Supported by National Institutes of Health (DK55679, and DK59888 to A.N.). Emory University&#160;Integrated Cellular Imaging Microscopy Core of the Winship Cancer&#160;Institute comprehensive cancer center grant, P30CA138292, and the Crohn's and Colitis Foundation of America Career Development award to C.T.C. and Fellowship Award to A.E.F.

ניסויים בשימוש C57BL / 6 עכברים בין 10 ל 12 שבועות של גיל. כל נהלי שימוש בבעלי חיים היו נבדקו ואושרו על ידי ועדת אמורי האוניברסיטה המוסדית טיפול בבעלי חיים והשימוש ובוצעו על פי המכון הלאומי לבריאות בקריטריונים. 1. התקנה ניסיונית <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> הגדרת cryostat <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> לאזן cryostat ל -20 מעלות צלזיוס, כולל להב microtome ותרמילים (זהירות קיצונית סביב הלהב!). </li><li style=";text-align:right;direction:rtl"> מלא cryomold ריק עם אוקטובר (מתחם טמפרטורה אופטימלי חיתוך) ולאזן לC -20 ° (~ 30 דקות). הסר ב- OCT הקפואה מהתבנית ולתקן אותה על צ&#39;אק עם אוקטובר הנוזלי. מניחים את הגוש / צ&#39;אק בזרוע microtome ולאפשר ב- OCT להגדיר במשך 10 דקות. </li><li style=";text-align:right;direction:rtl"> הגדר את cryostat עד 10 מיקרומטר לכל סעיף ולגלח את בלוק אוקטובר עד שהוא שטוח. חזרה זרוע microtome מהלהב בכמה סנטימטרים. בשלב זה לא להתאים את הלהב או צ&#39;אק לשארית experiment. </li></ol></li><li style=";text-align:right;direction:rtl"> הכן את סכיני גילוח: הכן 2 סכיני גילוח לדגימה. באמצעות קובץ מתכת, משעמם קצה sharped של להבים. בשלב הבא, להסיר את אוגן האלומיניום עם מלקחיים. </li><li style=";text-align:right;direction:rtl"> טרום צמרמורת צלחת פיירקס או משטח שטוח אחר על קרח יבש. </li><li style=";text-align:right;direction:rtl"> הכן צלחת לנתיחה עם 10-15 סיכות לנתיחה. 50% צלחת תרבית רקמת 10 סנטימטרים מלאים בסיליקון יספיקו. הוסף 5 מיליליטר של חיץ הנקס ב RT. </li></ol> 2. Dissection של רקמות המעי הגס דיסטלי <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> מקום עכברים בתא אטום ועכברים להרדים משאיפת isoflurane ונקע בצוואר הרחם, ולאחר מכן לרסס אתנול 70% על 12 הבטן ובית החזה. </li><li style=";text-align:right;direction:rtl"> לעשות חתך קטן בעור של הבטן עם מספריים ולאחר מכן לבצע חתך על מנת לחשוף את חלל הצפק. ניתן למצוא נהלים דומים מתואר כאן 12. </li><li style=";text-align:right;direction:rtl"> חותך את המעי גס בסף האנאלי ולהפריד לפדר עד למעי הגס ללא תשלום. </li><li style=";text-align:right;direction:rtl"> בלו מעי גס דיסטליקטע שבין 0 ל- 6 סנטימטר מהטבעת. כאן, עומק קריפטה הוא ~ 150 מיקרומטר (ראה איור 1). לחתוך את המעי הגס longitudinally באמצעות מספריים ולהסיר את תוכן הצואה. </li><li style=";text-align:right;direction:rtl"> הצמד את הרקמה לצלחת לנתיחה עם המשטח הרירי פונה כלפי מעלה. למתוח את הסיכות לנתיחה רקמות באמצעות על צלחת סיליקון במאגר הנקס ולתת מנוחה במשך 10 דקות ב RT (איור 1 ג). זה מסיר קפלים מרקמות ומאפשר שכבות השרירים להירגע. </li></ol> 3. רקמות הר על cryostat עבור חתך <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> להחליק בסכין גילוח בחלק הרצוי של רקמה ואז לשפוך את חיץ הנקס. להוסיף סכין גילוח אחר לראש, מה שהופך את כריך. חותך את קטע הרקמה ולהסיר את הסיכות. העבר את כריך סכין גילוח / רקמה לקרח יבש. לאפשר לרקמות להקפיא (5-10 דקות, 1D איור). </li><li style=";text-align:right;direction:rtl"> להרים את סכין הגילוח / כריך רקמות ולאפשר לו להתחמם מעט על ידי הנחת אצבע על BL העליוןADE (צד רירית עד. זה מכוון את הרקמה, כך ששכבות שרירים בסיסיות הם מחולק ראשונה.). הפרד את הכריך ולחתוך מסביב לקצוות של מגזר הרקמה. לחתוך קטע רקמה כ, x 1 סנטימטר על 0.5 סנטימטר. יש אזורי קצה נטייה להתכרבל, גורם לחלקים הסידוריים להכיל שכבות רקמה רבות. שים לב שנגמר חיתוך טוב יותר מאשר בחיתוך, כך לטעות בצד של זהירות. </li><li style=";text-align:right;direction:rtl"> לאפשר לרקמות לחמם עד הקרח על גבי הרקמה מתחיל להפשיר. בשלב זה לחץ במהירות ובזהירות את הרקמה לתוך בלוק אוקטובר בcryostat. </li><li style=";text-align:right;direction:rtl"> הסר את הלהב על ידי הנחת אצבע על המדגם. העברת החום תאפשר לך להסיר את הלהב מבלי לשבש את הרקמה. </li><li style=";text-align:right;direction:rtl"> מעיל הרקמה עם אוקטובר ולאזן במשך 5 דקות. חותך סעיפים 10 מיקרומטר ב( איור 1E, F). ראייה לבדוק את החלקים עד מאורות נראים. סעיפי מקום בצינורות 1.5 מיליליטר או בשקופיות. </li><li style=";text-align:right;direction:rtl"> לניתוח של mRNA או חלבון, לא מקוםהוא דגימות בצינורות עם 5 קריפטה-בסיס, 5 מעבר, וסעיפי 5 לכל צינור פני השטח. לאוסף RNA להוסיף 1 מיליליטר מגיב בידוד מסחרי ולדגור על RT במשך 10 דקות. לבצע טיהור RNA על פי הוראות יצרן. השתמש 5-10 מיקרוגרם של רנ&quot;א הכל לדור cDNA. </li><li style=";text-align:right;direction:rtl"> לטיהור חלבונים, להוסיף 0.5 מיליליטר של Ripa הקר תמוגה חיץ (בתוספת מעכבי פרוטאז) לכל 5 חלקים. Sonicate 3 פעמים במחזור של 70%, על קרח. <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> להוסיף דגימות למאגר SDS טעינת עמוד (חיץ Laemmli) ולדגור על 100 מעלות צלזיוס במשך 10 דקות. דגימות בכפוף לעמוד SDS והעברה, ואז לחסום ב5% חלב / PBS עבור שעה 2. ביצוע ניתוח מערבי כתם ואחריו דגירה עם נוגדני KLF4 (1: 500) O / N ב 4 מעלות צלזיוס. </li></ol></li></ol>

<ol>
	<li>Noah, T. K., Donahue, B., Shroyer, N. F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Intestinal+development+and+differentiation.">Intestinal development and differentiation.</a> Exp Cell Res. 317, 2702-2710 (2011).</li><li>Humphries, A., Wright, N. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Colonic+crypt+organization+and+tumorigenesis.">Colonic crypt organization and tumorigenesis.</a> Nat Rev Cancer. 8, 415-424 (2008).</li><li>Weber, C. R., Turner, J. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Inflammatory+bowel+disease:+is+it+really+just+another+break+in+the+wall.">Inflammatory bowel disease: is it really just another break in the wall.</a> Gut. 56, 6-8 (2007).</li><li>Bjerknes, M., Cheng, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Methods+for+the+isolation+of+intact+epithelium+from+the+mouse+intestine.">Methods for the isolation of intact epithelium from the mouse intestine.</a> Anat Rec. 199, 565-574 (1981).</li><li>Sato, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Single+Lgr5+stem+cells+build+crypt-villus+structures+in+vitro+without+a+mesenchymal+niche.">Single Lgr5 stem cells build crypt-villus structures in vitro without a mesenchymal niche.</a> Nature. 459, 262-265 (2009).</li><li>Rand, M. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Calcium+depletion+dissociates+and+activates+heterodimeric+notch+receptors.">Calcium depletion dissociates and activates heterodimeric notch receptors.</a> Mol Cell Biol. 20, 1825-1835 (2000).</li><li>Gjorevski, N., Boghaert, E., Nelson, C. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Regulation+of+Epithelial-Mesenchymal+Transition+by+Transmission+of+Mechanical+Stress+through+Epithelial+Tissues.">Regulation of Epithelial-Mesenchymal Transition by Transmission of Mechanical Stress through Epithelial Tissues.</a> Cancer Microenviron. 5, 29-38 (2012).</li><li>Lechner, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Gene+expression+pattern+of+laser+microdissected+colonic+crypts+of+adenomas+with+low+grade+dysplasia.">Gene expression pattern of laser microdissected colonic crypts of adenomas with low grade dysplasia.</a> Gut. 52, 1148-1153 (2003).</li><li>Reizel, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Colon+stem+cell+and+crypt+dynamics+exposed+by+cell+lineage+reconstruction.">Colon stem cell and crypt dynamics exposed by cell lineage reconstruction.</a> PLoS Genet. 7, e1002192 (2011).</li><li>Kosinski, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Gene+expression+patterns+of+human+colon+tops+and+basal+crypts+and+BMP+antagonists+as+intestinal+stem+cell+niche+factors.">Gene expression patterns of human colon tops and basal crypts and BMP antagonists as intestinal stem cell niche factors.</a> Proc Natl Acad Sci U S A. 104, 15418-15423 (2007).</li><li>Tamura, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Pit+pattern+and+three-dimensional+configuration+of+isolated+crypts+from+the+patients+with+colorectal+neoplasm.">Pit pattern and three-dimensional configuration of isolated crypts from the patients with colorectal neoplasm.</a> J Gastroenterol. 37, 798-806 (2002).</li><li>Geem, D., Medina-Contreras, O., Kim, W., Huang, C. S., Denning, T. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Isolation+and+characterization+of+dendritic+cells+and+macrophages+from+the+mouse+intestine.">Isolation and characterization of dendritic cells and macrophages from the mouse intestine.</a> Journal of visualized experiments : JoVE. , e4040 (2012).</li><li>Laukoetter, M. G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=JAM-A+regulates+permeability+and+inflammation+in+the+intestine+in+vivo.">JAM-A regulates permeability and inflammation in the intestine in vivo.</a> J Exp Med. 204, 3067-3076 (2007).</li><li>Neumann, P. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Gut+commensal+bacteria+and+regional+Wnt+gene+expression+in+the+proximal+versus+distal+colon.">Gut commensal bacteria and regional Wnt gene expression in the proximal versus distal colon.</a> Am J Pathol. 184, 592-599 (2014).</li><li>Capaldo, C. T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Proinflammatory+cytokine-induced+tight+junction+remodeling+through+dynamic+self-assembly+of+claudins.">Proinflammatory cytokine-induced tight junction remodeling through dynamic self-assembly of claudins.</a> Mol Biol Cell. 25, 2710-2719 (2014).</li><li>Wells, J. M., Spence, J. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=How+to+make+an+intestine.">How to make an intestine.</a> Development. 141, 752-760 (2014).</li></ol>

The authors have nothing to disclose

המנגנונים המולקולריים המעורבים בהפצה הגס אפיתל תאים והתמיינות הם הבינו היטב. זה כולל פערים בהבנה של סביבת האיתות התאית של התא בתאי גזע בבסיס מאורות אפיתל במעי הגס שלנו. יש גם עניין גובר בתהליכים שבבסיס בידול האנתרוציט. לדוגמא, עלה הבנה של הבידול בvivo נדרשת כאמת מידה למחקרים שמטרתם לייצר במבחנה מערכות מעיים עיקריות 16. ההליך שלעיל כולל מספר צעדים שדורשים תשומת לב נוספת. ראשית, הסרת הקצוות סביב קטע הרקמה הקפוא (כאמור בסעיף 3.2) נדרש כקצות רקמת התלתל במהלך נתיחה והקפאה. כישלון להעביר תוצאות קצוות אלה הוא אוכלוסייה מעורבת של תאי שטח ובסיס קריפטה. ההרכבה הרקמה באוקטובר לחסום מראש צונן, מפולס היא גם חיונית. Tהפרוטוקול שלו יכול להיות מותאם לאזורים אחרים של מעי גס דיסטלי על ידי שינוי מספר הסעיפים בכל בריכה. לדוגמא, כפי שמוצג באיור 1, אורך קריפטה רירית משתנה בין 150-300 מיקרומטר. לכן, כאשר לומדים את האזור שבין 4 ס&quot;מ 6 סנטימטר מפי הטבעת, מספר סעיפים צריך להיות מוגבר בין 15 ל 30. חשוב לציין, פרוטוקול זה לא מומלץ למעי הגס הפרוקסימלי (7 ס&quot;מ 9 סנטימטרים) בשל קפלים ( plicae obliquae) המשתרעת לתוך הלום שהופך אותו בלתי אפשרי לתאי שטח וקריפטה-בסיס נפרדים על ידי חתך סדרתי. טכניקות חתך סידוריים שימשו ללמוד קריפטה-בסיס ומשטח אוכלוסיות תאי אפיתל בבני אדם. עם זאת, הפרוטוקול שלנו מוסיף צעדים נוספים הנדרשים בשל גודלו הקטן של רקמה עכברית. אנו מציעים כי בפרוטוקול לעיל יאפשר לחקירת קריפטה-בסיס ואוכלוסיית תאי אפיתל פני השטח במערכות עכבר גנטי צייתנית. ואכן, חלקים נקוו yieחלבון LD באיכות גבוהה וניתוח במורד הזרם המתאים RNA. יישומים עתידיים יכולים לכלול המחקר של מסלולי איתות תא או immunoprecipitation הכרומטין. עם זאת, יש לציין כי, כמו כמה מהשיטות חלופיות שתוארו לעיל, וכתוצאה מכך החלקים מכילים תערובת של תאי אפיתל propria lamina וביניים. לסיכום, הפרוטוקול המתואר כאן מספק שיטה מהירה, תשואה גבוהה לניתוח תהליכים מולקולריים באזורים במרחב המובהקים של רירית המעי עכברית.

בטנת אפיתל במעי הגס היא רקמת משובי מאוד, עם תאי גזע תושב חידוש הרקמות כל כמה ימים 1. תהליך זה של התחדשות דורש התחזוקה של תא בתאי גזע שגשוג. במשך זמן, תאי בת פיק החדש יאבדו פוטנציאל השגשוג ונודדים לעבר פני השטח luminal של המעי. ביחד עם הגירה, ותאים להתמיין enterocytes יוצרי מחסום בוגר או תאי גביע ייצור ריר. כישלון של תכנית בידול זה חשב לתרום להתפשר מחסום האפיתל כגון נצפה במחלת מעי דלקתית וסרטן מעי גס 2,3. מחקר מפורט של התהליכים לעיל דורש מתודולוגיות לבידוד אוכלוסיות קריפטה-בסיס ותאי שטח. מספר שיטות קיימות, כל אחד עם יתרונות וחסרונות ייחודיים. שיטות קיימים לבידוד של תאי אפיתל במעי כוללות פרקסוכנים, מרומם רוח וניתוק מכאני, וכתוצאה מכך הבידוד של מאורות כל, גיליונות אפיתל, או תאים בודדים, תלויים ב4,5 תנאי ניסוי. אלה הם שיטות תשואה גבוהות, אך שינויים באיתות אינטר כבר דיווחו בתנאים אלה שלא יכולים לייצג את הסביבה המקומית 6,7. microdissection ללכוד לייזר מאפשר לאיסוף חומר שונה במרחב, אבל משיג תשואת 8,9 מולקולרי נמוכה. ברקמת מעי הגס אנושית, שיטות cryosectioning אופקיים סידוריים פותחו 10. עם זאת, רקמות הריריות עכברית הן להחריד קטנות לניכוס ישיר של טכניקה זו. בבני אדם, באורכי קריפטה מעיים (הרחוקים בין הכוך-הבסיס ותאי שטח) במעי הגס נע בין 100-1,000 ~ מיקרומטר 11. בעכברים, אורכי קריפטה הם בין 50-300 ~ מיקרומטר (ראו איור 1 א). הגודל הקטן של מאורות עכברי מציב אתגר לIsolation של שתי אוכלוסיות תאים אלה תוך שימוש בפרוטוקולים קיימים. עכשיו אנו מתארים בעלות נמוכה, שיטת תשואה גבוהה לבידוד של קריפטה-בסיס ומשטח אוכלוסיית תאי אפיתל במעי הגס רקמה עכברית. רקמה שנקטפו באופן זה עשויה אז להיות מנותח על ידי מספר היישומים במורד הזרם סטנדרטיים, כוללים מכתים immunofluorescence, RT-PCR (תגובת שרשרת זמן-פולימראז ריאל) או מערבי סופג.

<table border="0" cellpadding="0" cellspacing="0">
	<tbody>
		<tr>
			<td>Microtome</td>
			<td>Leica Biosystems, Nussloch Germany</td>
			<td>CM 1510-3</td>
			<td></td>
		</tr>
		<tr>
			<td>MyiQ real time PCR detector</td>
			<td>BioRad</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>LSM 510&#160;</td>
			<td>Carl Zeiss</td>
			<td></td>
			<td>Confocal microscope</td>
		</tr>
		<tr>
			<td>Materials</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>OCT</td>
			<td>Tissue-Tek, Sakura Finetek, Torrance CA</td>
			<td>4583</td>
			<td></td>
		</tr>
		<tr>
			<td>cryo-mold</td>
			<td>Tissue-Tek, Sakura Finetek, Torrance CA</td>
			<td>4557</td>
			<td>25mmx20mmx5mm</td>
		</tr>
		<tr>
			<td>High profile microtome blade</td>
			<td>Leica Biosystems, Nussloch germany</td>
			<td>818</td>
			<td></td>
		</tr>
		<tr>
			<td>GEM industrial blades</td>
			<td>American Safety Razor Blades</td>
			<td>62-0314</td>
			<td></td>
		</tr>
		<tr>
			<td>Sylgard silicon elastomere base</td>
			<td>Dow Corning, Midland MI</td>
			<td>3097358</td>
			<td></td>
		</tr>
		<tr>
			<td>27 1/2 g needle</td>
			<td>Becton-Dickinson, Franklin Lakes, NJ</td>
			<td>305109</td>
			<td>pins for dissection</td>
		</tr>
		<tr>
			<td>TRizol</td>
			<td>Life Technologies</td>
			<td>15596018</td>
			<td></td>
		</tr>
		<tr>
			<td>Rneasy</td>
			<td>Qiagen</td>
			<td>74104</td>
			<td></td>
		</tr>
		<tr>
			<td>DNAse</td>
			<td>Qiagen</td>
			<td>79254</td>
			<td></td>
		</tr>
		<tr>
			<td>Reagents</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Antibody ZO-1</td>
			<td>Invitrogen&#160;</td>
			<td>187430</td>
			<td></td>
		</tr>
		<tr>
			<td>Antibody KLF4</td>
			<td>Cell Signaling</td>
			<td>4038S</td>
			<td></td>
		</tr>
		<tr>
			<td>Antibody mGAPDH</td>
			<td>Sigma</td>
			<td>G8795</td>
			<td></td>
		</tr>
		<tr>
			<td>Antibody Secondary Alexa conjugate</td>
			<td>Invitrogen</td>
			<td>A11034</td>
			<td>488 anti-rabbit</td>
		</tr>
		<tr>
			<td>Antibody Secondary HRP conjugate</td>
			<td>Jackson</td>
			<td>111/115-001-003</td>
			<td>rabbit/mouse&#160;</td>
		</tr>
		<tr>
			<td>Topro-3</td>
			<td>Invitrogen</td>
			<td>T3605</td>
			<td></td>
		</tr>
		<tr>
			<td>HANKs balanced salt buffer</td>
			<td>Life Technologies</td>
			<td>14025092</td>
			<td></td>
		</tr>
		<tr>
			<td>RIPA lysis buffer</td>
			<td></td>
			<td></td>
			<td>50mM Tris-HCl pH 7.4 150mM NaCl 1% NP40 0.25% Na-deoxycholate</td>
		</tr>
		<tr>
			<td>PCR Primers</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>primer TBP 3&#39;</td>
			<td></td>
			<td></td>
			<td>GGAATTGTACCGCAGCTTCAAA</td>
		</tr>
		<tr>
			<td>primer TBP 5&#39;</td>
			<td></td>
			<td></td>
			<td>GATGACTGCAGCAAATCGCTT</td>
		</tr>
		<tr>
			<td>primer KLF4 3&#39;</td>
			<td></td>
			<td></td>
			<td>TGTGACTATGCAGGCTGTGGCAAA</td>
		</tr>
		<tr>
			<td>primer KLF4 5&#39;</td>
			<td></td>
			<td></td>
			<td>ACAGTGGTAAGGTTTCTCGCCTGT</td>
		</tr>
	</tbody>
</table>

cryosectioning method for microdissection of murine colonic mucosa

The colonic mucosal tissue provides a vital barrier to luminal antigens. This barrier is composed of a monolayer of simple columnar epithelial cells. The colonic epithelium is dynamically turned over and epithelial cells are generated in the stem cell containing crypts of Lieberk&#252;hn. Progenitor cells produced in the crypt-bases migrate toward the luminal surface, undergoing a process of cellular differentiation before being shed into the gut lumen. In order to study these processes at the molecular level, we have developed a simple method for the microdissection of two spatially distinct regions of the colonic mucosa; the proliferative crypt zone, and the differentiated surface epithelial cells. Our objective is to isolate specific crypt and surface epithelial cell populations from mouse colonic mucosa for the isolation of RNA and protein.

קטעי רקמת מעי הגס עובדו להערכה היסטולוגית ו- H &amp; E מכתים 13. צפה בחתך מסורתי של הרירית נראה באיור 2 א. אזורים בסל מכילים פנימית וחיצוני muscularis, מורכב בעיקר מmuscularis המעגלי. ימשיך לכיוון הלום, רירית muscularis ניכרה בסמוך לתאי האפיתל קריפטה-בסיס, תאי מעבר נמצאים באמצע של הרקמה, ובסופו אוכלוסיות תאי שטח, להתמודד לומן המעי. שיטת חתך הסידורי המתוארת כאן שומרת על נטייה כזו שmuscularis האורך והחוזר נתקל לראשונה (איור 2), ואחריו את רירית muscularis (איור 2 ג). שים לב למראה של תאי ביניים שאינם שריר בחלק השמאלי העליונה של התמונה. לניתוח במורד הזרם מתואר להלן, סעיפי שריר מבוטלים. הסעיפים הבאים מכילים תאי אפיתל ורקמת ביניים (propria lamina), החל בתאי קריפטה-הבסיס (איור 2 ד). שים לב להעדרו של לומן מרכזי ברוב מאורות, המופיעים כהה יותר בשל הגרעינים הצפופים. שכבות אלה מכילים תא השגשוג. תאי המעבר מופיעים כצפופים בלוטות עם לומן בולט מרכזי (2E איור). לבסוף, יש לי אוכלוסיות תאי שטח מבנה לא סדיר, עם אזורים של monolayer אפיתל נצפה en פנים (איור 2F). סעיפים סידוריים כפי שתואר לעיל עשויים גם להיות מעובד לתיוג immunofluorescence ומיקרוסקופיה confocal (כפי שמתוארים כאן 14). איור 2G תערוכות מאורות מבודדים הקבועים וpermeabilized במתנול 100% ולאחר מכן מוכתמים לגרעינים (כחול) וחלבון צומת תאי תאי Zonula Occludens 1 (הסתדרות ציונית-1, ירוקה). בכיוון חתך המסורתי, תא קריפטה ומשטח ניתן לצפות בו זמנית (איור 2G </stronז&gt;). שים לב שקווי כתם junctional ZO-1 לומן של קריפטה המעי הגס. בטנת Z0-1 זה של לומן גם ניתן לראות בדוגמאות מחולקים סידוריים של אוכלוסיות תאי מעבר, במרכז של הבלוטות עגולות (איור 2G). כתם ZO-1 משופר נראה באוכלוסיות תאי שטח (איור ט 2 וי). גורמי בידול כמה ידועים להתבטא באופנת spatiotemporal לאורך ציר קריפטה-קרקע. זה כולל את הגורם כמו-Kruppel גורם שעתוק 4 (KLF4), אשר ידוע להיות מועשרים באוכלוסיות תאי שטח. שימוש בשיטות מסורתיות חתך, KLF4 נמצא בגרעינים של לומן מול אוכלוסיות תאי שטח (איור 2K). לפיכך, אנו מעריכים כי KLF4 mRNA יתבטא בעיקר באוכלוסיות תאי שטח. כדי לבדוק זאת, סעיפים סידוריים נאספו וקובצו לדגימות פני השטח, וכוך-בסיס מעבר. Subsequently, RNA היה לקצור באמצעות מיצוי Trizol סטנדרטי, עם טיהור נוספת על ידי טור RNeasy וטיפול DNAse. RNA נאסף מסעיפים 5 רצופים ונקווה, שהניבו בין 5-10 מיקרוגרם של RNA הכולל לדגימה. דגימות אלה אז היו נתונים בזמן אמת חצי כמותית PCR לשני KLF4 וגן התייחסות, חלבון TATA תיבה מחייבת 1 (TBP-1) (איור 2L) 14. כפי שניתן לראות באיור 2L, לאחר הנורמליזציה לTBP-1, תאי שטח נמצאו להביע עד 8 ​​פעמים mRNA KLF4 שבאו לידי ביטוי בתאי קריפטה. כמו כן, רמות חלבון KLF4 נמצאו להציג רגולציה המרחבי לאורך ציר קריפטה-פני השטח. סעיפים סידוריים היו נקווים כמתואר לעיל ולאחר מכן מודגרות במאגר תמוגה במשך 20 דקות ב 4 מעלות צלזיוס. זה הניב בין 200-250 מיקרוגרם של חלבון לכל מדגם. דוגמאות אז היו נתונים ניתוח על ידי SDS-עמוד (איור 2M) 15. כפי שניתן לראות באיור 2M, עמ &#39;KLF4רמות rotein הן דרמטית גבוהות יותר באוכלוסיות תאי שטח. הממצאים לעיל מדגימים את היכולת של פרוטוקול זה לבודד את הכמויות גדולות של פני השטח ותאי אפיתל קריפטה מרירית המעי עכברית. <img alt="איור 1" src="/files/ftp_upload/53112/53112fig1.jpg" /> איור 1: (א) רירית מראה סכמטי עכברית מעי הגס ושכבות שרירים חיצוניות. השיטה שלנו שואפת לאסוף אוכלוסיות תאי תא השטח וקריפטה-בסיס דיסקרטיים על ידי cryosectioning הסידורי (10 מיקרומטר כל אחד). שכבות השרירים חיצוניות מבוטלים. גובה (B) קריפטה משתנה לאורכו של המעי הגס (מרחק בין שכבות קריפטה-בסיס ומשטח). נקודות הנתונים מצביעות על מדידות קריפטה בודדות וסימנים מצביעים על משכפל ביולוגי (n = 4). מגזרים (C) קולון נאספו, נחצה, והצמידו על צלחת סיליקון לנתח. רקמה (ד) segment כ 3 סנטימטר מהטבעת נלחץ בין לסכיני גילוח וקפוא בקרח יבש. רקמות (E) אז רכובים על בלוק אוקטובר-מפולס מראש. (F) cryosections יוסרו ובחינה חזותית. <img alt="איור 2" src="/files/ftp_upload/53112/53112fig2.jpg" /> איור 2:. נציגי נתונים () רקמת המעי הגס מוכתמת Hematoxylin-Eosin בחתך מראה את muscularis העגול (סנטימטר), רירית muscularis (מ&quot;מ), תאי קריפטה-בסיס, תאי מעבר, ותאי שטח. (ב - ג) שכבות שרירים מעי הגס. (ד) תאי קריפטה-בסיס. שים לב להעדרו של לומן מרכזי. (ה) תאים מעבר. (F) תאי שטח. הכתמה (G) Immunofluorescence של מאורות מעי הגס מבודדים. ZO-1 (ירוק) וגרעינים (כחולים) הם נצפו בחתך. (HI) ZO-1 וצביעה בגרעין תאי מעבר ומשטח. תצוגה מוגדלת של מכתים ZO-1 (J). (K) KLF4 (ירוק) מועשר באוכלוסיות תאי שטח. בזמן אמת הערכת PCR של רמות KLF4 mRNA בין שלושה התאים (L). ניתוח כתם מערבי של רמות חלבון KLF4 באוכלוסיות תאים אלה (M).

Watch this Scientific Journal Video about Cryosectioning Method for Microdissection of Murine Colonic Mucosa at JoVE.com

Cryosectioning Method for Microdissection of Murine Colonic Mucosa

Here we describe a simple method for the isolation of spatially distinct murine colonic epithelial surface cells from the underlying crypt-base cells.

Cryosectioning שיטה לMicrodissection של Murine גס רירית

The colonic mucosal tissue provides a vital barrier to luminal antigens. This barrier is composed of a monolayer of simple columnar epithelial cells. The ...

cryosectioning-method-for-microdissection-of-murine-colonic-mucosa

Research

JoVE Journal

Biology

17.1K Views.  Emory University, Atlanta, Georgia. Here we describe a simple method for the isolation of spatially distinct murine colonic epithelial surface cells from the underlying crypt-base cells.

Video: Cryosectioning Method for Microdissection of Murine Colonic Mucosa

Flash Freezing and Cryosectioning E12.5 Mouse Brain

Demonstrated in this video are the techniques for flash freezing and sectioning embryonic brain tissue from mouse. Useful tips for using the cryostat are given, including troubleshooting methods that can be used while cutting to ensure that the resultant tissues sections are free of cracks and other distortions.

פלאש מקפיא Cryosectioning E12.5 מוח עכבר

Laser Capture Microdissection of Mammalian Tissue

Laser capture microscopy, also known as laser microdissection (LMD), enables the user to isolate small numbers of cells or tissues from frozen or formalin-fixed, paraffin-embedded tissue sections. LMD techniques rely on a thermo labile membrane placed either on top of, or underneath, the tissue section. In one method, focused laser energy is used to melt the membrane onto the underlying cells, which can then be lifted out of the tissue section. In the other, the laser energy vaporizes the foil along a path "drawn" on the tissue, allowing the selected cells to fall into a collection device. Each technique allows the selection of cells with a minimum resolution of several microns. DNA, RNA, protein, and lipid samples may be isolated and analyzed from micro-dissected samples. In this video, we demonstrate the use of the Leica AS-LMD laser microdissection instrument in seven segments, including an introduction to the principles of LMD, initializing the instrument for use, general considerations for sample preparation, mounting the specimen and setting up capture tubes, aligning the microscope, adjusting the capture controls, and capturing tissue specimens. Laser-capture micro-dissection enables the investigator to isolate samples of pure cell populations as small as a few cell-equivalents. This allows the analysis of cells of interest that are free of neighboring contaminants, which may confound experimental results.

לייזר Microdissection לכידה של רקמות היונקים

Laser capture microscopy, also known as laser microdissection (LMD), enables the user to isolate small numbers of cells or tissues from frozen or ...

Microdissection of Zebrafish Embryonic Eye Tissues

Zebrafish is a popular animal model for research on eye development because of its rapid ex utero development and good fecundity. By 3 days post fertilization (dpf), the larvae will show the first visual response. Many genes have been identified to control a proper eye development, but we are far from a complete understanding of the underlying genetic architecture. Whole genome gene expression profiling is a useful tool to elucidate genetic regulatory network for eye development. However, the small size of the embryonic eye in zebrafish makes it challenging to obtain intact and pure eye tissues for expression analysis. For example, the anterior-posterior length of the eye between day 2 and 3 is only approximately 200-300 &mu;m, while the diameter of the lens is less 100 &mu;m. Also, the retinal pigment epithelium (RPE) underlying the retina is just a single-layer epithelium. While gene expression profiles can be obtained from the whole embryo, they do not accurately represent the expression of these tissues. Therefore pure tissue must be obtained for a successful gene expression profiling of eye development. To address this issue, we have developed an approach to microdissect intact retina and retina with RPE attached from 1-3 dpf, which cover major stages of eye morphogenesis. All procedures can be done with fine forceps and general laboratory supplies under standard stereomicroscopes. For retinal dissection, the single-layer RPE is removed and peeled off by brushing action and the preferential adherence of the RPE remnants to the surface of the culture plate for dissection. For RPE-attached retinal dissection, the adherence of RPE to the dissection plate is removed before the dissection so that the RPE can be completely preserved with the retina. A careful lifting action of this tissue can efficiently separate the presumptive choroid and sclera. The lens can be removed in both cases by a chemically etched tungsten needle. In short, our approach can obtain intact eye tissues and has been successfully utilized to study tissue-specific expression profiles of zebrafish retina1, 2 and retinal pigment epithelium3.

This article describes an approach to microdissect zebrafish retinas with and without retinal pigment epithelium attached, from one to three days postfertilization embryos.

Microdissection של רקמות דג הזברה העין עובריים

Zebrafish is a popular animal model for research on eye development because of its rapid ex utero development and good fecundity. By 3 days post ...

Microdissection of Black Widow Spider Silk-producing Glands

Modern spiders spin high-performance silk fibers with a broad range of biological functions, including locomotion, prey capture and protection of developing offspring 1,2. Spiders accomplish these tasks by spinning several distinct fiber types that have diverse mechanical properties. Such specialization of fiber types has occurred through the evolution of different silk-producing glands, which function as small biofactories. These biofactories manufacture and store large quantities of silk proteins for fiber production. Through a complex series of biochemical events, these silk proteins are converted from a liquid into a solid material upon extrusion.
Mechanical studies have demonstrated that spider silks are stronger than high-tensile steel 3. Analyses to understand the relationship between the structure and function of spider silk threads have revealed that spider silk consists largely of proteins, or fibroins, that have block repeats within their protein sequences 4. Common molecular signatures that contribute to the incredible tensile strength and extensibility of spider silks are being unraveled through the analyses of translated silk cDNAs. Given the extraordinary material properties of spider silks, research labs across the globe are racing to understand and mimic the spinning process to produce synthetic silk fibers for commercial, military and industrial applications. One of the main challenges to spinning artificial spider silk in the research lab involves a complete understanding of the biochemical processes that occur during extrusion of the fibers from the silk-producing glands.
Here we present a method for the isolation of the seven different silk-producing glands from the cobweaving black widow spider, which includes the major and minor ampullate glands [manufactures dragline and scaffolding silk] 5,6, tubuliform [synthesizes egg case silk] 7,8, flagelliform [unknown function in cob-weavers], aggregate [makes glue silk], aciniform [synthesizes prey wrapping and egg case threads] 9 and pyriform [produces attachment disc silk] 10. This approach is based upon anesthetizing the spider with carbon dioxide gas, subsequent separation of the cephalothorax from the abdomen, and microdissection of the abdomen to obtain the silk-producing glands. Following the separation of the different silk-producing glands, these tissues can be used to retrieve different macromolecules for distinct biochemical analyses, including quantitative real-time PCR, northern- and western blotting, mass spectrometry (MS or MS/MS) analyses to identify new silk protein sequences, search for proteins that participate in the silk assembly pathway, or use the intact tissue for cell culture or histological experiments.

Here we describe an efficient strategy to remove the silk-producing glands from the abdomen of female black widow spiders. This procedure allows the rapid isolation of the seven distinct silk-producing glands in a highly purified fashion, an important process for investigators studying spider silk production and fiber assembly.

Microdissection של האלמנה השחורה עכביש המשי לייצור בלוטות

Modern spiders spin high-performance silk fibers with a broad range of biological functions, including locomotion, prey capture and protection of ...

A Novel Method for the Culture and Polarized Stimulation of Human Intestinal Mucosa Explants

Few models currently exist to realistically simulate the complex human intestine's micro-environment, where a variety of interactions take place. Proper homeostasis directly depends on these interactions, as they shape an entire immunological response inducing tolerance against food antigens while at the same time mounting effective immune responses against pathogenic microbes accidentally ingested with food.
Intestinal homeostasis is preserved also through various complex interactions between the microbiota (including food-associated beneficial bacterial strains) and the host, that regulate the attachment/degradation of mucus, the production of antimicrobial peptides by the epithelial barrier, and the "education" of epithelial cells' that controls the tolerogenic or immunogenic phenotype of unique, gut-resident lymphoid cells' populations. These interactions have been so far very difficult to reproduce with in vitro assays using either cultured cell lines or peripheral blood mononuclear cells. In addition, mouse models differ substantially in components of the intestinal mucosa (mucus layer organization, commensal bacteria community) with respect to the human gut. Thus, studies of a variety of treatments to be brought in the clinics for important stress-related or pathological conditions such as irritable bowel syndrome, inflammatory bowel disease or colorectal cancer have been difficult to carry out.
To address these issues, we developed a novel system that enables us to stimulate explants of human intestinal mucosa that retain their in situ conditioning by the host microbiota and immune response, in a polarized fashion. Polarized apical stimulation is of great importance for the outcome of the elicited immune response. It has been repeatedly shown that the same stimuli can produce completely different responses when they bypass the apical face of the intestinal epithelium, stimulating epithelial cells basolaterally or coming into direct contact with lamina propria components, switching the phenotype from tolerogenic to immunogenic and causing unnecessary and excessive inflammation in the area.
We achieved polarized stimulation by gluing a cave cylinder which delimited the area of stimulation on the apical face of the mucosa as will be described in the protocol. We used this model to examine, among others, differential effects of three different Lactobacilli strains. We show that this model system is very powerful to assess the immunomodulatory properties of probiotics in healthy and disease conditions.

We introduce a novel method for the maintenance of human intestinal mucosa in culture and monitoring of the response to various types of stimuli over at least 24 hrs. With our method, the polarity of the tissue is maintained, allowing for a physiological stimulation via the apical route.

שיטה חדשה לתרבות והמקוטבת גירוי של רירית המעי Explants אדם

Few models currently exist to realistically simulate the complex human intestine's micro-environment, where a variety of interactions take place. Proper ...

Cryosectioning Yeast Communities for Examining Fluorescence Patterns

Microbes typically live in communities. The spatial organization of cells within a community is believed to impact the survival and function of the community1. Optical sectioning techniques, including confocal and two-photon microscopy, have proven useful for observing spatial organization of bacterial and archaeal communities2,3. A combination of confocal imaging and physical sectioning of yeast colonies has revealed internal organization of cells4. However, direct optical sectioning using confocal or two-photon microscopy has been only able to reach a few cell layers deep into yeast colonies. This limitation is likely because of strong scattering of light from yeast cells4.
Here, we present a method based on fixing and cryosectioning to obtain spatial distribution of fluorescent cells within Saccharomyces cerevisiae communities. We use methanol as the fixative agent to preserve the spatial distribution of cells. Fixed communities are infiltrated with OCT compound, frozen, and cryosectioned in a cryostat. Fluorescence imaging of the sections reveals the internal organization of fluorescent cells within the community.
Examples of yeast communities consisting of strains expressing red and green fluorescent proteins demonstrate the potentials of the cryosectioning method to reveal the spatial distribution of fluorescent cells as well as that of gene expression within yeast colonies2,3. Even though our focus has been on Saccharomyces cerevisiae communities, the same method can potentially be applied to examine other microbial communities.

We present a protocol for freezing and cryosectioning yeast communities to observe internal patterns of fluorescent cells. The method relies on methanol-fixing and OCT-embedding to preserve the spatial distribution of cells without inactivating fluorescent proteins within a community.

Cryosectioning קהילות שמרים לבחינת דפוסי פלואורסצנטי

Microbes typically live  in communities. The spatial organization  of cells within a community is believed to impact the survival and function of the  ...

Laser-assisted Microdissection (LAM) as a Tool for Transcriptional Profiling of Individual Cell Types

The understanding of developmental processes at the molecular level requires insights into transcriptional regulation, and thus the transcriptome, at the level of individual cell types. While the methods described here are generally applicable to a wide range of species and cell types, our research focuses on plant reproduction. Plant cultivation and seed production is of crucial importance for human and animal nutrition. A detailed understanding of the regulatory networks that govern the formation of the reproductive lineage (germline) and ultimately of seeds is a precondition for the targeted manipulation of plant reproduction. In particular, the engineering of apomixis (asexual reproduction through seeds) into crop plants promises great improvements, as it leads to the formation of clonal seeds that are genetically identical to the mother plant. Consequently, the cell types of the female germline are of major importance for the understanding and engineering of apomixis. However, as the corresponding cells are deeply embedded within the floral tissues, they are very difficult to access for experimental analyses, including cell-type specific transcriptomics. To overcome this limitation, sections of individual cells can be isolated by laser-assisted microdissection (LAM). While LAM in combination with transcriptional profiling allows the identification of genes and pathways active in any cell type with high specificity, establishing a suitable protocol can be challenging. Specifically, the quality of RNA obtained after LAM can be compromised, especially when small, single cells are targeted. To circumvent this problem, we have established a workflow for LAM that reproducibly results in high RNA quality that is well suitable for transcriptomics, as exemplified here by the isolation of cells of the female germline in apomictic Boechera. In this protocol, procedures are described for tissue preparation and LAM, also with regard to RNA extraction and quality control.

Laser-assisted Microdissection LAM as a Tool for Transcriptional Profiling of Individual Cell Types

Here we present a protocol for laser-assisted microdissection of specific plant cell types for transcriptional profiling. While the protocol is suitable for different species and cell types, the focus is on highly inaccessible cells of the female germline important for sexual and apomictic reproduction in the crucifer genus Boechera.

Microdissection לייזר בסיוע (LAM) ככלי פרופיל תעתיק של סוגי תאים בודדים

The understanding of developmental processes at the molecular level requires insights into transcriptional regulation, and thus the transcriptome, at the ...

Cryosectioning of Contiguous Regions of a Single Mouse Skeletal Muscle for Gene Expression and Histological Analyses

With this method, consecutive cryosections are collected to enable both microscopy applications for tissue histology and enrichment of RNA for gene expression using adjacent regions from a single mouse skeletal muscle. Typically, it is challenging to achieve adequate homogenization of small skeletal muscle samples because buffer volumes may be too low for efficient grinding applications, yet without sufficient mechanical disruption, the dense tissue architecture of muscle limits penetration of buffer reagents, ultimately causing low RNA yield. By following the protocol reported here, 30 &#956;m sections are collected and pooled allowing cryosectioning and subsequent needle homogenization to mechanically disrupt the muscle, increasing the surface area exposed for buffer penetration. The primary limitations of the technique are that it requires a cryostat, and it is relatively low throughput. However, high-quality RNA can be obtained from small samples of pooled muscle cryosections, making this method accessible for many different skeletal muscles and other tissues. Furthermore, this technique enables matched analyses (e.g., tissue histopathology and gene expression) from adjacent regions of a single skeletal muscle so that measurements can be directly compared across applications to reduce experimental uncertainty and to reduce replicative animal experiments necessary to source a small tissue for multiple applications.

Consecutive cryo-sections are collected to enable histological applications and enrichment of RNA for gene expression measurements using adjacent regions from a single mouse skeletal muscle. High-quality RNA is obtained from 20 - 30 mg of pooled cryosections and measurements are directly compared across applications.

Cryosectioning של רציף אזורים של שרירי שלד עכבר אחת על ביטוי גנים ועל ניתוח היסטולוגית

With this method, consecutive cryosections are collected to enable both microscopy applications for tissue histology and enrichment of RNA for gene ...

A Morphometric and Cellular Analysis Method for the Murine Mandibular Condyle

The temporomandibular joint (TMJ) has the capacity to adapt to external stimuli, and loading changes can affect the position of condyles, as well as the structural and cellular components of the mandibular condylar cartilage (MCC). This manuscript describes methods for analyzing these changes and a method for altering the loading of the TMJ in mice (i.e., compressive static TMJ loading). The structural evaluation illustrated here is a simple morphometric approach that uses the Digimizer software and is performed in radiographs of small bones. In addition, the analysis of cellular changes leading to alterations in collagen expression, bone remodeling, cell division, and proteoglycan distribution in the MCC is described. The quantification of these changes in histological sections - by counting the positive fluorescent pixels using image software and measuring the distance mapping and stained area with Digimizer - is also demonstrated. The methods shown here are not limited to the murine TMJ, but could be used on additional bones of small experimental animals and in other regions of endochondral ossification.

This manuscript presents methods for analyzing morphometric and cellular changes within the mandibular condyle of rodents.

Morphometric ושיטת ניתוח הסלולר עבור המפרקתי הנמוך מאתר הלסת

The temporomandibular joint (TMJ) has the capacity to adapt to external stimuli, and loading changes can affect the position of condyles, as well as the ...

Laser Capture Microdissection of Highly Pure Trabecular Meshwork from Mouse Eyes for Gene Expression Analysis

Laser capture microdissection (LCM) has allowed gene expression analysis of single cells and enriched cell populations in tissue sections. LCM is a great tool for the study of the molecular mechanisms underlying cell differentiation and the development and progression of various diseases, including glaucoma. Glaucoma, which comprises a family of progressive optic neuropathies, is the most common cause of irreversible blindness worldwide. Structural changes and damage within the trabecular meshwork (TM) can result in increased intraocular pressure (IOP), which is a major risk factor for developing glaucoma. However, the precise molecular mechanisms involved are still poorly understood. The ability to perform gene expression analysis will be crucial in obtaining further insights into the function of these cells and its role in the regulation of IOP and glaucoma development. To achieve this, a reproducible method for isolating highly enriched TM from frozen sections of mouse eyes and a method for downstream gene expression analysis, such as RT-qPCR and RNA-Seq is needed. The method described herein is developed to isolate highly pure TM from mouse eyes for downstream digital PCR and microarray analysis. In addition, this technique can be easily adapted for the isolation of other highly enriched ocular cells and cell compartments that have been difficult to isolate from mouse eyes. The combination of LCM and RNA analysis can contribute to a more comprehensive understanding of the cellular events underlying glaucoma.

Here, we describe a protocol for a reproducible laser capture microdissection (LCM) for isolating trabecular meshwork (TM) for downstream RNA analysis. The ability to analyze changes in gene expression in the TM will help in understanding the underlying molecular mechanisms of TM-related ocular diseases.

לייזר Microdissection לכידה של מאוד טהור Meshwork Trabecular מעיני העכבר עבור ניתוח ביטוי גנטי

Laser capture microdissection (LCM) has allowed gene expression analysis of single cells and enriched cell populations in tissue sections. LCM is a great ...