and monitoring of the response to various types of stimuli over at least 24 hrs. With our method, the polarity of the tissue is maintained, allowing for a physiological stimulation via the apical route.

Un nuevo método para la Cultura y polarizado estimulación de explantes mucosa intestinal humana

Few models currently exist to realistically simulate the complex human intestine's micro-environment, where a variety of interactions take place. Proper ...

Cryosectioning Yeast Communities for Examining Fluorescence Patterns

Microbes typically live in communities. The spatial organization of cells within a community is believed to impact the survival and function of the community1. Optical sectioning techniques, including confocal and two-photon microscopy, have proven useful for observing spatial organization of bacterial and archaeal communities2,3. A combination of confocal imaging and physical sectioning of yeast colonies has revealed internal organization of cells4. However, direct optical sectioning using confocal or two-photon microscopy has been only able to reach a few cell layers deep into yeast colonies. This limitation is likely because of strong scattering of light from yeast cells4.
Here, we present a method based on fixing and cryosectioning to obtain spatial distribution of fluorescent cells within Saccharomyces cerevisiae communities. We use methanol as the fixative agent to preserve the spatial distribution of cells. Fixed communities are infiltrated with OCT compound, frozen, and cryosectioned in a cryostat. Fluorescence imaging of the sections reveals the internal organization of fluorescent cells within the community.
Examples of yeast communities consisting of strains expressing red and green fluorescent proteins demonstrate the potentials of the cryosectioning method to reveal the spatial distribution of fluorescent cells as well as that of gene expression within yeast colonies2,3. Even though our focus has been on Saccharomyces cerevisiae communities, the same method can potentially be applied to examine other microbial communities.

We present a protocol for freezing and cryosectioning yeast communities to observe internal patterns of fluorescent cells. The method relies on methanol-fixing and OCT-embedding to preserve the spatial distribution of cells without inactivating fluorescent proteins within a community.

Cryosectioning Comunidades levadura para examinar los patrones de fluorescencia

Microbes typically live  in communities. The spatial organization  of cells within a community is believed to impact the survival and function of the  ...

Laser-assisted Microdissection (LAM) as a Tool for Transcriptional Profiling of Individual Cell Types

The understanding of developmental processes at the molecular level requires insights into transcriptional regulation, and thus the transcriptome, at the level of individual cell types. While the methods described here are generally applicable to a wide range of species and cell types, our research focuses on plant reproduction. Plant cultivation and seed production is of crucial importance for human and animal nutrition. A detailed understanding of the regulatory networks that govern the formation of the reproductive lineage (germline) and ultimately of seeds is a precondition for the targeted manipulation of plant reproduction. In particular, the engineering of apomixis (asexual reproduction through seeds) into crop plants promises great improvements, as it leads to the formation of clonal seeds that are genetically identical to the mother plant. Consequently, the cell types of the female germline are of major importance for the understanding and engineering of apomixis. However, as the corresponding cells are deeply embedded within the floral tissues, they are very difficult to access for experimental analyses, including cell-type specific transcriptomics. To overcome this limitation, sections of individual cells can be isolated by laser-assisted microdissection (LAM). While LAM in combination with transcriptional profiling allows the identification of genes and pathways active in any cell type with high specificity, establishing a suitable protocol can be challenging. Specifically, the quality of RNA obtained after LAM can be compromised, especially when small, single cells are targeted. To circumvent this problem, we have established a workflow for LAM that reproducibly results in high RNA quality that is well suitable for transcriptomics, as exemplified here by the isolation of cells of the female germline in apomictic Boechera. In this protocol, procedures are described for tissue preparation and LAM, also with regard to RNA extraction and quality control.

Laser-assisted Microdissection LAM as a Tool for Transcriptional Profiling of Individual Cell Types

Here we present a protocol for laser-assisted microdissection of specific plant cell types for transcriptional profiling. While the protocol is suitable for different species and cell types, the focus is on highly inaccessible cells of the female germline important for sexual and apomictic reproduction in the crucifer genus Boechera.

Asistida por láser microdisección (LAM) como herramienta para la transcripción de perfiles de distintos tipos de células

The understanding of developmental processes at the molecular level requires insights into transcriptional regulation, and thus the transcriptome, at the ...

Cryosectioning of Contiguous Regions of a Single Mouse Skeletal Muscle for Gene Expression and Histological Analyses

With this method, consecutive cryosections are collected to enable both microscopy applications for tissue histology and enrichment of RNA for gene expression using adjacent regions from a single mouse skeletal muscle. Typically, it is challenging to achieve adequate homogenization of small skeletal muscle samples because buffer volumes may be too low for efficient grinding applications, yet without sufficient mechanical disruption, the dense tissue architecture of muscle limits penetration of buffer reagents, ultimately causing low RNA yield. By following the protocol reported here, 30 &#956;m sections are collected and pooled allowing cryosectioning and subsequent needle homogenization to mechanically disrupt the muscle, increasing the surface area exposed for buffer penetration. The primary limitations of the technique are that it requires a cryostat, and it is relatively low throughput. However, high-quality RNA can be obtained from small samples of pooled muscle cryosections, making this method accessible for many different skeletal muscles and other tissues. Furthermore, this technique enables matched analyses (e.g., tissue histopathology and gene expression) from adjacent regions of a single skeletal muscle so that measurements can be directly compared across applications to reduce experimental uncertainty and to reduce replicative animal experiments necessary to source a small tissue for multiple applications.

Consecutive cryo-sections are collected to enable histological applications and enrichment of RNA for gene expression measurements using adjacent regions from a single mouse skeletal muscle. High-quality RNA is obtained from 20 - 30 mg of pooled cryosections and measurements are directly compared across applications.

Cryosectioning de regiones contiguas de un músculo esquelético solo ratón para la expresión de genes y análisis histológicos

With this method, consecutive cryosections are collected to enable both microscopy applications for tissue histology and enrichment of RNA for gene ...

A Morphometric and Cellular Analysis Method for the Murine Mandibular Condyle

The temporomandibular joint (TMJ) has the capacity to adapt to external stimuli, and loading changes can affect the position of condyles, as well as the structural and cellular components of the mandibular condylar cartilage (MCC). This manuscript describes methods for analyzing these changes and a method for altering the loading of the TMJ in mice (i.e., compressive static TMJ loading). The structural evaluation illustrated here is a simple morphometric approach that uses the Digimizer software and is performed in radiographs of small bones. In addition, the analysis of cellular changes leading to alterations in collagen expression, bone remodeling, cell division, and proteoglycan distribution in the MCC is described. The quantification of these changes in histological sections - by counting the positive fluorescent pixels using image software and measuring the distance mapping and stained area with Digimizer - is also demonstrated. The methods shown here are not limited to the murine TMJ, but could be used on additional bones of small experimental animals and in other regions of endochondral ossification.

This manuscript presents methods for analyzing morphometric and cellular changes within the mandibular condyle of rodents.

Un método de análisis celular para el cóndilo Mandibular murino y morfométricos

The temporomandibular joint (TMJ) has the capacity to adapt to external stimuli, and loading changes can affect the position of condyles, as well as the ...

Laser Capture Microdissection of Highly Pure Trabecular Meshwork from Mouse Eyes for Gene Expression Analysis

Laser capture microdissection (LCM) has allowed gene expression analysis of single cells and enriched cell populations in tissue sections. LCM is a great tool for the study of the molecular mechanisms underlying cell differentiation and the development and progression of various diseases, including glaucoma. Glaucoma, which comprises a family of progressive optic neuropathies, is the most common cause of irreversible blindness worldwide. Structural changes and damage within the trabecular meshwork (TM) can result in increased intraocular pressure (IOP), which is a major risk factor for developing glaucoma. However, the precise molecular mechanisms involved are still poorly understood. The ability to perform gene expression analysis will be crucial in obtaining further insights into the function of these cells and its role in the regulation of IOP and glaucoma development. To achieve this, a reproducible method for isolating highly enriched TM from frozen sections of mouse eyes and a method for downstream gene expression analysis, such as RT-qPCR and RNA-Seq is needed. The method described herein is developed to isolate highly pure TM from mouse eyes for downstream digital PCR and microarray analysis. In addition, this technique can be easily adapted for the isolation of other highly enriched ocular cells and cell compartments that have been difficult to isolate from mouse eyes. The combination of LCM and RNA analysis can contribute to a more comprehensive understanding of the cellular events underlying glaucoma.

Here, we describe a protocol for a reproducible laser capture microdissection (LCM) for isolating trabecular meshwork (TM) for downstream RNA analysis. The ability to analyze changes in gene expression in the TM will help in understanding the underlying molecular mechanisms of TM-related ocular diseases.

Microdissection de la captura del laser de la malla Trabecular muy pura de ojos de ratón para análisis de expresión génica

Laser capture microdissection (LCM) has allowed gene expression analysis of single cells and enriched cell populations in tissue sections. LCM is a great ...