Supported by National Institutes of Health (DK55679, and DK59888 to A.N.). Emory University&#160;Integrated Cellular Imaging Microscopy Core of the Winship Cancer&#160;Institute comprehensive cancer center grant, P30CA138292, and the Crohn's and Colitis Foundation of America Career Development award to C.T.C. and Fellowship Award to A.E.F.

Experiências utilizados ratinhos C57BL / 6 entre 10 e 12 semanas de idade. Todos os procedimentos que utilizam animais foram revistos e aprovados pelo Comitê de Emory University Animal Care Institucional e Use e foram realizadas de acordo com Institutos Nacionais de Saúde critérios. 1. Setup Experimental <ol><li> Configurar o Criostato <ol><li> Equilibrar criostato a -20 ° C, incluindo a lâmina micrótomo e mandris (ter muito cuidado em torno da lâmina!). </li><li> Encha uma cryomold vazio com outubro (Optimal composto de corte de temperatura) e equilibrar a -20 ° C (~ 30 min). Remova a outubro congelado do molde e corrigi-lo no mandril com líquido outubro Coloque o bloco / mandril no braço micrótomo e permitir que o OCT para definir durante 10 min. </li><li> Defina o criostato a 10 um por seção e raspar o bloco de outubro até que seja plana. Apoiar o braço microtome longe da lâmina por vários centímetros. Neste ponto não se ajustar a lâmina ou mandril para o restante da experiment. </li></ol></li><li> Preparar as lâminas de barbear: Prepare duas lâminas de barbear por amostra. Usando um arquivo de metal, maçante a borda sharped de lâminas. Em seguida, retire a flange de alumínio com uma pinça. </li><li> Pré-descontrair um pirex ou outra superfície plana em gelo seco. </li><li> Prepare um prato de dissecação com 15/10 pinos de dissecação. De 10 cm cultura de tecidos de 50% cheio com silicone será suficiente. Adicionar 5 ml de tampão de Hanks à temperatura ambiente. </li></ol> 2. Dissecção da Distal Colonic Tissue <ol><li> Camundongos lugar em uma câmara selada e euthanize ratos por inalação de isoflurano e deslocamento cervical, em seguida, pulverizar etanol a 70% para o abdômen e tórax 12. </li><li> Faça uma pequena incisão na pele do abdómen com uma tesoura e, em seguida, fazer uma incisão para expor a cavidade peritoneal. Procedimentos semelhantes podem ser encontradas aqui descrita 12. </li><li> Cortar o intestino grosso à beira anal e provocar uma separação do mesentério até que o cólon é gratuito. </li><li> Extirpar um cólon distalsegmento entre 0 e 6 cm do ânus. Aqui, a profundidade das criptas é ~ 150 uM (ver Figura 1B). Corte aberto do cólon longitudinalmente com uma tesoura e remova o conteúdo fecal. </li><li> Pin o tecido para o prato de dissecação com a superfície da mucosa voltada para cima. Esticar o tecido utilizando pinos de dissecação sobre um prato de silício em tampão de Hanks e deixar em repouso durante 10 min à temperatura ambiente (Figura 1C). Isto remove dobras do tecido e permite que as camadas de músculos para relaxar. </li></ol> 3. Monte Tissue na Criostato para Seccionamento <ol><li> Deslize uma lâmina de barbear sob a seção desejada do tecido e, em seguida, despeje o tampão Hanks. Adicionar outra lâmina de barbear para o topo, tornando uma sanduíche. Corte o segmento de tecidos e remover os pinos. Transferir o sanduíche de lâminas de barbear / tecido para gelo seco. Permitir que o tecido para congelar (5-10 min, A Figura 1D). </li><li> Pegar a navalha / sanduíche de tecido e deixe-o aquecer ligeiramente, colocando um dedo no topo blade (lado da mucosa para cima. Este orienta o tecido de modo que as camadas basais musculares são seccionados em primeiro lugar.). Separa-se a sanduíche de corte e em volta das extremidades do segmento de tecido. Cortar um segmento de tecido de aproximadamente, 0,5 centímetros x 1 cm. Áreas de ponta têm uma tendência a enrolar, fazendo com que os cortes seriados para conter muitas camadas de tecido. Note-se que o excesso de corte é melhor do que under-corte, assim errar do lado da cautela. </li><li> Permitir que o tecido se aquecer até que o gelo no topo do tecido começa a derreter. Neste ponto, de forma rápida e cuidadosamente pressionar o tecido para dentro do bloco de outubro no criostato. </li><li> Remova a lâmina, colocando um dedo sobre a amostra. A transferência de calor vai permitir que você remover a lâmina, sem perturbar o tecido. </li><li> Brasão do tecido com outubro e equilibrar durante 5 min. Cortar em secções de 10 um (Figura 1E, F). Inspecione visualmente as seções até que as criptas são vistos. Seções lugar em um tubos de 1,5 ml ou em slides. </li><li> Para a análise de mRNA ou proteína, lugar tele amostras em tubos com 5 cripta-base, 5 de transição, e 5 secções de superfície por tubo. Para recolha de RNA adicionar 1 ml de reagente de isolamento comercial e incubar à TA durante 10 min. Realizar a purificação de ARN de acordo com as instruções do fabricante. Use 5-10 ug de ARN total para a produção de ADNc. </li><li> Para a purificação de proteínas, adicionar 0,5 ml de tampão de lise RIPA frio (mais inibidores de protease) por cinco secções. Sonicar três vezes a um ciclo de 70%, em gelo. <ol><li> Adicionar tampão de amostras de SDS PAGE de carregamento (tampão de Laemmli) e incuba-se a 100 ° C durante 10 min. Amostras sujeitas a SDS PAGE e transferência, em seguida, bloquear em 5% de leite / PBS durante 2 horas. Realizar a análise Western blot, seguido por incubação com anticorpos Klf4 (1: 500) O / N a 4 ° C. </li></ol></li></ol>

<ol>
	<li>Noah, T. K., Donahue, B., Shroyer, N. F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Intestinal+development+and+differentiation.">Intestinal development and differentiation.</a> Exp Cell Res. 317, 2702-2710 (2011).</li><li>Humphries, A., Wright, N. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Colonic+crypt+organization+and+tumorigenesis.">Colonic crypt organization and tumorigenesis.</a> Nat Rev Cancer. 8, 415-424 (2008).</li><li>Weber, C. R., Turner, J. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Inflammatory+bowel+disease:+is+it+really+just+another+break+in+the+wall.">Inflammatory bowel disease: is it really just another break in the wall.</a> Gut. 56, 6-8 (2007).</li><li>Bjerknes, M., Cheng, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Methods+for+the+isolation+of+intact+epithelium+from+the+mouse+intestine.">Methods for the isolation of intact epithelium from the mouse intestine.</a> Anat Rec. 199, 565-574 (1981).</li><li>Sato, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Single+Lgr5+stem+cells+build+crypt-villus+structures+in+vitro+without+a+mesenchymal+niche.">Single Lgr5 stem cells build crypt-villus structures in vitro without a mesenchymal niche.</a> Nature. 459, 262-265 (2009).</li><li>Rand, M. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Calcium+depletion+dissociates+and+activates+heterodimeric+notch+receptors.">Calcium depletion dissociates and activates heterodimeric notch receptors.</a> Mol Cell Biol. 20, 1825-1835 (2000).</li><li>Gjorevski, N., Boghaert, E., Nelson, C. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Regulation+of+Epithelial-Mesenchymal+Transition+by+Transmission+of+Mechanical+Stress+through+Epithelial+Tissues.">Regulation of Epithelial-Mesenchymal Transition by Transmission of Mechanical Stress through Epithelial Tissues.</a> Cancer Microenviron. 5, 29-38 (2012).</li><li>Lechner, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Gene+expression+pattern+of+laser+microdissected+colonic+crypts+of+adenomas+with+low+grade+dysplasia.">Gene expression pattern of laser microdissected colonic crypts of adenomas with low grade dysplasia.</a> Gut. 52, 1148-1153 (2003).</li><li>Reizel, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Colon+stem+cell+and+crypt+dynamics+exposed+by+cell+lineage+reconstruction.">Colon stem cell and crypt dynamics exposed by cell lineage reconstruction.</a> PLoS Genet. 7, e1002192 (2011).</li><li>Kosinski, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Gene+expression+patterns+of+human+colon+tops+and+basal+crypts+and+BMP+antagonists+as+intestinal+stem+cell+niche+factors.">Gene expression patterns of human colon tops and basal crypts and BMP antagonists as intestinal stem cell niche factors.</a> Proc Natl Acad Sci U S A. 104, 15418-15423 (2007).</li><li>Tamura, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Pit+pattern+and+three-dimensional+configuration+of+isolated+crypts+from+the+patients+with+colorectal+neoplasm.">Pit pattern and three-dimensional configuration of isolated crypts from the patients with colorectal neoplasm.</a> J Gastroenterol. 37, 798-806 (2002).</li><li>Geem, D., Medina-Contreras, O., Kim, W., Huang, C. S., Denning, T. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Isolation+and+characterization+of+dendritic+cells+and+macrophages+from+the+mouse+intestine.">Isolation and characterization of dendritic cells and macrophages from the mouse intestine.</a> Journal of visualized experiments : JoVE. , e4040 (2012).</li><li>Laukoetter, M. G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=JAM-A+regulates+permeability+and+inflammation+in+the+intestine+in+vivo.">JAM-A regulates permeability and inflammation in the intestine in vivo.</a> J Exp Med. 204, 3067-3076 (2007).</li><li>Neumann, P. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Gut+commensal+bacteria+and+regional+Wnt+gene+expression+in+the+proximal+versus+distal+colon.">Gut commensal bacteria and regional Wnt gene expression in the proximal versus distal colon.</a> Am J Pathol. 184, 592-599 (2014).</li><li>Capaldo, C. T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Proinflammatory+cytokine-induced+tight+junction+remodeling+through+dynamic+self-assembly+of+claudins.">Proinflammatory cytokine-induced tight junction remodeling through dynamic self-assembly of claudins.</a> Mol Biol Cell. 25, 2710-2719 (2014).</li><li>Wells, J. M., Spence, J. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=How+to+make+an+intestine.">How to make an intestine.</a> Development. 141, 752-760 (2014).</li></ol>

The authors have nothing to disclose

Os mecanismos moleculares envolvidos na proliferação de células epiteliais do cólon e diferenciação são mal compreendidos. Isto inclui lacunas na nossa compreensão do ambiente de sinalização celular do compartimento de células estaminais na base das criptas epiteliais do cólon. Há também um crescente interesse nos processos que subjazem diferenciação enterócitos. Por exemplo, o aumento da compreensão dos in vivo diferenciação é necessária como um ponto de referência para estudos voltados para a produção in vitro de sistemas intestinais primárias 16. O procedimento acima contém várias etapas que requerem atenção extra. Em primeiro lugar, a remoção das bordas ao redor do segmento de tecidos congelados (como discutido na seção 3.2) é necessária como as bordas do tecido onda durante a dissecção e congelamento. A falha para mover estes bordos resultados é uma população mista de células de superfície e de base cripta. Montando o tecido em um bloco de pré-refrigerados, nivelado outubro também é essencial. To protocolo pode ser adaptado para outras áreas do cólon distai através da alteração do número de secções, em cada pool. Por exemplo, como mostrado na Figura 1B, comprimento das criptas mucosa varia entre 150-300 um. Portanto, quando se estuda a região entre 4 cm-a 6 cm do ânus, o número de secções deve ser aumentado de 15 para 30. Importante, este procedimento não é recomendado para o cólon proximal (7 cm @ 9 cm), devido a dobras ( plicas obliquae) que se estendem para dentro do lúmen fazendo com que seja impossível para as células cripta e de superfície de base separados por cortes seriados. Técnicas de seccionamento em série têm sido usados ​​para estudar cripta-base e superfície de populações de células epiteliais em humanos. No entanto, o nosso protocolo adiciona passos adicionais que são necessários devido ao tamanho pequeno de tecido murino. Propomos que o protocolo acima permitirá a investigação de cripta-base e população de células epiteliais da superfície em sistemas geneticamente tratáveis ​​do mouse. Na verdade, seções reunidas yield proteína de alta qualidade e análise do RNA a jusante adequados. As aplicações futuras podem incluir o estudo de vias de sinalização celular ou cromatina imunoprecipitação. No entanto, deve notar-se que, tal como muitos dos métodos alternativos descritos acima, as secções resultantes contêm uma mistura de células epiteliais e da lâmina própria intersticiais. Em conclusão, o protocolo aqui descrito proporciona um método rápido de rendimento, elevada para a análise de processos moleculares em regiões espacialmente distintas da mucosa do cólon de murino.

O revestimento epitelial do cólon é um tecido altamente regenerativa, com as células estaminais residentes reabastecer o tecido a cada poucos dias 1. Este processo de regeneração requer a manutenção de um compartimento de células estaminais proliferativa. Ao longo do tempo, as células filhas recentemente produzidos perdem o seu potencial proliferativo e migram para a superfície luminal do intestino. Coincidente com a migração, as células progenitoras diferenciam-se em enterócitos de formação de barreira maduras ou células caliciformes produtoras de muco. A falha deste programa de diferenciação é pensado para contribuir para barreira epitelial comprometida tal como é observada na doença inflamatória do intestino e o cancro do cólon 2,3. Estudo detalhado dos processos acima exigirá metodologias para isolar populações cripta-base e celulares de superfície. Existem vários métodos, cada um com suas vantagens e desvantagens. Os métodos actuais para o isolamento de células epiteliais intestinais incluem chagentes elating e dissociação mecânica, resultando no isolamento de criptas epiteliais, folhas inteiras, ou de células individuais, dependentes das condições experimentais 4,5. Estes são os métodos de alto rendimento, ainda mudanças na sinalização intercelular foram relatados nestas condições que podem não representar o ambiente nativo 6,7. Captura Laser microdissection permite a coleta de material distinto espacial, mas alcança 8,9 baixo rendimento molecular. No tecido do cólon humano, métodos cryosectioning horizontais em série foram desenvolvidos 10. No entanto, os tecidos da mucosa murino são proibitivamente pequeno para apropriação direta desta técnica. Nos seres humanos, os comprimentos das criptas intestinais (a distantes entre a base de cripta e células superficiais) no cólon varia entre 100-1.000 uM ~ 11. Em ratinhos, os comprimentos das criptas são entre 50-300 ~ ^ M (ver Figura 1A). O tamanho pequeno das criptas murino apresenta um desafio para o isolação destas duas populações celulares utilizando protocolos existentes. Vamos agora descrever um baixo custo, o método de alto rendimento para o isolamento de cripta-base e superfície população de células epiteliais no tecido do cólon de murino. Tecido colhida desta maneira pode, então, ser analisado por um certo número de aplicações a jusante padrão, incluindo coloração por imunofluorescência, por RT-PCR (Real Time-Polymerase Chain Reaction) ou transferência de western.

<table border="0" cellpadding="0" cellspacing="0">
	<tbody>
		<tr>
			<td>Microtome</td>
			<td>Leica Biosystems, Nussloch Germany</td>
			<td>CM 1510-3</td>
			<td></td>
		</tr>
		<tr>
			<td>MyiQ real time PCR detector</td>
			<td>BioRad</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>LSM 510&#160;</td>
			<td>Carl Zeiss</td>
			<td></td>
			<td>Confocal microscope</td>
		</tr>
		<tr>
			<td>Materials</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>OCT</td>
			<td>Tissue-Tek, Sakura Finetek, Torrance CA</td>
			<td>4583</td>
			<td></td>
		</tr>
		<tr>
			<td>cryo-mold</td>
			<td>Tissue-Tek, Sakura Finetek, Torrance CA</td>
			<td>4557</td>
			<td>25mmx20mmx5mm</td>
		</tr>
		<tr>
			<td>High profile microtome blade</td>
			<td>Leica Biosystems, Nussloch germany</td>
			<td>818</td>
			<td></td>
		</tr>
		<tr>
			<td>GEM industrial blades</td>
			<td>American Safety Razor Blades</td>
			<td>62-0314</td>
			<td></td>
		</tr>
		<tr>
			<td>Sylgard silicon elastomere base</td>
			<td>Dow Corning, Midland MI</td>
			<td>3097358</td>
			<td></td>
		</tr>
		<tr>
			<td>27 1/2 g needle</td>
			<td>Becton-Dickinson, Franklin Lakes, NJ</td>
			<td>305109</td>
			<td>pins for dissection</td>
		</tr>
		<tr>
			<td>TRizol</td>
			<td>Life Technologies</td>
			<td>15596018</td>
			<td></td>
		</tr>
		<tr>
			<td>Rneasy</td>
			<td>Qiagen</td>
			<td>74104</td>
			<td></td>
		</tr>
		<tr>
			<td>DNAse</td>
			<td>Qiagen</td>
			<td>79254</td>
			<td></td>
		</tr>
		<tr>
			<td>Reagents</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Antibody ZO-1</td>
			<td>Invitrogen&#160;</td>
			<td>187430</td>
			<td></td>
		</tr>
		<tr>
			<td>Antibody KLF4</td>
			<td>Cell Signaling</td>
			<td>4038S</td>
			<td></td>
		</tr>
		<tr>
			<td>Antibody mGAPDH</td>
			<td>Sigma</td>
			<td>G8795</td>
			<td></td>
		</tr>
		<tr>
			<td>Antibody Secondary Alexa conjugate</td>
			<td>Invitrogen</td>
			<td>A11034</td>
			<td>488 anti-rabbit</td>
		</tr>
		<tr>
			<td>Antibody Secondary HRP conjugate</td>
			<td>Jackson</td>
			<td>111/115-001-003</td>
			<td>rabbit/mouse&#160;</td>
		</tr>
		<tr>
			<td>Topro-3</td>
			<td>Invitrogen</td>
			<td>T3605</td>
			<td></td>
		</tr>
		<tr>
			<td>HANKs balanced salt buffer</td>
			<td>Life Technologies</td>
			<td>14025092</td>
			<td></td>
		</tr>
		<tr>
			<td>RIPA lysis buffer</td>
			<td></td>
			<td></td>
			<td>50mM Tris-HCl pH 7.4 150mM NaCl 1% NP40 0.25% Na-deoxycholate</td>
		</tr>
		<tr>
			<td>PCR Primers</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>primer TBP 3&#39;</td>
			<td></td>
			<td></td>
			<td>GGAATTGTACCGCAGCTTCAAA</td>
		</tr>
		<tr>
			<td>primer TBP 5&#39;</td>
			<td></td>
			<td></td>
			<td>GATGACTGCAGCAAATCGCTT</td>
		</tr>
		<tr>
			<td>primer KLF4 3&#39;</td>
			<td></td>
			<td></td>
			<td>TGTGACTATGCAGGCTGTGGCAAA</td>
		</tr>
		<tr>
			<td>primer KLF4 5&#39;</td>
			<td></td>
			<td></td>
			<td>ACAGTGGTAAGGTTTCTCGCCTGT</td>
		</tr>
	</tbody>
</table>

cryosectioning method for microdissection of murine colonic mucosa

The colonic mucosal tissue provides a vital barrier to luminal antigens. This barrier is composed of a monolayer of simple columnar epithelial cells. The colonic epithelium is dynamically turned over and epithelial cells are generated in the stem cell containing crypts of Lieberk&#252;hn. Progenitor cells produced in the crypt-bases migrate toward the luminal surface, undergoing a process of cellular differentiation before being shed into the gut lumen. In order to study these processes at the molecular level, we have developed a simple method for the microdissection of two spatially distinct regions of the colonic mucosa; the proliferative crypt zone, and the differentiated surface epithelial cells. Our objective is to isolate specific crypt and surface epithelial cell populations from mouse colonic mucosa for the isolation of RNA and protein.

Seções de tecido do cólon foram processados ​​para avaliação histológica e H &amp; E coloração 13. Uma vista em secção transversal tradicional da mucosa é visto na Figura 2A. Áreas basais conter o muscular externa, composta principalmente dos muscularis circulares. Prosseguindo para o lúmen, a mucosa muscularis é evidente adjacente para as células epiteliais de cripta-base, as células são transitórias no meio do tecido, e finalmente, as populações de células de superfície da face do lúmen do intestino. O método descrito aqui cortes seriados mantém uma orientação tal que os muscularis longitudinais e circulares são encontrados primeira (Figura 2B), seguido pela mucosa muscular (Figura 2C). Observe a aparência das células intersticiais não-musculares no canto superior esquerdo da imagem. Para a análise a jusante descrito abaixo, as secções de músculo são descartados. As seções posteriores contêm células epiteliais e tecido intersticial (lâmina própria), Começando com as células de cripta-base (Figura 2D). Note-se a ausência de um lúmen central, na maioria das criptas, que aparecem mais escuras devido aos núcleos estreitamente empacotadas. Estas camadas contêm o compartimento proliferativa. As células de transição aparecem como bem embalado glândulas com lumens centrais proeminentes (Figura 2E). Por último, as populações de células da superfície tem uma estrutura irregular, com áreas de monocamada epitelial viram en face (Figura 2F). Cortes seriados como descritos acima podem também ser tratados para a rotulagem de imunofluorescência e microscopia confocal (como descrito aqui 14). Figura 2G mostra criptas isoladas fixas e permeabilizadas em 100% de metanol e, posteriormente coradas para núcleos (azul) e da proteína de junção célula-célula zonula occludens 1 (ZO-1, verde). Na orientação de corte tradicional, células da cripta e da superfície pode ser visto simultaneamente (Figura 2G </strong&gt;). Note-se que as linhas de junção mancha ZO-1 do lúmen da cripta do cólon. Esse revestimento Z0-1 do lúmen também pode ser visto em amostras seccionadas em série de populações de células de transição, no centro das glândulas circulares (Figura 2G). Aprimorado ZO-1 mancha é visto em populações de células de superfície (Figura 2I e J). Vários factores de diferenciação são conhecidos a ser expresso de uma forma espaço-temporal ao longo do eixo cripta-a-superfície. Isto inclui o factor de transcrição-Kruppel como factor de 4 (KLF4), que é conhecido por ser enriquecido em populações de células de superfície. Usando métodos tradicionais de seccionamento, KLF4 é encontrada nos núcleos de lúmen populações de células de superfície (Figura 2K) enfrentando. Nós portanto especulado que KLF4 ARNm poderia ser predominantemente expresso em populações de células de superfície. Para testar isso, cortes seriados foram coletadas e agrupadas em amostras de superfície, de transição, de criptas e-base. Subsequently, o ARN foi colhido utilizando Trizol extracção padrão, com uma purificação adicional por coluna RNeasy e tratamento com DNAse. RNA foi coletado de cinco secções consecutivas em pool, que renderam entre 5-10 mg de RNA total por amostra. Estas amostras foram então submetidas a tempo de semi-quantitativo PCR real tanto para KLF4 e um gene de referência, a ligação da proteína caixa TATÁ 1 (TBP-1) (Figura 2L) 14. Como mostrado na Figura 2L, após normalização para a TBP-1, células de superfície foram encontrados para expressar até 8 vezes o ARNm KLF4 que é expresso em células da cripta. Do mesmo modo, os níveis de proteína KLF4 foram encontrados para expor regulação espacial ao longo do eixo cripta-superfície. As secções em série foram recolhidas como descrito acima e, em seguida, incubadas em tampão de lise durante 20 min a 4 ° C. Isto produziu entre 200-250 mg de proteína por amostra. As amostras foram então sujeitas a análise por SDS-PAGE (Figura 2M) 15. Como mostrado na Figura 2 M, p KLF4níveis rotein são dramaticamente mais elevada em populações de células de superfície. Os resultados acima demonstram a capacidade deste protocolo para isolar grandes quantidades de células epiteliais superficiais e das criptas da mucosa do cólon murino. <img alt="Figura 1" src="/files/ftp_upload/53112/53112fig1.jpg" /> Figura 1: (A) mostrando esquemática da mucosa do cólon de murino e as camadas musculares externos. Nosso método tem como objectivo recolher populações de células discretas de células superficiais e cripta-base por cryosectioning serial (10 m cada). As camadas musculares externos são descartados. Altura (B) Crypt varia ao longo do comprimento do cólon (a distância entre as camadas de base e de cripta-superficiais). Os pontos de dados individuais indicam as medições das criptas e símbolos indicam réplicas biológicas (n = 4). (C) segmentos de cólon recolhido, dividido, e preso em um silício dissecar prato. (D) Um tecido segment aproximadamente 3 cm do ânus é prensada entre a lâminas de barbear e os congelados em gelo seco. (E) O tecido é, em seguida, montado sobre um pré-nivelado bloco PTU. (F) Cortes congelados são removidos e inspeccionados visualmente. <img alt="Figura 2" src="/files/ftp_upload/53112/53112fig2.jpg" /> Figura 2:. Os dados representativos (A) de tecido do cólon corado com Hematoxilina-Eosina, em corte transversal, que mostra a muscular circular (em cm), a mucosa muscularis (mm), as células de cripta-base, células de transição, e de células de superfície. (B - C) camadas musculares do cólon. (D) As células da cripta de base. Note-se a ausência de um lúmen central. (E) células transitórias. (F), as células de superfície. (G) Imunofluorescência coloração das criptas colônicas isoladas. ZO-1 (verde) e núcleos (azul) são observadas em corte transversal. (HI) ZO-1 e coloração nuclear em células de transição e de superfície. (J) visão ampliada de ZO-1 coloração. (K) KLF4 (verde) está enriquecido nas populações de células de superfície. (G) em tempo real os níveis de avaliação de PCR de ARNm KLF4 entre os três compartimentos. (M) análise de Western blot de KLF4 níveis de proteína nestas populações de células.

Watch this Scientific Journal Video about Cryosectioning Method for Microdissection of Murine Colonic Mucosa at JoVE.com

Cryosectioning Method for Microdissection of Murine Colonic Mucosa

Here we describe a simple method for the isolation of spatially distinct murine colonic epithelial surface cells from the underlying crypt-base cells.

Método cryosectioning para Microdissection de Murino Colonic Mucosa

The colonic mucosal tissue provides a vital barrier to luminal antigens. This barrier is composed of a monolayer of simple columnar epithelial cells. The ...

cryosectioning-method-for-microdissection-of-murine-colonic-mucosa

Research

JoVE Journal

Biology

17.2K visualizações.  Emory University, Atlanta, Georgia. Here we describe a simple method for the isolation of spatially distinct murine colonic epithelial surface cells from the underlying crypt-base cells.

Vídeo: Cryosectioning Method for Microdissection of Murine Colonic Mucosa

Flash Freezing and Cryosectioning E12.5 Mouse Brain

Demonstrated in this video are the techniques for flash freezing and sectioning embryonic brain tissue from mouse. Useful tips for using the cryostat are given, including troubleshooting methods that can be used while cutting to ensure that the resultant tissues sections are free of cracks and other distortions.

Flash Freezing e Cryosectioning E12.5 cérebro de camundongo

Biologia

Laser Capture Microdissection of Mammalian Tissue

Laser capture microscopy, also known as laser microdissection (LMD), enables the user to isolate small numbers of cells or tissues from frozen or formalin-fixed, paraffin-embedded tissue sections. LMD techniques rely on a thermo labile membrane placed either on top of, or underneath, the tissue section. In one method, focused laser energy is used to melt the membrane onto the underlying cells, which can then be lifted out of the tissue section. In the other, the laser energy vaporizes the foil along a path "drawn" on the tissue, allowing the selected cells to fall into a collection device. Each technique allows the selection of cells with a minimum resolution of several microns. DNA, RNA, protein, and lipid samples may be isolated and analyzed from micro-dissected samples. In this video, we demonstrate the use of the Leica AS-LMD laser microdissection instrument in seven segments, including an introduction to the principles of LMD, initializing the instrument for use, general considerations for sample preparation, mounting the specimen and setting up capture tubes, aligning the microscope, adjusting the capture controls, and capturing tissue specimens. Laser-capture micro-dissection enables the investigator to isolate samples of pure cell populations as small as a few cell-equivalents. This allows the analysis of cells of interest that are free of neighboring contaminants, which may confound experimental results.

Laser Microdissecção Captura de tecidos de mamíferos

Laser capture microscopy, also known as laser microdissection (LMD), enables the user to isolate small numbers of cells or tissues from frozen or ...

Microdissection of Zebrafish Embryonic Eye Tissues

Zebrafish is a popular animal model for research on eye development because of its rapid ex utero development and good fecundity. By 3 days post fertilization (dpf), the larvae will show the first visual response. Many genes have been identified to control a proper eye development, but we are far from a complete understanding of the underlying genetic architecture. Whole genome gene expression profiling is a useful tool to elucidate genetic regulatory network for eye development. However, the small size of the embryonic eye in zebrafish makes it challenging to obtain intact and pure eye tissues for expression analysis. For example, the anterior-posterior length of the eye between day 2 and 3 is only approximately 200-300 &mu;m, while the diameter of the lens is less 100 &mu;m. Also, the retinal pigment epithelium (RPE) underlying the retina is just a single-layer epithelium. While gene expression profiles can be obtained from the whole embryo, they do not accurately represent the expression of these tissues. Therefore pure tissue must be obtained for a successful gene expression profiling of eye development. To address this issue, we have developed an approach to microdissect intact retina and retina with RPE attached from 1-3 dpf, which cover major stages of eye morphogenesis. All procedures can be done with fine forceps and general laboratory supplies under standard stereomicroscopes. For retinal dissection, the single-layer RPE is removed and peeled off by brushing action and the preferential adherence of the RPE remnants to the surface of the culture plate for dissection. For RPE-attached retinal dissection, the adherence of RPE to the dissection plate is removed before the dissection so that the RPE can be completely preserved with the retina. A careful lifting action of this tissue can efficiently separate the presumptive choroid and sclera. The lens can be removed in both cases by a chemically etched tungsten needle. In short, our approach can obtain intact eye tissues and has been successfully utilized to study tissue-specific expression profiles of zebrafish retina1, 2 and retinal pigment epithelium3.

This article describes an approach to microdissect zebrafish retinas with and without retinal pigment epithelium attached, from one to three days postfertilization embryos.

Microdissecção de tecidos oculares Zebrafish embrionárias

Zebrafish is a popular animal model for research on eye development because of its rapid ex utero development and good fecundity. By 3 days post ...

Microdissection of Black Widow Spider Silk-producing Glands

Modern spiders spin high-performance silk fibers with a broad range of biological functions, including locomotion, prey capture and protection of developing offspring 1,2. Spiders accomplish these tasks by spinning several distinct fiber types that have diverse mechanical properties. Such specialization of fiber types has occurred through the evolution of different silk-producing glands, which function as small biofactories. These biofactories manufacture and store large quantities of silk proteins for fiber production. Through a complex series of biochemical events, these silk proteins are converted from a liquid into a solid material upon extrusion.
Mechanical studies have demonstrated that spider silks are stronger than high-tensile steel 3. Analyses to understand the relationship between the structure and function of spider silk threads have revealed that spider silk consists largely of proteins, or fibroins, that have block repeats within their protein sequences 4. Common molecular signatures that contribute to the incredible tensile strength and extensibility of spider silks are being unraveled through the analyses of translated silk cDNAs. Given the extraordinary material properties of spider silks, research labs across the globe are racing to understand and mimic the spinning process to produce synthetic silk fibers for commercial, military and industrial applications. One of the main challenges to spinning artificial spider silk in the research lab involves a complete understanding of the biochemical processes that occur during extrusion of the fibers from the silk-producing glands.
Here we present a method for the isolation of the seven different silk-producing glands from the cobweaving black widow spider, which includes the major and minor ampullate glands [manufactures dragline and scaffolding silk] 5,6, tubuliform [synthesizes egg case silk] 7,8, flagelliform [unknown function in cob-weavers], aggregate [makes glue silk], aciniform [synthesizes prey wrapping and egg case threads] 9 and pyriform [produces attachment disc silk] 10. This approach is based upon anesthetizing the spider with carbon dioxide gas, subsequent separation of the cephalothorax from the abdomen, and microdissection of the abdomen to obtain the silk-producing glands. Following the separation of the different silk-producing glands, these tissues can be used to retrieve different macromolecules for distinct biochemical analyses, including quantitative real-time PCR, northern- and western blotting, mass spectrometry (MS or MS/MS) analyses to identify new silk protein sequences, search for proteins that participate in the silk assembly pathway, or use the intact tissue for cell culture or histological experiments.

Here we describe an efficient strategy to remove the silk-producing glands from the abdomen of female black widow spiders. This procedure allows the rapid isolation of the seven distinct silk-producing glands in a highly purified fashion, an important process for investigators studying spider silk production and fiber assembly.

Microdissecção de Black Widow Aranha Silk glândulas produtoras de

Modern spiders spin high-performance silk fibers with a broad range of biological functions, including locomotion, prey capture and protection of ...

A Novel Method for the Culture and Polarized Stimulation of Human Intestinal Mucosa Explants

Few models currently exist to realistically simulate the complex human intestine's micro-environment, where a variety of interactions take place. Proper homeostasis directly depends on these interactions, as they shape an entire immunological response inducing tolerance against food antigens while at the same time mounting effective immune responses against pathogenic microbes accidentally ingested with food.
Intestinal homeostasis is preserved also through various complex interactions between the microbiota (including food-associated beneficial bacterial strains) and the host, that regulate the attachment/degradation of mucus, the production of antimicrobial peptides by the epithelial barrier, and the "education" of epithelial cells' that controls the tolerogenic or immunogenic phenotype of unique, gut-resident lymphoid cells' populations. These interactions have been so far very difficult to reproduce with in vitro assays using either cultured cell lines or peripheral blood mononuclear cells. In addition, mouse models differ substantially in components of the intestinal mucosa (mucus layer organization, commensal bacteria community) with respect to the human gut. Thus, studies of a variety of treatments to be brought in the clinics for important stress-related or pathological conditions such as irritable bowel syndrome, inflammatory bowel disease or colorectal cancer have been difficult to carry out.
To address these issues, we developed a novel system that enables us to stimulate explants of human intestinal mucosa that retain their in situ conditioning by the host microbiota and immune response, in a polarized fashion. Polarized apical stimulation is of great importance for the outcome of the elicited immune response. It has been repeatedly shown that the same stimuli can produce completely different responses when they bypass the apical face of the intestinal epithelium, stimulating epithelial cells basolaterally or coming into direct contact with lamina propria components, switching the phenotype from tolerogenic to immunogenic and causing unnecessary and excessive inflammation in the area.
We achieved polarized stimulation by gluing a cave cylinder which delimited the area of stimulation on the apical face of the mucosa as will be described in the protocol. We used this model to examine, among others, differential effects of three different Lactobacilli strains. We show that this model system is very powerful to assess the immunomodulatory properties of probiotics in healthy and disease conditions.

We introduce a novel method for the maintenance of human intestinal mucosa in culture and monitoring of the response to various types of stimuli over at least 24 hrs. With our method, the polarity of the tissue is maintained, allowing for a physiological stimulation via the apical route.

Um novo método para a Cultura e polarizada Estimulação dos Humanos explantes mucosa intestinal

Few models currently exist to realistically simulate the complex human intestine's micro-environment, where a variety of interactions take place. Proper ...

Cryosectioning Yeast Communities for Examining Fluorescence Patterns

Microbes typically live in communities. The spatial organization of cells within a community is believed to impact the survival and function of the community1. Optical sectioning techniques, including confocal and two-photon microscopy, have proven useful for observing spatial organization of bacterial and archaeal communities2,3. A combination of confocal imaging and physical sectioning of yeast colonies has revealed internal organization of cells4. However, direct optical sectioning using confocal or two-photon microscopy has been only able to reach a few cell layers deep into yeast colonies. This limitation is likely because of strong scattering of light from yeast cells4.
Here, we present a method based on fixing and cryosectioning to obtain spatial distribution of fluorescent cells within Saccharomyces cerevisiae communities. We use methanol as the fixative agent to preserve the spatial distribution of cells. Fixed communities are infiltrated with OCT compound, frozen, and cryosectioned in a cryostat. Fluorescence imaging of the sections reveals the internal organization of fluorescent cells within the community.
Examples of yeast communities consisting of strains expressing red and green fluorescent proteins demonstrate the potentials of the cryosectioning method to reveal the spatial distribution of fluorescent cells as well as that of gene expression within yeast colonies2,3. Even though our focus has been on Saccharomyces cerevisiae communities, the same method can potentially be applied to examine other microbial communities.

We present a protocol for freezing and cryosectioning yeast communities to observe internal patterns of fluorescent cells. The method relies on methanol-fixing and OCT-embedding to preserve the spatial distribution of cells without inactivating fluorescent proteins within a community.

Cryosectioning comunidades de leveduras para o exame de padrões de fluorescência

Microbes typically live  in communities. The spatial organization  of cells within a community is believed to impact the survival and function of the  ...

Laser-assisted Microdissection (LAM) as a Tool for Transcriptional Profiling of Individual Cell Types

The understanding of developmental processes at the molecular level requires insights into transcriptional regulation, and thus the transcriptome, at the level of individual cell types. While the methods described here are generally applicable to a wide range of species and cell types, our research focuses on plant reproduction. Plant cultivation and seed production is of crucial importance for human and animal nutrition. A detailed understanding of the regulatory networks that govern the formation of the reproductive lineage (germline) and ultimately of seeds is a precondition for the targeted manipulation of plant reproduction. In particular, the engineering of apomixis (asexual reproduction through seeds) into crop plants promises great improvements, as it leads to the formation of clonal seeds that are genetically identical to the mother plant. Consequently, the cell types of the female germline are of major importance for the understanding and engineering of apomixis. However, as the corresponding cells are deeply embedded within the floral tissues, they are very difficult to access for experimental analyses, including cell-type specific transcriptomics. To overcome this limitation, sections of individual cells can be isolated by laser-assisted microdissection (LAM). While LAM in combination with transcriptional profiling allows the identification of genes and pathways active in any cell type with high specificity, establishing a suitable protocol can be challenging. Specifically, the quality of RNA obtained after LAM can be compromised, especially when small, single cells are targeted. To circumvent this problem, we have established a workflow for LAM that reproducibly results in high RNA quality that is well suitable for transcriptomics, as exemplified here by the isolation of cells of the female germline in apomictic Boechera. In this protocol, procedures are described for tissue preparation and LAM, also with regard to RNA extraction and quality control.

Laser-assisted Microdissection LAM as a Tool for Transcriptional Profiling of Individual Cell Types

Here we present a protocol for laser-assisted microdissection of specific plant cell types for transcriptional profiling. While the protocol is suitable for different species and cell types, the focus is on highly inaccessible cells of the female germline important for sexual and apomictic reproduction in the crucifer genus Boechera.

assistida por laser Microdissecção (LAM) como ferramenta para transcricional Profiling de tipos de células individuais

The understanding of developmental processes at the molecular level requires insights into transcriptional regulation, and thus the transcriptome, at the ...

Cryosectioning of Contiguous Regions of a Single Mouse Skeletal Muscle for Gene Expression and Histological Analyses

With this method, consecutive cryosections are collected to enable both microscopy applications for tissue histology and enrichment of RNA for gene expression using adjacent regions from a single mouse skeletal muscle. Typically, it is challenging to achieve adequate homogenization of small skeletal muscle samples because buffer volumes may be too low for efficient grinding applications, yet without sufficient mechanical disruption, the dense tissue architecture of muscle limits penetration of buffer reagents, ultimately causing low RNA yield. By following the protocol reported here, 30 &#956;m sections are collected and pooled allowing cryosectioning and subsequent needle homogenization to mechanically disrupt the muscle, increasing the surface area exposed for buffer penetration. The primary limitations of the technique are that it requires a cryostat, and it is relatively low throughput. However, high-quality RNA can be obtained from small samples of pooled muscle cryosections, making this method accessible for many different skeletal muscles and other tissues. Furthermore, this technique enables matched analyses (e.g., tissue histopathology and gene expression) from adjacent regions of a single skeletal muscle so that measurements can be directly compared across applications to reduce experimental uncertainty and to reduce replicative animal experiments necessary to source a small tissue for multiple applications.

Consecutive cryo-sections are collected to enable histological applications and enrichment of RNA for gene expression measurements using adjacent regions from a single mouse skeletal muscle. High-quality RNA is obtained from 20 - 30 mg of pooled cryosections and measurements are directly compared across applications.

Cryosectioning da contíguos Regiões de um músculo esquelético único mouse para expressão do gene e análises histológicas

With this method, consecutive cryosections are collected to enable both microscopy applications for tissue histology and enrichment of RNA for gene ...

A Morphometric and Cellular Analysis Method for the Murine Mandibular Condyle

The temporomandibular joint (TMJ) has the capacity to adapt to external stimuli, and loading changes can affect the position of condyles, as well as the structural and cellular components of the mandibular condylar cartilage (MCC). This manuscript describes methods for analyzing these changes and a method for altering the loading of the TMJ in mice (i.e., compressive static TMJ loading). The structural evaluation illustrated here is a simple morphometric approach that uses the Digimizer software and is performed in radiographs of small bones. In addition, the analysis of cellular changes leading to alterations in collagen expression, bone remodeling, cell division, and proteoglycan distribution in the MCC is described. The quantification of these changes in histological sections - by counting the positive fluorescent pixels using image software and measuring the distance mapping and stained area with Digimizer - is also demonstrated. The methods shown here are not limited to the murine TMJ, but could be used on additional bones of small experimental animals and in other regions of endochondral ossification.

This manuscript presents methods for analyzing morphometric and cellular changes within the mandibular condyle of rodents.

Um método de análise celular para o côndilo Mandibular murino e morfométricas

The temporomandibular joint (TMJ) has the capacity to adapt to external stimuli, and loading changes can affect the position of condyles, as well as the ...

Laser Capture Microdissection of Highly Pure Trabecular Meshwork from Mouse Eyes for Gene Expression Analysis

Laser capture microdissection (LCM) has allowed gene expression analysis of single cells and enriched cell populations in tissue sections. LCM is a great tool for the study of the molecular mechanisms underlying cell differentiation and the development and progression of various diseases, including glaucoma. Glaucoma, which comprises a family of progressive optic neuropathies, is the most common cause of irreversible blindness worldwide. Structural changes and damage within the trabecular meshwork (TM) can result in increased intraocular pressure (IOP), which is a major risk factor for developing glaucoma. However, the precise molecular mechanisms involved are still poorly understood. The ability to perform gene expression analysis will be crucial in obtaining further insights into the function of these cells and its role in the regulation of IOP and glaucoma development. To achieve this, a reproducible method for isolating highly enriched TM from frozen sections of mouse eyes and a method for downstream gene expression analysis, such as RT-qPCR and RNA-Seq is needed. The method described herein is developed to isolate highly pure TM from mouse eyes for downstream digital PCR and microarray analysis. In addition, this technique can be easily adapted for the isolation of other highly enriched ocular cells and cell compartments that have been difficult to isolate from mouse eyes. The combination of LCM and RNA analysis can contribute to a more comprehensive understanding of the cellular events underlying glaucoma.

Here, we describe a protocol for a reproducible laser capture microdissection (LCM) for isolating trabecular meshwork (TM) for downstream RNA analysis. The ability to analyze changes in gene expression in the TM will help in understanding the underlying molecular mechanisms of TM-related ocular diseases.

Captação microdissection da malha Trabecular altamente pura de olhos de rato de laser para análise de expressão do Gene

Laser capture microdissection (LCM) has allowed gene expression analysis of single cells and enriched cell populations in tissue sections. LCM is a great ...