Name: cryosectioning method for microdissection of murine colonic mucosa
Uploaded: 2015-07-12T13:00:00
Duration: 6 min 16 s
Description: Watch this Scientific Journal Video about Cryosectioning Method for Microdissection of Murine Colonic Mucosa at JoVE.com

Supported by National Institutes of Health (DK55679, and DK59888 to A.N.). Emory University&#160;Integrated Cellular Imaging Microscopy Core of the Winship Cancer&#160;Institute comprehensive cancer center grant, P30CA138292, and the Crohn's and Colitis Foundation of America Career Development award to C.T.C. and Fellowship Award to A.E.F.

Experiments used C57BL/6 mice between 10 and 12 weeks of age. All procedures using animals were reviewed and approved by the Emory University Institutional Animal Care and Use Committee and were performed according to National Institutes of Health criteria.
1. Experimental Setup
<ol>
	<li>Set Up the Cryostat
	<ol>
		<li>Equilibrate cryostat to -20 &#176;C, including the microtome blade and chucks (exercise extreme caution around the blade!).</li>
		<li>Fill an empty cryomold with OCT (Optimal Cutting Temperature compound) and equilibrate to -20 &#176;C (~30 min). Remove the frozen OCT from the mold and fix it on the chuck with liquid OCT. Place the block/chuck in the microtome arm and allow the OCT to set for 10 min.</li>
		<li>Set the cryostat to 10 &#181;m per section and shave the OCT block until it is flat. Back the microtome arm away from the blade by several centimeters. At this point do not adjust the blade or chuck for the remainder of the experiment.</li>
	</ol>
	</li>
	<li>Prepare the razor blades: Prepare 2 razor blades per sample. Using a metal file, dull the sharped edge of blades. Next, remove the aluminum flange with forceps.</li>
	<li>Pre-chill a Pyrex dish or other flat surface on dry ice.</li>
	<li>Prepare a dissection dish with 10-15 dissection pins. A 10 cm tissue culture dish 50% filled with silicon will suffice. Add 5 ml of Hanks buffer at RT.</li>
</ol>
2. Dissection of Distal Colonic Tissue
<ol>
	<li>Place mice in a sealed chamber and euthanize mice by isoflurane inhalation and cervical dislocation, then spray 70% ethanol onto the abdomen and thorax12.</li>
	<li>Make a small incision in skin of the abdomen with scissors and then make an incision to expose the peritoneal cavity. Similar procedures can be found described here12.</li>
	<li>Cut the large intestine at the anal verge and tease apart the mesentery until the colon is free.</li>
	<li>Excise a distal colon segment between 0 and 6 cm from the anus. Here, the crypt depth is ~150 &#181;m (see Figure 1B). Cut open the colon longitudinally using scissors and remove the fecal contents.</li>
	<li>Pin the tissue to the dissection dish with the mucosal surface facing up. Stretch the tissue using dissection pins on a silicon dish in Hanks buffer and let rest for 10 min at RT (Figure 1C). This removes folds from the tissue and allows the muscle layers to relax.</li>
</ol>
3. Mount Tissue on the Cryostat for Sectioning
<ol>
	<li>Slide a razor blade under the desired section of tissue and then pour off the Hanks buffer. Add another razor blade to the top, making a sandwich. Cut the tissue segment and remove the pins. Transfer the razor blade/tissue sandwich to dry ice. Allow the tissue to freeze (5-10 min, Figure 1D).</li>
	<li>Pick up the razor/tissue sandwich and allow it to warm slightly by placing a finger on the top blade (mucosal side up. This orients the tissue so that the basal muscle layers are sectioned first.). Separate the sandwich and cut around the edges of the tissue segment. Cut a tissue segment approximately, 0.5 cm x 1 cm. Edge areas have a tendency to curl, causing the serial sections to contain many tissue layers. Note that over-cutting is better than under-cutting, so err on the side of caution.</li>
	<li>Allow the tissue to warm until the ice on top of the tissue begins to melt. At this point quickly and carefully press the tissue into the OCT block in the cryostat.</li>
	<li>Remove the blade by placing a finger over the sample. The heat transfer will allow you to remove the blade without disrupting the tissue.</li>
	<li>Coat the tissue with OCT and equilibrate for 5 min. Cut sections at 10 &#181;m (Figure 1E, F). Visually inspect the sections until the crypts are seen. Place sections in a 1.5 ml tubes or on slides.</li>
	<li>For analysis of mRNA or protein, place the samples in tubes with 5 crypt-base, 5 transitional, and 5 surface sections per tube. For RNA collection add 1 ml commercial isolation reagent and incubate at RT for 10 min. Perform RNA purification according to manufacturer&#8217;s instructions. Use 5-10 &#181;g of total RNA for cDNA generation.</li>
	<li>For protein purification, add 0.5 ml of cold RIPA lysis buffer (plus protease inhibitors) per 5 sections. Sonicate 3 times at a 70% cycle, on ice.
	<ol>
		<li>Add samples to SDS PAGE loading buffer (Laemmli buffer) and incubate at 100 &#176;C for 10 min. Subject samples to SDS PAGE and transfer, then block in 5% milk/PBS for 2 hr. Perform western blot analysis followed by incubation with KLF4 antibodies (1:500) O/N at 4 &#176;C.</li>
	</ol>
	</li>
</ol>

<ol>
	<li>Noah, T. K., Donahue, B., Shroyer, N. F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Intestinal+development+and+differentiation.">Intestinal development and differentiation.</a> Exp Cell Res. 317, 2702-2710 (2011).</li><li>Humphries, A., Wright, N. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Colonic+crypt+organization+and+tumorigenesis.">Colonic crypt organization and tumorigenesis.</a> Nat Rev Cancer. 8, 415-424 (2008).</li><li>Weber, C. R., Turner, J. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Inflammatory+bowel+disease:+is+it+really+just+another+break+in+the+wall.">Inflammatory bowel disease: is it really just another break in the wall.</a> Gut. 56, 6-8 (2007).</li><li>Bjerknes, M., Cheng, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Methods+for+the+isolation+of+intact+epithelium+from+the+mouse+intestine.">Methods for the isolation of intact epithelium from the mouse intestine.</a> Anat Rec. 199, 565-574 (1981).</li><li>Sato, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Single+Lgr5+stem+cells+build+crypt-villus+structures+in+vitro+without+a+mesenchymal+niche.">Single Lgr5 stem cells build crypt-villus structures in vitro without a mesenchymal niche.</a> Nature. 459, 262-265 (2009).</li><li>Rand, M. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Calcium+depletion+dissociates+and+activates+heterodimeric+notch+receptors.">Calcium depletion dissociates and activates heterodimeric notch receptors.</a> Mol Cell Biol. 20, 1825-1835 (2000).</li><li>Gjorevski, N., Boghaert, E., Nelson, C. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Regulation+of+Epithelial-Mesenchymal+Transition+by+Transmission+of+Mechanical+Stress+through+Epithelial+Tissues.">Regulation of Epithelial-Mesenchymal Transition by Transmission of Mechanical Stress through Epithelial Tissues.</a> Cancer Microenviron. 5, 29-38 (2012).</li><li>Lechner, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Gene+expression+pattern+of+laser+microdissected+colonic+crypts+of+adenomas+with+low+grade+dysplasia.">Gene expression pattern of laser microdissected colonic crypts of adenomas with low grade dysplasia.</a> Gut. 52, 1148-1153 (2003).</li><li>Reizel, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Colon+stem+cell+and+crypt+dynamics+exposed+by+cell+lineage+reconstruction.">Colon stem cell and crypt dynamics exposed by cell lineage reconstruction.</a> PLoS Genet. 7, e1002192 (2011).</li><li>Kosinski, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Gene+expression+patterns+of+human+colon+tops+and+basal+crypts+and+BMP+antagonists+as+intestinal+stem+cell+niche+factors.">Gene expression patterns of human colon tops and basal crypts and BMP antagonists as intestinal stem cell niche factors.</a> Proc Natl Acad Sci U S A. 104, 15418-15423 (2007).</li><li>Tamura, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Pit+pattern+and+three-dimensional+configuration+of+isolated+crypts+from+the+patients+with+colorectal+neoplasm.">Pit pattern and three-dimensional configuration of isolated crypts from the patients with colorectal neoplasm.</a> J Gastroenterol. 37, 798-806 (2002).</li><li>Geem, D., Medina-Contreras, O., Kim, W., Huang, C. S., Denning, T. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Isolation+and+characterization+of+dendritic+cells+and+macrophages+from+the+mouse+intestine.">Isolation and characterization of dendritic cells and macrophages from the mouse intestine.</a> Journal of visualized experiments : JoVE. , e4040 (2012).</li><li>Laukoetter, M. G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=JAM-A+regulates+permeability+and+inflammation+in+the+intestine+in+vivo.">JAM-A regulates permeability and inflammation in the intestine in vivo.</a> J Exp Med. 204, 3067-3076 (2007).</li><li>Neumann, P. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Gut+commensal+bacteria+and+regional+Wnt+gene+expression+in+the+proximal+versus+distal+colon.">Gut commensal bacteria and regional Wnt gene expression in the proximal versus distal colon.</a> Am J Pathol. 184, 592-599 (2014).</li><li>Capaldo, C. T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Proinflammatory+cytokine-induced+tight+junction+remodeling+through+dynamic+self-assembly+of+claudins.">Proinflammatory cytokine-induced tight junction remodeling through dynamic self-assembly of claudins.</a> Mol Biol Cell. 25, 2710-2719 (2014).</li><li>Wells, J. M., Spence, J. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=How+to+make+an+intestine.">How to make an intestine.</a> Development. 141, 752-760 (2014).</li></ol>

The authors have nothing to disclose

The molecular mechanisms involved in colonic epithelial cell proliferation and differentiation are poorly understood. This includes gaps in our understanding of the cellular signaling environment of the stem cell compartment at the base of the colonic epithelial crypts. There is also an increasing interest in the processes that underlie enterocyte differentiation. For example, increased understanding of in vivo differentiation is required as a benchmark for studies aimed at producing in vitro primary intestinal systems16.
The above procedure contains several steps that require extra attention. Firstly, removing the edges around the frozen tissue segment (as discussed in section 3.2) is required as the tissue edges curl during dissection and freezing. Failure to move these edges results is a mixed population of surface and crypt base cells. Mounting the tissue on a pre-chilled, leveled OCT block is also essential. This protocol can be adapted to other areas of the distal colon by altering the number of sections in each pool. For example, as shown in Figure 1B, mucosal crypt length varies between 150-300 &#956;m. Therefore, when studying the region between 4 cm-6 cm from the anus, the number of sections should be increased from 15 to 30. Importantly, this protocol is not suggested for the proximal colon (7 cm-9 cm) due to folds (plicae obliquae) which extend into the lumen making it impossible to separate surface and crypt-base cells by serial sectioning.
Serial sectioning techniques have been used to study crypt-base and surface epithelial cell populations in humans. However, our protocol adds additional steps that are required due to the small size of murine tissue. We propose that the above protocol will allow for the investigation of crypt-base and surface epithelial cell population in genetically tractable mouse systems. Indeed, pooled sections yield high quality protein and RNA suitable downstream analysis. Future applications could include the study of cell signaling pathways or chromatin immunoprecipitation. However, it should be noted that, like several of the alternative methods described above, the resulting sections contain a mixture of epithelial and interstitial lamina propria cells. In conclusion, the protocol described here provides a rapid, high yield method for the analysis of molecular processes in spatially distinct regions of the murine colonic mucosa.

The colonic epithelial lining is a highly regenerative tissue, with resident stem cells replenishing the tissue every few days1. This process of regeneration requires the maintenance of a proliferative stem cell compartment. Over time, the newly produced daughter cells lose their proliferative potential and migrate toward the luminal surface of the intestine. Coincident with migration, progenitor cells differentiate into mature barrier-forming enterocytes or mucous producing goblet cells. Failure of this differentiation program is thought to contribute to compromised epithelial barrier such as is observed in inflammatory bowel disease and colon cancer2,3.
Detailed study of the above processes will require methodologies for isolating crypt-base and surface cell populations. Multiple methods exist, each with unique advantages and drawbacks. Current methods for the isolation of intestinal epithelial cells include chelating agents and mechanical disassociation, resulting in the isolation of entire crypts, epithelial sheets, or single cells, dependent on experimental conditions4,5. These are high yield methods, yet changes in intercellular signaling have been reported under these conditions that may not represent the native environment6,7. Laser capture microdissection allows for the collection of spatial distinct material, but achieves low molecular yield8,9. In human colonic tissue, serial horizontal cryosectioning methods have been developed10. However, murine mucosal tissues are prohibitively small for direct appropriation of this technique. In humans, intestinal crypt lengths (the distant between the crypt-base and surface cells) in the colon varies between ~100&#8211;1,000 &#956;m 11. In mice, crypt lengths are between ~50&#8211;300 &#956;m (see Figure 1A). The small size of murine crypts presents a challenge to the isolation of these two cell populations using existing protocols.
We now describe a low cost, high yield method for the isolation of crypt-base and surface epithelial cell population in murine colonic tissue. Tissue harvested in this manner may then be analyzed by a number of standard downstream applications, including immunofluorescence staining, RT&#8211;PCR (Real Time&#8211;Polymerase Chain Reaction) or western blotting.

<table border="0" cellpadding="0" cellspacing="0">
	<tbody>
		<tr>
			<td>Microtome</td>
			<td>Leica Biosystems, Nussloch Germany</td>
			<td>CM 1510-3</td>
			<td></td>
		</tr>
		<tr>
			<td>MyiQ real time PCR detector</td>
			<td>BioRad</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>LSM 510&#160;</td>
			<td>Carl Zeiss</td>
			<td></td>
			<td>Confocal microscope</td>
		</tr>
		<tr>
			<td>Materials</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>OCT</td>
			<td>Tissue-Tek, Sakura Finetek, Torrance CA</td>
			<td>4583</td>
			<td></td>
		</tr>
		<tr>
			<td>cryo-mold</td>
			<td>Tissue-Tek, Sakura Finetek, Torrance CA</td>
			<td>4557</td>
			<td>25mmx20mmx5mm</td>
		</tr>
		<tr>
			<td>High profile microtome blade</td>
			<td>Leica Biosystems, Nussloch germany</td>
			<td>818</td>
			<td></td>
		</tr>
		<tr>
			<td>GEM industrial blades</td>
			<td>American Safety Razor Blades</td>
			<td>62-0314</td>
			<td></td>
		</tr>
		<tr>
			<td>Sylgard silicon elastomere base</td>
			<td>Dow Corning, Midland MI</td>
			<td>3097358</td>
			<td></td>
		</tr>
		<tr>
			<td>27 1/2 g needle</td>
			<td>Becton-Dickinson, Franklin Lakes, NJ</td>
			<td>305109</td>
			<td>pins for dissection</td>
		</tr>
		<tr>
			<td>TRizol</td>
			<td>Life Technologies</td>
			<td>15596018</td>
			<td></td>
		</tr>
		<tr>
			<td>Rneasy</td>
			<td>Qiagen</td>
			<td>74104</td>
			<td></td>
		</tr>
		<tr>
			<td>DNAse</td>
			<td>Qiagen</td>
			<td>79254</td>
			<td></td>
		</tr>
		<tr>
			<td>Reagents</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Antibody ZO-1</td>
			<td>Invitrogen&#160;</td>
			<td>187430</td>
			<td></td>
		</tr>
		<tr>
			<td>Antibody KLF4</td>
			<td>Cell Signaling</td>
			<td>4038S</td>
			<td></td>
		</tr>
		<tr>
			<td>Antibody mGAPDH</td>
			<td>Sigma</td>
			<td>G8795</td>
			<td></td>
		</tr>
		<tr>
			<td>Antibody Secondary Alexa conjugate</td>
			<td>Invitrogen</td>
			<td>A11034</td>
			<td>488 anti-rabbit</td>
		</tr>
		<tr>
			<td>Antibody Secondary HRP conjugate</td>
			<td>Jackson</td>
			<td>111/115-001-003</td>
			<td>rabbit/mouse&#160;</td>
		</tr>
		<tr>
			<td>Topro-3</td>
			<td>Invitrogen</td>
			<td>T3605</td>
			<td></td>
		</tr>
		<tr>
			<td>HANKs balanced salt buffer</td>
			<td>Life Technologies</td>
			<td>14025092</td>
			<td></td>
		</tr>
		<tr>
			<td>RIPA lysis buffer</td>
			<td></td>
			<td></td>
			<td>50mM Tris-HCl pH 7.4 150mM NaCl 1% NP40 0.25% Na-deoxycholate</td>
		</tr>
		<tr>
			<td>PCR Primers</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>primer TBP 3&#39;</td>
			<td></td>
			<td></td>
			<td>GGAATTGTACCGCAGCTTCAAA</td>
		</tr>
		<tr>
			<td>primer TBP 5&#39;</td>
			<td></td>
			<td></td>
			<td>GATGACTGCAGCAAATCGCTT</td>
		</tr>
		<tr>
			<td>primer KLF4 3&#39;</td>
			<td></td>
			<td></td>
			<td>TGTGACTATGCAGGCTGTGGCAAA</td>
		</tr>
		<tr>
			<td>primer KLF4 5&#39;</td>
			<td></td>
			<td></td>
			<td>ACAGTGGTAAGGTTTCTCGCCTGT</td>
		</tr>
	</tbody>
</table>

cryosectioning method for microdissection of murine colonic mucosa

The colonic mucosal tissue provides a vital barrier to luminal antigens. This barrier is composed of a monolayer of simple columnar epithelial cells. The colonic epithelium is dynamically turned over and epithelial cells are generated in the stem cell containing crypts of Lieberk&#252;hn. Progenitor cells produced in the crypt-bases migrate toward the luminal surface, undergoing a process of cellular differentiation before being shed into the gut lumen. In order to study these processes at the molecular level, we have developed a simple method for the microdissection of two spatially distinct regions of the colonic mucosa; the proliferative crypt zone, and the differentiated surface epithelial cells. Our objective is to isolate specific crypt and surface epithelial cell populations from mouse colonic mucosa for the isolation of RNA and protein.

Colonic tissue sections were processed for histological assessment and H&#38;E staining13. A traditional cross-section view of the mucosa is seen in Figure 2A. Basal areas contain the muscularis externa, composed mainly of the circular muscularis. Proceeding toward the lumen, the muscularis mucosa is evident adjacent to the crypt-base epithelial cells, transitional cells are in the middle of the tissue, and finally, surface cell populations face the gut lumen. The serial sectioning method described here maintains an orientation such that the longitudinal and circular muscularis are encountered first (Figure 2B), followed by the muscularis mucosa (Figure 2C). Note the appearance of non-muscle interstitial cells in the top left of the image. For the downstream analysis described below, muscle sections are discarded. The subsequent sections contain epithelial cells and interstitial tissue (lamina propria), starting with the crypt-base cells (Figure 2D). Note the absence of a central lumen in most of the crypts, which appear darker due to the closely packed nuclei. These layers contain the proliferative compartment. The transitional cells appear as tightly packed glands with prominent central lumens (Figure 2E). Lastly, surface cell populations have an irregular structure, with areas of the epithelial monolayer viewed en face (Figure 2F).
Serial sections as described above may also be processed for immunofluorescence labeling and confocal microscopy (as described here14). Figure 2G shows isolated crypts fixed and permeabilized in 100% methanol and subsequently stained for nuclei (blue) and the cell-cell junction protein Zonula Occludens 1 (ZO-1, green). In the traditional sectioning orientation, crypt and surface cell can be viewed simultaneously (Figure 2G). Note that the ZO-1 junctional stain lines the lumen of the colonic crypt. This Z0-1 lining of the lumen can also be seen in serial sectioned samples of transitional cell populations, in the center of the circular glands (Figure 2G). Enhanced ZO-1 stain is seen in surface cell populations (Figure 2I and J).
Several differentiation factors are known to be expressed in a spatiotemporal fashion along the crypt-to&#8211;surface axis. This includes the transcription factor Kruppel-like factor 4 (KLF4), which is known to be enriched in surface cell populations. Using traditional sectioning methods, KLF4 is found in the nuclei of lumen facing surface cell populations (Figure 2K). We therefore speculated that KLF4 mRNA would be predominantly expressed in surface cell populations. To test this, serial sections were collected and grouped into surface, transitional, and crypt-base samples. Subsequently, RNA was harvested using standard Trizol extraction, with an additional purification by RNeasy column and DNAse treatment. RNA was collected from 5 pooled consecutive sections, which yielded between 5-10 &#181;g of total RNA per sample. These samples were then subjected to semi-quantitative real time PCR for both KLF4 and a reference gene, TATA box binding protein 1 (TBP-1) (Figure 2L)14. As shown in Figure 2L, after normalization to TBP-1, surface cells were found to express up to 8 times the KLF4 mRNA that is expressed in crypt cells. Similarly, KLF4 protein levels were found to exhibit spatial regulation along the crypt-surface axis. Serial sections were pooled as described above and then incubated in lysis buffer for 20 min at 4 &#176;C. This yielded between 200-250 &#181;g of protein per sample. Samples were then subjected analysis by SDS-PAGE (Figure 2M)15. As shown in Figure 2M, KLF4 protein levels are dramatically higher in surface cell populations. The above findings demonstrate the ability of this protocol to isolate large amounts of surface and crypt epithelial cells from the murine colonic mucosa.
<img alt="Figure 1" src="/files/ftp_upload/53112/53112fig1.jpg" /> 
Figure 1: (A) Schematic showing murine colonic mucosa and external muscle layers. Our method aims to collect discrete surface cell and crypt-base cell populations by serial cryosectioning (10 &#956;m each). The external muscle layers are discarded. (B) Crypt height varies along the length of the colon (distance between crypt-base and surface layers). Data points indicate individual crypt measurements and symbols indicate biological replicates (n = 4). (C) Colon segments collected, bisected, and pinned onto a silicon dissecting dish. (D) A tissue segment approximately 3 cm from the anus is pressed between to razor blades and the frozen on dry ice. (E) Tissue is then mounted on a pre-leveled OCT block. (F) Cryosections are removed and visually inspected.
<img alt="Figure 2" src="/files/ftp_upload/53112/53112fig2.jpg" /> 
Figure 2: Representative data. (A) Colonic tissue stained with Hematoxylin-Eosin in cross-section showing the circular muscularis (c.m.), the muscularis mucosa (m.m.), crypt-base cells, transitional cells, and surface cells. (B-C) colonic muscle layers. (D) Crypt-base cells. Note the absence of a central lumen. (E) Transitional cells. (F) Surface cells. (G) Immunofluorescence staining of isolated colonic crypts. ZO-1 (green) and nuclei (blue) are observed in cross-section. (H-I) ZO-1 and nuclear staining in transitional and surface cells. (J) magnified view of ZO-1 staining. (K) KLF4 (green) is enriched in surface cell populations. (L) Real-time PCR assessment of KLF4 mRNA levels between the three compartments. (M) Western blot analysis of KLF4 protein levels in these cell populations.

Watch this Scientific Journal Video about Cryosectioning Method for Microdissection of Murine Colonic Mucosa at JoVE.com

Cryosectioning Method for Microdissection of Murine Colonic Mucosa

Here we describe a simple method for the isolation of spatially distinct murine colonic epithelial surface cells from the underlying crypt-base cells.

The colonic mucosal tissue provides a vital barrier to luminal antigens. This barrier is composed of a monolayer of simple columnar epithelial cells. The ...

cryosectioning-method-for-microdissection-of-murine-colonic-mucosa

Research

JoVE Journal

Biology

Flash Freezing and Cryosectioning E12.5 Mouse Brain

Demonstrated in this video are the techniques for flash freezing and sectioning embryonic brain tissue from mouse. Useful tips for using the cryostat are given, including troubleshooting methods that can be used while cutting to ensure that the resultant tissues sections are free of cracks and other distortions.

Laser Capture Microdissection of Mammalian Tissue

Laser capture microscopy, also known as laser microdissection (LMD), enables the user to isolate small numbers of cells or tissues from frozen or formalin-fixed, paraffin-embedded tissue sections. LMD techniques rely on a thermo labile membrane placed either on top of, or underneath, the tissue section. In one method, focused laser energy is used to melt the membrane onto the underlying cells, which can then be lifted out of the tissue section. In the other, the laser energy vaporizes the foil along a path "drawn" on the tissue, allowing the selected cells to fall into a collection device. Each technique allows the selection of cells with a minimum resolution of several microns. DNA, RNA, protein, and lipid samples may be isolated and analyzed from micro-dissected samples. In this video, we demonstrate the use of the Leica AS-LMD laser microdissection instrument in seven segments, including an introduction to the principles of LMD, initializing the instrument for use, general considerations for sample preparation, mounting the specimen and setting up capture tubes, aligning the microscope, adjusting the capture controls, and capturing tissue specimens. Laser-capture micro-dissection enables the investigator to isolate samples of pure cell populations as small as a few cell-equivalents. This allows the analysis of cells of interest that are free of neighboring contaminants, which may confound experimental results.

Laser capture microscopy, also known as laser microdissection (LMD), enables the user to isolate small numbers of cells or tissues from frozen or ...

Microdissection of Zebrafish Embryonic Eye Tissues

Zebrafish is a popular animal model for research on eye development because of its rapid ex utero development and good fecundity. By 3 days post fertilization (dpf), the larvae will show the first visual response. Many genes have been identified to control a proper eye development, but we are far from a complete understanding of the underlying genetic architecture. Whole genome gene expression profiling is a useful tool to elucidate genetic regulatory network for eye development. However, the small size of the embryonic eye in zebrafish makes it challenging to obtain intact and pure eye tissues for expression analysis. For example, the anterior-posterior length of the eye between day 2 and 3 is only approximately 200-300 &mu;m, while the diameter of the lens is less 100 &mu;m. Also, the retinal pigment epithelium (RPE) underlying the retina is just a single-layer epithelium. While gene expression profiles can be obtained from the whole embryo, they do not accurately represent the expression of these tissues. Therefore pure tissue must be obtained for a successful gene expression profiling of eye development. To address this issue, we have developed an approach to microdissect intact retina and retina with RPE attached from 1-3 dpf, which cover major stages of eye morphogenesis. All procedures can be done with fine forceps and general laboratory supplies under standard stereomicroscopes. For retinal dissection, the single-layer RPE is removed and peeled off by brushing action and the preferential adherence of the RPE remnants to the surface of the culture plate for dissection. For RPE-attached retinal dissection, the adherence of RPE to the dissection plate is removed before the dissection so that the RPE can be completely preserved with the retina. A careful lifting action of this tissue can efficiently separate the presumptive choroid and sclera. The lens can be removed in both cases by a chemically etched tungsten needle. In short, our approach can obtain intact eye tissues and has been successfully utilized to study tissue-specific expression profiles of zebrafish retina1, 2 and retinal pigment epithelium3.

This article describes an approach to microdissect zebrafish retinas with and without retinal pigment epithelium attached, from one to three days postfertilization embryos.

Zebrafish is a popular animal model for research on eye development because of its rapid ex utero development and good fecundity. By 3 days post ...

Microdissection of Black Widow Spider Silk-producing Glands

Modern spiders spin high-performance silk fibers with a broad range of biological functions, including locomotion, prey capture and protection of developing offspring 1,2. Spiders accomplish these tasks by spinning several distinct fiber types that have diverse mechanical properties. Such specialization of fiber types has occurred through the evolution of different silk-producing glands, which function as small biofactories. These biofactories manufacture and store large quantities of silk proteins for fiber production. Through a complex series of biochemical events, these silk proteins are converted from a liquid into a solid material upon extrusion.
Mechanical studies have demonstrated that spider silks are stronger than high-tensile steel 3. Analyses to understand the relationship between the structure and function of spider silk threads have revealed that spider silk consists largely of proteins, or fibroins, that have block repeats within their protein sequences 4. Common molecular signatures that contribute to the incredible tensile strength and extensibility of spider silks are being unraveled through the analyses of translated silk cDNAs. Given the extraordinary material properties of spider silks, research labs across the globe are racing to understand and mimic the spinning process to produce synthetic silk fibers for commercial, military and industrial applications. One of the main challenges to spinning artificial spider silk in the research lab involves a complete understanding of the biochemical processes that occur during extrusion of the fibers from the silk-producing glands.
Here we present a method for the isolation of the seven different silk-producing glands from the cobweaving black widow spider, which includes the major and minor ampullate glands [manufactures dragline and scaffolding silk] 5,6, tubuliform [synthesizes egg case silk] 7,8, flagelliform [unknown function in cob-weavers], aggregate [makes glue silk], aciniform [synthesizes prey wrapping and egg case threads] 9 and pyriform [produces attachment disc silk] 10. This approach is based upon anesthetizing the spider with carbon dioxide gas, subsequent separation of the cephalothorax from the abdomen, and microdissection of the abdomen to obtain the silk-producing glands. Following the separation of the different silk-producing glands, these tissues can be used to retrieve different macromolecules for distinct biochemical analyses, including quantitative real-time PCR, northern- and western blotting, mass spectrometry (MS or MS/MS) analyses to identify new silk protein sequences, search for proteins that participate in the silk assembly pathway, or use the intact tissue for cell culture or histological experiments.

Here we describe an efficient strategy to remove the silk-producing glands from the abdomen of female black widow spiders. This procedure allows the rapid isolation of the seven distinct silk-producing glands in a highly purified fashion, an important process for investigators studying spider silk production and fiber assembly.

Modern spiders spin high-performance silk fibers with a broad range of biological functions, including locomotion, prey capture and protection of ...

A Novel Method for the Culture and Polarized Stimulation of Human Intestinal Mucosa Explants

Few models currently exist to realistically simulate the complex human intestine's micro-environment, where a variety of interactions take place. Proper homeostasis directly depends on these interactions, as they shape an entire immunological response inducing tolerance against food antigens while at the same time mounting effective immune responses against pathogenic microbes accidentally ingested with food.
Intestinal homeostasis is preserved also through various complex interactions between the microbiota (including food-associated beneficial bacterial strains) and the host, that regulate the attachment/degradation of mucus, the production of antimicrobial peptides by the epithelial barrier, and the "education" of epithelial cells' that controls the tolerogenic or immunogenic phenotype of unique, gut-resident lymphoid cells' populations. These interactions have been so far very difficult to reproduce with in vitro assays using either cultured cell lines or peripheral blood mononuclear cells. In addition, mouse models differ substantially in components of the intestinal mucosa (mucus layer organization, commensal bacteria community) with respect to the human gut. Thus, studies of a variety of treatments to be brought in the clinics for important stress-related or pathological conditions such as irritable bowel syndrome, inflammatory bowel disease or colorectal cancer have been difficult to carry out.
To address these issues, we developed a novel system that enables us to stimulate explants of human intestinal mucosa that retain their in situ conditioning by the host microbiota and immune response, in a polarized fashion. Polarized apical stimulation is of great importance for the outcome of the elicited immune response. It has been repeatedly shown that the same stimuli can produce completely different responses when they bypass the apical face of the intestinal epithelium, stimulating epithelial cells basolaterally or coming into direct contact with lamina propria components, switching the phenotype from tolerogenic to immunogenic and causing unnecessary and excessive inflammation in the area.
We achieved polarized stimulation by gluing a cave cylinder which delimited the area of stimulation on the apical face of the mucosa as will be described in the protocol. We used this model to examine, among others, differential effects of three different Lactobacilli strains. We show that this model system is very powerful to assess the immunomodulatory properties of probiotics in healthy and disease conditions.

We introduce a novel method for the maintenance of human intestinal mucosa in culture and monitoring of the response to various types of stimuli over at least 24 hrs. With our method, the polarity of the tissue is maintained, allowing for a physiological stimulation via the apical route.

Few models currently exist to realistically simulate the complex human intestine's micro-environment, where a variety of interactions take place. Proper ...

Cryosectioning Yeast Communities for Examining Fluorescence Patterns

Microbes typically live in communities. The spatial organization of cells within a community is believed to impact the survival and function of the community1. Optical sectioning techniques, including confocal and two-photon microscopy, have proven useful for observing spatial organization of bacterial and archaeal communities2,3. A combination of confocal imaging and physical sectioning of yeast colonies has revealed internal organization of cells4. However, direct optical sectioning using confocal or two-photon microscopy has been only able to reach a few cell layers deep into yeast colonies. This limitation is likely because of strong scattering of light from yeast cells4.
Here, we present a method based on fixing and cryosectioning to obtain spatial distribution of fluorescent cells within Saccharomyces cerevisiae communities. We use methanol as the fixative agent to preserve the spatial distribution of cells. Fixed communities are infiltrated with OCT compound, frozen, and cryosectioned in a cryostat. Fluorescence imaging of the sections reveals the internal organization of fluorescent cells within the community.
Examples of yeast communities consisting of strains expressing red and green fluorescent proteins demonstrate the potentials of the cryosectioning method to reveal the spatial distribution of fluorescent cells as well as that of gene expression within yeast colonies2,3. Even though our focus has been on Saccharomyces cerevisiae communities, the same method can potentially be applied to examine other microbial communities.

We present a protocol for freezing and cryosectioning yeast communities to observe internal patterns of fluorescent cells. The method relies on methanol-fixing and OCT-embedding to preserve the spatial distribution of cells without inactivating fluorescent proteins within a community.

Microbes typically live  in communities. The spatial organization  of cells within a community is believed to impact the survival and function of the  ...

Laser-assisted Microdissection (LAM) as a Tool for Transcriptional Profiling of Individual Cell Types

The understanding of developmental processes at the molecular level requires insights into transcriptional regulation, and thus the transcriptome, at the level of individual cell types. While the methods described here are generally applicable to a wide range of species and cell types, our research focuses on plant reproduction. Plant cultivation and seed production is of crucial importance for human and animal nutrition. A detailed understanding of the regulatory networks that govern the formation of the reproductive lineage (germline) and ultimately of seeds is a precondition for the targeted manipulation of plant reproduction. In particular, the engineering of apomixis (asexual reproduction through seeds) into crop plants promises great improvements, as it leads to the formation of clonal seeds that are genetically identical to the mother plant. Consequently, the cell types of the female germline are of major importance for the understanding and engineering of apomixis. However, as the corresponding cells are deeply embedded within the floral tissues, they are very difficult to access for experimental analyses, including cell-type specific transcriptomics. To overcome this limitation, sections of individual cells can be isolated by laser-assisted microdissection (LAM). While LAM in combination with transcriptional profiling allows the identification of genes and pathways active in any cell type with high specificity, establishing a suitable protocol can be challenging. Specifically, the quality of RNA obtained after LAM can be compromised, especially when small, single cells are targeted. To circumvent this problem, we have established a workflow for LAM that reproducibly results in high RNA quality that is well suitable for transcriptomics, as exemplified here by the isolation of cells of the female germline in apomictic Boechera. In this protocol, procedures are described for tissue preparation and LAM, also with regard to RNA extraction and quality control.

Laser-assisted Microdissection LAM as a Tool for Transcriptional Profiling of Individual Cell Types

Here we present a protocol for laser-assisted microdissection of specific plant cell types for transcriptional profiling. While the protocol is suitable for different species and cell types, the focus is on highly inaccessible cells of the female germline important for sexual and apomictic reproduction in the crucifer genus Boechera.

The understanding of developmental processes at the molecular level requires insights into transcriptional regulation, and thus the transcriptome, at the ...

Cryosectioning of Contiguous Regions of a Single Mouse Skeletal Muscle for Gene Expression and Histological Analyses

With this method, consecutive cryosections are collected to enable both microscopy applications for tissue histology and enrichment of RNA for gene expression using adjacent regions from a single mouse skeletal muscle. Typically, it is challenging to achieve adequate homogenization of small skeletal muscle samples because buffer volumes may be too low for efficient grinding applications, yet without sufficient mechanical disruption, the dense tissue architecture of muscle limits penetration of buffer reagents, ultimately causing low RNA yield. By following the protocol reported here, 30 &#956;m sections are collected and pooled allowing cryosectioning and subsequent needle homogenization to mechanically disrupt the muscle, increasing the surface area exposed for buffer penetration. The primary limitations of the technique are that it requires a cryostat, and it is relatively low throughput. However, high-quality RNA can be obtained from small samples of pooled muscle cryosections, making this method accessible for many different skeletal muscles and other tissues. Furthermore, this technique enables matched analyses (e.g., tissue histopathology and gene expression) from adjacent regions of a single skeletal muscle so that measurements can be directly compared across applications to reduce experimental uncertainty and to reduce replicative animal experiments necessary to source a small tissue for multiple applications.

Consecutive cryo-sections are collected to enable histological applications and enrichment of RNA for gene expression measurements using adjacent regions from a single mouse skeletal muscle. High-quality RNA is obtained from 20 - 30 mg of pooled cryosections and measurements are directly compared across applications.

With this method, consecutive cryosections are collected to enable both microscopy applications for tissue histology and enrichment of RNA for gene ...

A Morphometric and Cellular Analysis Method for the Murine Mandibular Condyle

The temporomandibular joint (TMJ) has the capacity to adapt to external stimuli, and loading changes can affect the position of condyles, as well as the structural and cellular components of the mandibular condylar cartilage (MCC). This manuscript describes methods for analyzing these changes and a method for altering the loading of the TMJ in mice (i.e., compressive static TMJ loading). The structural evaluation illustrated here is a simple morphometric approach that uses the Digimizer software and is performed in radiographs of small bones. In addition, the analysis of cellular changes leading to alterations in collagen expression, bone remodeling, cell division, and proteoglycan distribution in the MCC is described. The quantification of these changes in histological sections - by counting the positive fluorescent pixels using image software and measuring the distance mapping and stained area with Digimizer - is also demonstrated. The methods shown here are not limited to the murine TMJ, but could be used on additional bones of small experimental animals and in other regions of endochondral ossification.

This manuscript presents methods for analyzing morphometric and cellular changes within the mandibular condyle of rodents.

The temporomandibular joint (TMJ) has the capacity to adapt to external stimuli, and loading changes can affect the position of condyles, as well as the ...

Laser Capture Microdissection of Highly Pure Trabecular Meshwork from Mouse Eyes for Gene Expression Analysis

Laser capture microdissection (LCM) has allowed gene expression analysis of single cells and enriched cell populations in tissue sections. LCM is a great tool for the study of the molecular mechanisms underlying cell differentiation and the development and progression of various diseases, including glaucoma. Glaucoma, which comprises a family of progressive optic neuropathies, is the most common cause of irreversible blindness worldwide. Structural changes and damage within the trabecular meshwork (TM) can result in increased intraocular pressure (IOP), which is a major risk factor for developing glaucoma. However, the precise molecular mechanisms involved are still poorly understood. The ability to perform gene expression analysis will be crucial in obtaining further insights into the function of these cells and its role in the regulation of IOP and glaucoma development. To achieve this, a reproducible method for isolating highly enriched TM from frozen sections of mouse eyes and a method for downstream gene expression analysis, such as RT-qPCR and RNA-Seq is needed. The method described herein is developed to isolate highly pure TM from mouse eyes for downstream digital PCR and microarray analysis. In addition, this technique can be easily adapted for the isolation of other highly enriched ocular cells and cell compartments that have been difficult to isolate from mouse eyes. The combination of LCM and RNA analysis can contribute to a more comprehensive understanding of the cellular events underlying glaucoma.

Here, we describe a protocol for a reproducible laser capture microdissection (LCM) for isolating trabecular meshwork (TM) for downstream RNA analysis. The ability to analyze changes in gene expression in the TM will help in understanding the underlying molecular mechanisms of TM-related ocular diseases.

Laser capture microdissection (LCM) has allowed gene expression analysis of single cells and enriched cell populations in tissue sections. LCM is a great ...