Supported by National Institutes of Health (DK55679, and DK59888 to A.N.). Emory University&#160;Integrated Cellular Imaging Microscopy Core of the Winship Cancer&#160;Institute comprehensive cancer center grant, P30CA138292, and the Crohn's and Colitis Foundation of America Career Development award to C.T.C. and Fellowship Award to A.E.F.

Esperimenti utilizzati topi C57BL / 6 tra 10 e 12 settimane di età. Tutte le procedure che utilizzano gli animali sono stati esaminati e approvati dall&#39;Università Istituzionale Cura e Comitato uso degli animali Emory e sono state eseguite secondo National Institutes of Criteri sanitari. 1. Setup sperimentale <ol><li> Impostazione del criostato <ol><li> Equilibrare criostato a -20 ° C, tra cui la lama microtomo e mandrini (estrema cautela intorno alla lama!). </li><li> Riempire un vuoto con cryomold ottobre (Ottimale composta Taglio temperatura) ed equilibrare a -20 ° C (~ 30 min). Rimuovere l&#39;ottobre congelato dallo stampo e fissarlo sul mandrino con liquido ottobre Posizionare il blocco / mandrino nel braccio microtomo e consentire di Office per impostare per 10 minuti. </li><li> Impostare il criostato a 10 micron per sezione e radersi il blocco ottobre fino a quando non è piatta. Eseguire il braccio microtomo lontano dalla lama di alcuni centimetri. A questo punto non regolare la lama o mandrino per il resto della experiment. </li></ol></li><li> Preparare le lamette da barba: Preparare 2 lamette per campione. Utilizzo di un file di metallo, opaco bordo sharped di lame. Quindi, rimuovere la flangia in alluminio con una pinza. </li><li> Pre-raffreddare una pirofila o altra superficie piatta in ghiaccio secco. </li><li> Preparare un piatto dissezione con 10-15 perni dissezione. A 10 centimetri piatto di coltura tissutale 50% pieno di silicio sarà sufficiente. Aggiungere 5 ml di tampone Hanks a temperatura ambiente. </li></ol> 2. dissezione distale colon Tissue <ol><li> Topi posto in una camera sigillata e Euthanize topi per inalazione isoflurano e dislocazione cervicale, quindi spruzzare il 70% di etanolo sul ventre e del torace 12. </li><li> Fai una piccola incisione nella pelle dell&#39;addome con le forbici e poi fare un&#39;incisione per esporre la cavità peritoneale. Procedure simili si possono trovare qui 12 descritto. </li><li> Tagliare l&#39;intestino crasso al margine anale e prendere in giro a parte il mesentere fino a quando il colon è gratuito. </li><li> Accise un colon distalesegmento tra 0 e 6 cm dalla ano. Qui, la profondità cripta ~ 150 micron (vedere Figura 1B). Taglio aperto il colon longitudinalmente con le forbici e rimuovere il contenuto fecale. </li><li> Pin il tessuto al piatto dissezione con la superficie della mucosa rivolta verso l&#39;alto. Allungare il tessuto con perni dissezione su un piatto di silicio in tampone Hanks e lasciare riposare per 10 minuti a temperatura ambiente (Figura 1C). Questo elimina pieghe dal tessuto e permette strati muscolari di rilassarsi. </li></ol> 3. Montare tessuto sulla Criostato per il sezionamento <ol><li> Infilare una lametta sotto la sezione desiderata del tessuto e quindi versare il tampone Hanks. Aggiungere un&#39;altra lametta all&#39;inizio, facendo un sandwich. Tagliare il segmento tessuti e rimuovere i perni. Trasferire il panino lametta / tessuto a ghiaccio secco. Lasciare che il tessuto di congelare (5-10 min, Figura 1D). </li><li> Sollevare il rasoio / panino tessuto e lasciarlo riscaldare leggermente mettendo un dito sul bl superioreade (lato mucosale up. Questo orienta il tessuto in modo che gli strati muscolari basali sono sezionate prima.). Separare il sandwich e tagliare lungo i bordi del segmento tissue. Tagliare un segmento di tessuto di circa 0,5 x 1 cm. Aree di bordo hanno la tendenza ad arricciarsi, causando sezioni seriali contengono molti strati di tessuto. Si noti che l&#39;eccesso di taglio è migliore di sotto-taglio, in modo sbagliare sul lato della cautela. </li><li> Lasciare il tessuto riscaldare fino ghiaccio sulla parte superiore del tessuto inizia a fondere. A questo punto rapidamente e con attenzione premere il tessuto nel blocco OCT criostato. </li><li> Rimuovere la lama inserendo un dito sul campione. Il trasferimento di calore permette di rimuovere la lama senza interrompere il tessuto. </li><li> Cappotto il tessuto con ottobre e equilibrare per 5 minuti. Tagliare le sezioni a 10 micron (Figura 1E, F). Visivamente sezioni fino a quando le cripte sono visti. Luogo sezioni in un provette da 1,5 ml o su diapositive. </li><li> Per l&#39;analisi di mRNA e di proteine, luogo tegli campioni in tubi con 5 cripta-base, 5 di transizione, e 5 sezioni di superficie per provetta. Per la raccolta RNA aggiungere 1 ml di reagente commerciale isolamento e incubare a temperatura ambiente per 10 min. Eseguire la purificazione di RNA secondo le istruzioni del produttore. Utilizzare 5-10 mg di RNA totale per la generazione di cDNA. </li><li> Per purificazione della proteina, aggiungere 0,5 ml di freddo RIPA Lysis Buffer (più inibitori della proteasi) per 5 sezioni. Sonicare 3 volte in un ciclo di 70%, su ghiaccio. <ol><li> Aggiungere esempi di SDS tampone di caricamento delle pagine (buffer Laemmli) e incubare a 100 ° C per 10 min. Campioni soggetti a SDS PAGE e trasferimento, poi bloccano in 5% di latte / PBS per 2 ore. Eseguire l&#39;analisi Western Blot seguita da incubazione con anticorpi Klf4 (1: 500) O / N a 4 ° C. </li></ol></li></ol>

<ol>
	<li>Noah, T. K., Donahue, B., Shroyer, N. F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Intestinal+development+and+differentiation.">Intestinal development and differentiation.</a> Exp Cell Res. 317, 2702-2710 (2011).</li><li>Humphries, A., Wright, N. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Colonic+crypt+organization+and+tumorigenesis.">Colonic crypt organization and tumorigenesis.</a> Nat Rev Cancer. 8, 415-424 (2008).</li><li>Weber, C. R., Turner, J. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Inflammatory+bowel+disease:+is+it+really+just+another+break+in+the+wall.">Inflammatory bowel disease: is it really just another break in the wall.</a> Gut. 56, 6-8 (2007).</li><li>Bjerknes, M., Cheng, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Methods+for+the+isolation+of+intact+epithelium+from+the+mouse+intestine.">Methods for the isolation of intact epithelium from the mouse intestine.</a> Anat Rec. 199, 565-574 (1981).</li><li>Sato, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Single+Lgr5+stem+cells+build+crypt-villus+structures+in+vitro+without+a+mesenchymal+niche.">Single Lgr5 stem cells build crypt-villus structures in vitro without a mesenchymal niche.</a> Nature. 459, 262-265 (2009).</li><li>Rand, M. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Calcium+depletion+dissociates+and+activates+heterodimeric+notch+receptors.">Calcium depletion dissociates and activates heterodimeric notch receptors.</a> Mol Cell Biol. 20, 1825-1835 (2000).</li><li>Gjorevski, N., Boghaert, E., Nelson, C. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Regulation+of+Epithelial-Mesenchymal+Transition+by+Transmission+of+Mechanical+Stress+through+Epithelial+Tissues.">Regulation of Epithelial-Mesenchymal Transition by Transmission of Mechanical Stress through Epithelial Tissues.</a> Cancer Microenviron. 5, 29-38 (2012).</li><li>Lechner, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Gene+expression+pattern+of+laser+microdissected+colonic+crypts+of+adenomas+with+low+grade+dysplasia.">Gene expression pattern of laser microdissected colonic crypts of adenomas with low grade dysplasia.</a> Gut. 52, 1148-1153 (2003).</li><li>Reizel, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Colon+stem+cell+and+crypt+dynamics+exposed+by+cell+lineage+reconstruction.">Colon stem cell and crypt dynamics exposed by cell lineage reconstruction.</a> PLoS Genet. 7, e1002192 (2011).</li><li>Kosinski, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Gene+expression+patterns+of+human+colon+tops+and+basal+crypts+and+BMP+antagonists+as+intestinal+stem+cell+niche+factors.">Gene expression patterns of human colon tops and basal crypts and BMP antagonists as intestinal stem cell niche factors.</a> Proc Natl Acad Sci U S A. 104, 15418-15423 (2007).</li><li>Tamura, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Pit+pattern+and+three-dimensional+configuration+of+isolated+crypts+from+the+patients+with+colorectal+neoplasm.">Pit pattern and three-dimensional configuration of isolated crypts from the patients with colorectal neoplasm.</a> J Gastroenterol. 37, 798-806 (2002).</li><li>Geem, D., Medina-Contreras, O., Kim, W., Huang, C. S., Denning, T. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Isolation+and+characterization+of+dendritic+cells+and+macrophages+from+the+mouse+intestine.">Isolation and characterization of dendritic cells and macrophages from the mouse intestine.</a> Journal of visualized experiments : JoVE. , e4040 (2012).</li><li>Laukoetter, M. G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=JAM-A+regulates+permeability+and+inflammation+in+the+intestine+in+vivo.">JAM-A regulates permeability and inflammation in the intestine in vivo.</a> J Exp Med. 204, 3067-3076 (2007).</li><li>Neumann, P. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Gut+commensal+bacteria+and+regional+Wnt+gene+expression+in+the+proximal+versus+distal+colon.">Gut commensal bacteria and regional Wnt gene expression in the proximal versus distal colon.</a> Am J Pathol. 184, 592-599 (2014).</li><li>Capaldo, C. T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Proinflammatory+cytokine-induced+tight+junction+remodeling+through+dynamic+self-assembly+of+claudins.">Proinflammatory cytokine-induced tight junction remodeling through dynamic self-assembly of claudins.</a> Mol Biol Cell. 25, 2710-2719 (2014).</li><li>Wells, J. M., Spence, J. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=How+to+make+an+intestine.">How to make an intestine.</a> Development. 141, 752-760 (2014).</li></ol>

The authors have nothing to disclose

I meccanismi molecolari coinvolti nella proliferazione delle cellule epiteliali del colon e la differenziazione sono poco conosciute. Questo include lacune nella nostra comprensione dell&#39;ambiente segnalazione cellulare del compartimento di cellule staminali alla base delle cripte epiteliali del colon. Vi è anche un crescente interesse per i processi che stanno alla base di differenziazione enterociti. Ad esempio, ha aumentato la comprensione di differenziazione in vivo è necessaria come punto di riferimento per gli studi volti a produrre in vitro sistemi intestinali primarie 16. La procedura di cui sopra contiene diversi passaggi che richiedono una particolare attenzione. In primo luogo, eliminando i bordi intorno al segmento tessuto congelato (come discusso nella sezione 3.2) è richiesto come i bordi di tessuto riccio durante la dissezione e il congelamento. La mancata spostare questi spigoli risultati è una popolazione mista di cellule superficiali e base cripta. Montaggio il tessuto su una, ottobre blocco livellati pre-raffreddata è anche essenziale. Tsuo protocollo può essere adattato ad altre zone del colon distale modificando il numero di sezioni in ciascun pool. Ad esempio, come mostrato nella Figura 1B, lunghezza cripta mucosa varia tra 150-300 micron. Pertanto, quando si studia la regione tra 4 CM-6 centimetri dall&#39;ano, il numero di sezioni dovrebbe essere aumentato da 15 a 30. È importante sottolineare che questo protocollo non è suggerito per il colon prossimale (7 gli cm-9 cm) a causa di pieghe ( pliche obliquae) che si estendono nel lume rendendo impossibile superficie e la cripta-base celle separate di sezionamento seriale. Tecniche di sezionamento seriali sono state usate per studiare cripta-base e la superficie popolazioni di cellule epiteliali nell&#39;uomo. Tuttavia, il nostro protocollo aggiunge passaggi aggiuntivi richiesti a causa delle piccole dimensioni del tessuto murino. Proponiamo che il protocollo di cui sopra consentirà la ricerca di cripta-base e la popolazione di cellule epiteliali di superficie nei sistemi geneticamente trattabili mouse. In effetti, le sezioni pool Yield proteine ​​di alta qualità e RNA analisi valle adatto. Le applicazioni future potrebbero includere lo studio delle vie di segnalazione cellulare o immunoprecipitazione della cromatina. Tuttavia, va notato che, come molti dei metodi alternativi descritti sopra, le sezioni ottenute contengono una miscela di cellule lamina propria epiteliali e interstiziali. In conclusione, il protocollo qui descritto fornisce un rapido metodo del rendimento, alta per l&#39;analisi dei processi molecolari in regioni spazialmente distinte della mucosa del colon murino.

Il rivestimento epiteliale del colon è un tessuto altamente rigenerativa, con le cellule staminali residenti rifornire il tessuto ogni pochi giorni 1. Questo processo di rigenerazione richiede il mantenimento di un compartimento staminale proliferativa. Nel corso del tempo, le cellule figlie nuova produzione perdono il loro potenziale proliferativo e migrano verso la superficie luminale dell&#39;intestino. In coincidenza con la migrazione, le cellule progenitrici differenziarsi in enterociti-barriera che formano mature o cellule caliciformi che producono muco. Fallimento di questo programma differenziazione è pensato per contribuire alla compromissione barriera epiteliale, come si osserva nella malattia infiammatoria intestinale e del colon 2,3. Studio dettagliato dei processi di cui sopra richiede metodologie per isolare le popolazioni cripta-base e delle cellule di superficie. Esistono metodi multipli, ciascuno con vantaggi e svantaggi. Gli attuali metodi per l&#39;isolamento delle cellule epiteliali intestinali includono chagenti elating e dissociazione meccanica, con conseguente isolamento di intere cripte, fogli epiteliali, o cellule singole, dipendenti condizioni sperimentali 4,5. Questi sono metodi ad alto rendimento, ma i cambiamenti nella segnalazione intercellulare sono stati riportati in queste condizioni, che non possono rappresentare l&#39;ambiente nativo 6,7. Microdissezione laser consente la raccolta di materiale spaziale distinte, ma realizza bassa resa 8,9 molecolare. Nel tessuto del colon umano, metodi criosezionamento orizzontali di serie sono stati sviluppati 10. Tuttavia, mucose murini sono proibitivamente piccole per appropriazione diretta di questa tecnica. Negli esseri umani, le lunghezze cripta intestinale (la distanza tra la cripta-base e cellule di superficie), nel colon varia tra ~ 100-1.000 micron 11. Nei topi, le lunghezze cripta sono tra ~ 50-300 micron (vedi Figura 1A). Le piccole dimensioni delle cripte murine rappresenta una sfida per l&#39;isolazione di queste due popolazioni cellulari che utilizzano protocolli esistenti. Descriviamo ora un basso costo, il metodo ad alto rendimento per l&#39;isolamento di cripta-base e la superficie popolazione di cellule epiteliali nel tessuto del colon murino. Tissue raccolti in questo modo può poi essere analizzato da un certo numero di applicazioni a valle standard, tra immunofluorescenza, RT-PCR (Real Time-Polymerase Chain Reaction) o western blotting.

<table border="0" cellpadding="0" cellspacing="0">
	<tbody>
		<tr>
			<td>Microtome</td>
			<td>Leica Biosystems, Nussloch Germany</td>
			<td>CM 1510-3</td>
			<td></td>
		</tr>
		<tr>
			<td>MyiQ real time PCR detector</td>
			<td>BioRad</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>LSM 510&#160;</td>
			<td>Carl Zeiss</td>
			<td></td>
			<td>Confocal microscope</td>
		</tr>
		<tr>
			<td>Materials</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>OCT</td>
			<td>Tissue-Tek, Sakura Finetek, Torrance CA</td>
			<td>4583</td>
			<td></td>
		</tr>
		<tr>
			<td>cryo-mold</td>
			<td>Tissue-Tek, Sakura Finetek, Torrance CA</td>
			<td>4557</td>
			<td>25mmx20mmx5mm</td>
		</tr>
		<tr>
			<td>High profile microtome blade</td>
			<td>Leica Biosystems, Nussloch germany</td>
			<td>818</td>
			<td></td>
		</tr>
		<tr>
			<td>GEM industrial blades</td>
			<td>American Safety Razor Blades</td>
			<td>62-0314</td>
			<td></td>
		</tr>
		<tr>
			<td>Sylgard silicon elastomere base</td>
			<td>Dow Corning, Midland MI</td>
			<td>3097358</td>
			<td></td>
		</tr>
		<tr>
			<td>27 1/2 g needle</td>
			<td>Becton-Dickinson, Franklin Lakes, NJ</td>
			<td>305109</td>
			<td>pins for dissection</td>
		</tr>
		<tr>
			<td>TRizol</td>
			<td>Life Technologies</td>
			<td>15596018</td>
			<td></td>
		</tr>
		<tr>
			<td>Rneasy</td>
			<td>Qiagen</td>
			<td>74104</td>
			<td></td>
		</tr>
		<tr>
			<td>DNAse</td>
			<td>Qiagen</td>
			<td>79254</td>
			<td></td>
		</tr>
		<tr>
			<td>Reagents</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Antibody ZO-1</td>
			<td>Invitrogen&#160;</td>
			<td>187430</td>
			<td></td>
		</tr>
		<tr>
			<td>Antibody KLF4</td>
			<td>Cell Signaling</td>
			<td>4038S</td>
			<td></td>
		</tr>
		<tr>
			<td>Antibody mGAPDH</td>
			<td>Sigma</td>
			<td>G8795</td>
			<td></td>
		</tr>
		<tr>
			<td>Antibody Secondary Alexa conjugate</td>
			<td>Invitrogen</td>
			<td>A11034</td>
			<td>488 anti-rabbit</td>
		</tr>
		<tr>
			<td>Antibody Secondary HRP conjugate</td>
			<td>Jackson</td>
			<td>111/115-001-003</td>
			<td>rabbit/mouse&#160;</td>
		</tr>
		<tr>
			<td>Topro-3</td>
			<td>Invitrogen</td>
			<td>T3605</td>
			<td></td>
		</tr>
		<tr>
			<td>HANKs balanced salt buffer</td>
			<td>Life Technologies</td>
			<td>14025092</td>
			<td></td>
		</tr>
		<tr>
			<td>RIPA lysis buffer</td>
			<td></td>
			<td></td>
			<td>50mM Tris-HCl pH 7.4 150mM NaCl 1% NP40 0.25% Na-deoxycholate</td>
		</tr>
		<tr>
			<td>PCR Primers</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>primer TBP 3&#39;</td>
			<td></td>
			<td></td>
			<td>GGAATTGTACCGCAGCTTCAAA</td>
		</tr>
		<tr>
			<td>primer TBP 5&#39;</td>
			<td></td>
			<td></td>
			<td>GATGACTGCAGCAAATCGCTT</td>
		</tr>
		<tr>
			<td>primer KLF4 3&#39;</td>
			<td></td>
			<td></td>
			<td>TGTGACTATGCAGGCTGTGGCAAA</td>
		</tr>
		<tr>
			<td>primer KLF4 5&#39;</td>
			<td></td>
			<td></td>
			<td>ACAGTGGTAAGGTTTCTCGCCTGT</td>
		</tr>
	</tbody>
</table>

cryosectioning method for microdissection of murine colonic mucosa

The colonic mucosal tissue provides a vital barrier to luminal antigens. This barrier is composed of a monolayer of simple columnar epithelial cells. The colonic epithelium is dynamically turned over and epithelial cells are generated in the stem cell containing crypts of Lieberk&#252;hn. Progenitor cells produced in the crypt-bases migrate toward the luminal surface, undergoing a process of cellular differentiation before being shed into the gut lumen. In order to study these processes at the molecular level, we have developed a simple method for the microdissection of two spatially distinct regions of the colonic mucosa; the proliferative crypt zone, and the differentiated surface epithelial cells. Our objective is to isolate specific crypt and surface epithelial cell populations from mouse colonic mucosa for the isolation of RNA and protein.

Sezioni di tessuto del colon sono stati elaborati per la valutazione istologica e H &amp; E colorazione 13. Una visione tradizionale sezione trasversale della mucosa è visto in Figura 2A. Aree basali contengono il externa muscolare, composta principalmente delle muscolare circolari. Procedendo verso il lume, la mucosa muscolare è evidente adiacente alle cellule epiteliali cripta-base, cellule transizionali sono al centro del tessuto, e, infine, popolazioni cellulari superficie faccia lume intestinale. Il metodo descritto qui sezionamento seriale mantiene un orientamento tale che le muscolare longitudinali e circolari sono incontrate, prima (Figura 2B), seguita dalla mucosa muscolare (Figura 2C). Si noti la comparsa di cellule interstiziali non muscolari in alto a sinistra dell&#39;immagine. Per l&#39;analisi valle descritto di seguito, le sezioni muscolari vengono scartati. Le sezioni successive contengono cellule epiteliali e tessuto interstiziale (lamina propria), A partire dalle cellule cripta-base (Figura 2D). Si noti l&#39;assenza di un lume centrale nella maggior parte delle cripte, che appaiono più scuro a causa dei nuclei fitte. Questi strati contengono il vano proliferativa. Le cellule di transizione appaiono come accuratamente imballati ghiandole con lumen centrali importanti (Figura 2E). Infine, le popolazioni di cellule superficie hanno una struttura irregolare, con aree del monostrato epiteliale visto en face (Figura 2F). Sezioni seriali descritti sopra possono anche essere trattati per l&#39;etichettatura immunofluorescenza e microscopia confocale (come descritto qui 14). La figura 2G mostra cripte isolate fissi e permeabilizzate in 100% di metanolo e successivamente colorate per nuclei (blu) e la proteina giunzione cellula-cellula zonula occludere 1 (ZO-1, verde). Nel orientamento sezionamento tradizionale, cellule cripta e la superficie può essere visto contemporaneamente (Figura 2G </strong&gt;). Si noti che le linee ZO-1 macchia giunzionale lume della cripta del colon. Questo rivestimento Z0-1 del lume può essere visto anche in campioni seriali sezionate di popolazioni cellulari transitorie, nel centro delle ghiandole circolari (figura 2G). Avanzato ZO-1 macchia è visto in popolazioni cellulari di superficie (figura 2I e J). Diversi fattori di differenziazione sono noti per essere espressi in modo spaziotemporale lungo l&#39;asse cripta-superficie. Questo include il fattore di fattore di trascrizione Kruppel-like 4 (Klf4), che è noto per essere arricchito in popolazioni cellulari di superficie. Con i metodi tradizionali di sezionamento, Klf4 si trova nei nuclei di lume di fronte popolazioni cellulari di superficie (Figura 2K). Abbiamo quindi ipotizzato che Klf4 mRNA sarebbe espressa prevalentemente in popolazioni di cellule superficiali. Per verificare ciò, sezioni seriali sono stati raccolti e raggruppati in campioni di superficie, di transizione, e cripta-base. Subsequente, RNA è stato raccolto con l&#39;estrazione di serie Trizol, con una purificazione supplementare RNeasy colonna e trattamento DNAsi. L&#39;RNA è stato raccolto da 5 sezioni consecutive messe in comune, che diedero tra 5-10 mg di RNA totale per campione. Questi campioni sono stati poi sottoposti a semi-quantitativa real time PCR sia Klf4 e un gene di riferimento, TATA binding protein 1 scatola (TBP-1) (Figura 2L) 14. Come mostrato in Figura 2L, dopo la normalizzazione di TBP-1, cellule superficiali sono stati trovati per esprimere fino a 8 volte il Klf4 mRNA che è espresso nelle cellule cripta. Allo stesso modo, sono stati trovati livelli di proteina Klf4 esporre regolazione spaziale lungo l&#39;asse cripta superficie. Sezioni seriali sono stati riuniti come descritto sopra e poi incubate in tampone di lisi per 20 min a 4 ° C. Questo ha prodotto tra 200-250 mg di proteine ​​per campione. I campioni sono stati poi sottoposti analisi mediante SDS-PAGE (Figura 2M) 15. Come mostrato nella Figura 2M, Klf4 plivelli rotein sono drammaticamente più alta in popolazioni di cellule di superficie. I risultati di cui sopra dimostrano la capacità di questo protocollo per isolare grandi quantità di superficie e le cellule epiteliali cripta della mucosa del colon murino. <img alt="Figura 1" src="/files/ftp_upload/53112/53112fig1.jpg" /> Figura 1: (A) mostra schematica murine mucosa del colon e strati muscolari esterni. Il nostro metodo si propone di raccogliere cellulari di superficie e la cripta-base popolazioni cellulari discreti criosezionamento seriale (10 micron ciascuna). Gli strati muscolari esterni vengono scartati. Altezza (B) cripta varia lungo la lunghezza del colon (distanza interstrato cripta-base e la superficie). I punti dati indicano singole misurazioni cripta e simboli indicano repliche biologiche (n = 4). (C) segmenti Colon raccolti, Diviso in due parti, e appuntato su un piatto di silicio dissezione. (D) Un tessuto segment circa 3 cm dal ano si preme tra di lamette da barba e congelati in ghiaccio secco. (E) tessuto viene poi montato su un blocco Ottobre pre-livellato. (F) criosezioni vengono rimosse ed esame visivo. <img alt="Figura 2" src="/files/ftp_upload/53112/53112fig2.jpg" /> Figura 2:. Dati rappresentativi (A) tessuto del colon colorate con ematossilina-eosina in sezione trasversale che mostra la muscolaris circolari (cm), la mucosa muscolare (mm), cellule cripta-base, cellule di transizione, e cellule superficiali. (B - C) strati muscolari del colon. (D) le cellule Cripta-base. Si noti l&#39;assenza di un lume centrale. (E) le cellule di transizione. (F), le cellule di superficie. (G) Immunofluorescenza di isolati cripte del colon. ZO-1 (verde) e nuclei (blu) si osservano in sezione trasversale. (CIAO) ZO-1 e colorazione nucleare in cellule di transizione e di superficie. (J) vista ingrandita ZO-1 colorazione. (K) Klf4 (verde) si arricchisce in popolazioni di cellule di superficie. (L) Real-time PCR valutazione dei livelli di mRNA Klf4 tra i tre compartimenti. (M) Western blot dei livelli di proteine ​​Klf4 in queste popolazioni di cellule.

Watch this Scientific Journal Video about Cryosectioning Method for Microdissection of Murine Colonic Mucosa at JoVE.com

Cryosectioning Method for Microdissection of Murine Colonic Mucosa

Here we describe a simple method for the isolation of spatially distinct murine colonic epithelial surface cells from the underlying crypt-base cells.

Metodo criosezionamento per Microdissezione di Murine colon mucosa

The colonic mucosal tissue provides a vital barrier to luminal antigens. This barrier is composed of a monolayer of simple columnar epithelial cells. The ...

cryosectioning-method-for-microdissection-of-murine-colonic-mucosa

Research

JoVE Journal

Biology

17.2K Views.  Emory University, Atlanta, Georgia. Here we describe a simple method for the isolation of spatially distinct murine colonic epithelial surface cells from the underlying crypt-base cells.

Video: Cryosectioning Method for Microdissection of Murine Colonic Mucosa

Flash Freezing and Cryosectioning E12.5 Mouse Brain

Demonstrated in this video are the techniques for flash freezing and sectioning embryonic brain tissue from mouse. Useful tips for using the cryostat are given, including troubleshooting methods that can be used while cutting to ensure that the resultant tissues sections are free of cracks and other distortions.

Flash Congelamento e criosezionamento E12.5 cervello di topo

Ricerca

Biologia

Laser Capture Microdissection of Mammalian Tissue

Laser capture microscopy, also known as laser microdissection (LMD), enables the user to isolate small numbers of cells or tissues from frozen or formalin-fixed, paraffin-embedded tissue sections. LMD techniques rely on a thermo labile membrane placed either on top of, or underneath, the tissue section. In one method, focused laser energy is used to melt the membrane onto the underlying cells, which can then be lifted out of the tissue section. In the other, the laser energy vaporizes the foil along a path "drawn" on the tissue, allowing the selected cells to fall into a collection device. Each technique allows the selection of cells with a minimum resolution of several microns. DNA, RNA, protein, and lipid samples may be isolated and analyzed from micro-dissected samples. In this video, we demonstrate the use of the Leica AS-LMD laser microdissection instrument in seven segments, including an introduction to the principles of LMD, initializing the instrument for use, general considerations for sample preparation, mounting the specimen and setting up capture tubes, aligning the microscope, adjusting the capture controls, and capturing tissue specimens. Laser-capture micro-dissection enables the investigator to isolate samples of pure cell populations as small as a few cell-equivalents. This allows the analysis of cells of interest that are free of neighboring contaminants, which may confound experimental results.

Laser Microdissezione Cattura di tessuti di mammiferi

Laser capture microscopy, also known as laser microdissection (LMD), enables the user to isolate small numbers of cells or tissues from frozen or ...

Microdissection of Zebrafish Embryonic Eye Tissues

Zebrafish is a popular animal model for research on eye development because of its rapid ex utero development and good fecundity. By 3 days post fertilization (dpf), the larvae will show the first visual response. Many genes have been identified to control a proper eye development, but we are far from a complete understanding of the underlying genetic architecture. Whole genome gene expression profiling is a useful tool to elucidate genetic regulatory network for eye development. However, the small size of the embryonic eye in zebrafish makes it challenging to obtain intact and pure eye tissues for expression analysis. For example, the anterior-posterior length of the eye between day 2 and 3 is only approximately 200-300 &mu;m, while the diameter of the lens is less 100 &mu;m. Also, the retinal pigment epithelium (RPE) underlying the retina is just a single-layer epithelium. While gene expression profiles can be obtained from the whole embryo, they do not accurately represent the expression of these tissues. Therefore pure tissue must be obtained for a successful gene expression profiling of eye development. To address this issue, we have developed an approach to microdissect intact retina and retina with RPE attached from 1-3 dpf, which cover major stages of eye morphogenesis. All procedures can be done with fine forceps and general laboratory supplies under standard stereomicroscopes. For retinal dissection, the single-layer RPE is removed and peeled off by brushing action and the preferential adherence of the RPE remnants to the surface of the culture plate for dissection. For RPE-attached retinal dissection, the adherence of RPE to the dissection plate is removed before the dissection so that the RPE can be completely preserved with the retina. A careful lifting action of this tissue can efficiently separate the presumptive choroid and sclera. The lens can be removed in both cases by a chemically etched tungsten needle. In short, our approach can obtain intact eye tissues and has been successfully utilized to study tissue-specific expression profiles of zebrafish retina1, 2 and retinal pigment epithelium3.

This article describes an approach to microdissect zebrafish retinas with and without retinal pigment epithelium attached, from one to three days postfertilization embryos.

Microdissezione dei tessuti oculari Zebrafish embrionali

Zebrafish is a popular animal model for research on eye development because of its rapid ex utero development and good fecundity. By 3 days post ...

Microdissection of Black Widow Spider Silk-producing Glands

Modern spiders spin high-performance silk fibers with a broad range of biological functions, including locomotion, prey capture and protection of developing offspring 1,2. Spiders accomplish these tasks by spinning several distinct fiber types that have diverse mechanical properties. Such specialization of fiber types has occurred through the evolution of different silk-producing glands, which function as small biofactories. These biofactories manufacture and store large quantities of silk proteins for fiber production. Through a complex series of biochemical events, these silk proteins are converted from a liquid into a solid material upon extrusion.
Mechanical studies have demonstrated that spider silks are stronger than high-tensile steel 3. Analyses to understand the relationship between the structure and function of spider silk threads have revealed that spider silk consists largely of proteins, or fibroins, that have block repeats within their protein sequences 4. Common molecular signatures that contribute to the incredible tensile strength and extensibility of spider silks are being unraveled through the analyses of translated silk cDNAs. Given the extraordinary material properties of spider silks, research labs across the globe are racing to understand and mimic the spinning process to produce synthetic silk fibers for commercial, military and industrial applications. One of the main challenges to spinning artificial spider silk in the research lab involves a complete understanding of the biochemical processes that occur during extrusion of the fibers from the silk-producing glands.
Here we present a method for the isolation of the seven different silk-producing glands from the cobweaving black widow spider, which includes the major and minor ampullate glands [manufactures dragline and scaffolding silk] 5,6, tubuliform [synthesizes egg case silk] 7,8, flagelliform [unknown function in cob-weavers], aggregate [makes glue silk], aciniform [synthesizes prey wrapping and egg case threads] 9 and pyriform [produces attachment disc silk] 10. This approach is based upon anesthetizing the spider with carbon dioxide gas, subsequent separation of the cephalothorax from the abdomen, and microdissection of the abdomen to obtain the silk-producing glands. Following the separation of the different silk-producing glands, these tissues can be used to retrieve different macromolecules for distinct biochemical analyses, including quantitative real-time PCR, northern- and western blotting, mass spectrometry (MS or MS/MS) analyses to identify new silk protein sequences, search for proteins that participate in the silk assembly pathway, or use the intact tissue for cell culture or histological experiments.

Here we describe an efficient strategy to remove the silk-producing glands from the abdomen of female black widow spiders. This procedure allows the rapid isolation of the seven distinct silk-producing glands in a highly purified fashion, an important process for investigators studying spider silk production and fiber assembly.

Microdissezione di Black Widow Spider Silk ghiandole che producono

Modern spiders spin high-performance silk fibers with a broad range of biological functions, including locomotion, prey capture and protection of ...

A Novel Method for the Culture and Polarized Stimulation of Human Intestinal Mucosa Explants

Few models currently exist to realistically simulate the complex human intestine's micro-environment, where a variety of interactions take place. Proper homeostasis directly depends on these interactions, as they shape an entire immunological response inducing tolerance against food antigens while at the same time mounting effective immune responses against pathogenic microbes accidentally ingested with food.
Intestinal homeostasis is preserved also through various complex interactions between the microbiota (including food-associated beneficial bacterial strains) and the host, that regulate the attachment/degradation of mucus, the production of antimicrobial peptides by the epithelial barrier, and the "education" of epithelial cells' that controls the tolerogenic or immunogenic phenotype of unique, gut-resident lymphoid cells' populations. These interactions have been so far very difficult to reproduce with in vitro assays using either cultured cell lines or peripheral blood mononuclear cells. In addition, mouse models differ substantially in components of the intestinal mucosa (mucus layer organization, commensal bacteria community) with respect to the human gut. Thus, studies of a variety of treatments to be brought in the clinics for important stress-related or pathological conditions such as irritable bowel syndrome, inflammatory bowel disease or colorectal cancer have been difficult to carry out.
To address these issues, we developed a novel system that enables us to stimulate explants of human intestinal mucosa that retain their in situ conditioning by the host microbiota and immune response, in a polarized fashion. Polarized apical stimulation is of great importance for the outcome of the elicited immune response. It has been repeatedly shown that the same stimuli can produce completely different responses when they bypass the apical face of the intestinal epithelium, stimulating epithelial cells basolaterally or coming into direct contact with lamina propria components, switching the phenotype from tolerogenic to immunogenic and causing unnecessary and excessive inflammation in the area.
We achieved polarized stimulation by gluing a cave cylinder which delimited the area of stimulation on the apical face of the mucosa as will be described in the protocol. We used this model to examine, among others, differential effects of three different Lactobacilli strains. We show that this model system is very powerful to assess the immunomodulatory properties of probiotics in healthy and disease conditions.

We introduce a novel method for the maintenance of human intestinal mucosa in culture and monitoring of the response to various types of stimuli over at least 24 hrs. With our method, the polarity of the tissue is maintained, allowing for a physiological stimulation via the apical route.

Un nuovo metodo per la Cultura e polarizzata stimolazione umani espianti mucosa intestinale

Few models currently exist to realistically simulate the complex human intestine's micro-environment, where a variety of interactions take place. Proper ...

Cryosectioning Yeast Communities for Examining Fluorescence Patterns

Microbes typically live in communities. The spatial organization of cells within a community is believed to impact the survival and function of the community1. Optical sectioning techniques, including confocal and two-photon microscopy, have proven useful for observing spatial organization of bacterial and archaeal communities2,3. A combination of confocal imaging and physical sectioning of yeast colonies has revealed internal organization of cells4. However, direct optical sectioning using confocal or two-photon microscopy has been only able to reach a few cell layers deep into yeast colonies. This limitation is likely because of strong scattering of light from yeast cells4.
Here, we present a method based on fixing and cryosectioning to obtain spatial distribution of fluorescent cells within Saccharomyces cerevisiae communities. We use methanol as the fixative agent to preserve the spatial distribution of cells. Fixed communities are infiltrated with OCT compound, frozen, and cryosectioned in a cryostat. Fluorescence imaging of the sections reveals the internal organization of fluorescent cells within the community.
Examples of yeast communities consisting of strains expressing red and green fluorescent proteins demonstrate the potentials of the cryosectioning method to reveal the spatial distribution of fluorescent cells as well as that of gene expression within yeast colonies2,3. Even though our focus has been on Saccharomyces cerevisiae communities, the same method can potentially be applied to examine other microbial communities.

We present a protocol for freezing and cryosectioning yeast communities to observe internal patterns of fluorescent cells. The method relies on methanol-fixing and OCT-embedding to preserve the spatial distribution of cells without inactivating fluorescent proteins within a community.

Criosezionamento Comunità di lievito per l&#39;esame di pattern di fluorescenza

Microbes typically live  in communities. The spatial organization  of cells within a community is believed to impact the survival and function of the  ...

Laser-assisted Microdissection (LAM) as a Tool for Transcriptional Profiling of Individual Cell Types

The understanding of developmental processes at the molecular level requires insights into transcriptional regulation, and thus the transcriptome, at the level of individual cell types. While the methods described here are generally applicable to a wide range of species and cell types, our research focuses on plant reproduction. Plant cultivation and seed production is of crucial importance for human and animal nutrition. A detailed understanding of the regulatory networks that govern the formation of the reproductive lineage (germline) and ultimately of seeds is a precondition for the targeted manipulation of plant reproduction. In particular, the engineering of apomixis (asexual reproduction through seeds) into crop plants promises great improvements, as it leads to the formation of clonal seeds that are genetically identical to the mother plant. Consequently, the cell types of the female germline are of major importance for the understanding and engineering of apomixis. However, as the corresponding cells are deeply embedded within the floral tissues, they are very difficult to access for experimental analyses, including cell-type specific transcriptomics. To overcome this limitation, sections of individual cells can be isolated by laser-assisted microdissection (LAM). While LAM in combination with transcriptional profiling allows the identification of genes and pathways active in any cell type with high specificity, establishing a suitable protocol can be challenging. Specifically, the quality of RNA obtained after LAM can be compromised, especially when small, single cells are targeted. To circumvent this problem, we have established a workflow for LAM that reproducibly results in high RNA quality that is well suitable for transcriptomics, as exemplified here by the isolation of cells of the female germline in apomictic Boechera. In this protocol, procedures are described for tissue preparation and LAM, also with regard to RNA extraction and quality control.

Laser-assisted Microdissection LAM as a Tool for Transcriptional Profiling of Individual Cell Types

Here we present a protocol for laser-assisted microdissection of specific plant cell types for transcriptional profiling. While the protocol is suitable for different species and cell types, the focus is on highly inaccessible cells of the female germline important for sexual and apomictic reproduction in the crucifer genus Boechera.

Laser-assistita Microdissection (LAM) come strumento per trascrizionale Profiling di tipi di cellule individuali

The understanding of developmental processes at the molecular level requires insights into transcriptional regulation, and thus the transcriptome, at the ...

Cryosectioning of Contiguous Regions of a Single Mouse Skeletal Muscle for Gene Expression and Histological Analyses

With this method, consecutive cryosections are collected to enable both microscopy applications for tissue histology and enrichment of RNA for gene expression using adjacent regions from a single mouse skeletal muscle. Typically, it is challenging to achieve adequate homogenization of small skeletal muscle samples because buffer volumes may be too low for efficient grinding applications, yet without sufficient mechanical disruption, the dense tissue architecture of muscle limits penetration of buffer reagents, ultimately causing low RNA yield. By following the protocol reported here, 30 &#956;m sections are collected and pooled allowing cryosectioning and subsequent needle homogenization to mechanically disrupt the muscle, increasing the surface area exposed for buffer penetration. The primary limitations of the technique are that it requires a cryostat, and it is relatively low throughput. However, high-quality RNA can be obtained from small samples of pooled muscle cryosections, making this method accessible for many different skeletal muscles and other tissues. Furthermore, this technique enables matched analyses (e.g., tissue histopathology and gene expression) from adjacent regions of a single skeletal muscle so that measurements can be directly compared across applications to reduce experimental uncertainty and to reduce replicative animal experiments necessary to source a small tissue for multiple applications.

Consecutive cryo-sections are collected to enable histological applications and enrichment of RNA for gene expression measurements using adjacent regions from a single mouse skeletal muscle. High-quality RNA is obtained from 20 - 30 mg of pooled cryosections and measurements are directly compared across applications.

Criosezionamento di regioni contigue di un muscolo scheletrico mouse unico per l&#39;espressione genica e analisi istologiche

With this method, consecutive cryosections are collected to enable both microscopy applications for tissue histology and enrichment of RNA for gene ...

A Morphometric and Cellular Analysis Method for the Murine Mandibular Condyle

The temporomandibular joint (TMJ) has the capacity to adapt to external stimuli, and loading changes can affect the position of condyles, as well as the structural and cellular components of the mandibular condylar cartilage (MCC). This manuscript describes methods for analyzing these changes and a method for altering the loading of the TMJ in mice (i.e., compressive static TMJ loading). The structural evaluation illustrated here is a simple morphometric approach that uses the Digimizer software and is performed in radiographs of small bones. In addition, the analysis of cellular changes leading to alterations in collagen expression, bone remodeling, cell division, and proteoglycan distribution in the MCC is described. The quantification of these changes in histological sections - by counting the positive fluorescent pixels using image software and measuring the distance mapping and stained area with Digimizer - is also demonstrated. The methods shown here are not limited to the murine TMJ, but could be used on additional bones of small experimental animals and in other regions of endochondral ossification.

This manuscript presents methods for analyzing morphometric and cellular changes within the mandibular condyle of rodents.

Un metodo di analisi cellulare per condilo mandibolare murino e morfometrica

The temporomandibular joint (TMJ) has the capacity to adapt to external stimuli, and loading changes can affect the position of condyles, as well as the ...

Laser Capture Microdissection of Highly Pure Trabecular Meshwork from Mouse Eyes for Gene Expression Analysis

Laser capture microdissection (LCM) has allowed gene expression analysis of single cells and enriched cell populations in tissue sections. LCM is a great tool for the study of the molecular mechanisms underlying cell differentiation and the development and progression of various diseases, including glaucoma. Glaucoma, which comprises a family of progressive optic neuropathies, is the most common cause of irreversible blindness worldwide. Structural changes and damage within the trabecular meshwork (TM) can result in increased intraocular pressure (IOP), which is a major risk factor for developing glaucoma. However, the precise molecular mechanisms involved are still poorly understood. The ability to perform gene expression analysis will be crucial in obtaining further insights into the function of these cells and its role in the regulation of IOP and glaucoma development. To achieve this, a reproducible method for isolating highly enriched TM from frozen sections of mouse eyes and a method for downstream gene expression analysis, such as RT-qPCR and RNA-Seq is needed. The method described herein is developed to isolate highly pure TM from mouse eyes for downstream digital PCR and microarray analysis. In addition, this technique can be easily adapted for the isolation of other highly enriched ocular cells and cell compartments that have been difficult to isolate from mouse eyes. The combination of LCM and RNA analysis can contribute to a more comprehensive understanding of the cellular events underlying glaucoma.

Here, we describe a protocol for a reproducible laser capture microdissection (LCM) for isolating trabecular meshwork (TM) for downstream RNA analysis. The ability to analyze changes in gene expression in the TM will help in understanding the underlying molecular mechanisms of TM-related ocular diseases.

Microdissezione laser di elevata purezza trabecolato dai Mouse occhi per analisi dell'espressione genica

Laser capture microdissection (LCM) has allowed gene expression analysis of single cells and enriched cell populations in tissue sections. LCM is a great ...