Supported by National Institutes of Health (DK55679, and DK59888 to A.N.). Emory University&#160;Integrated Cellular Imaging Microscopy Core of the Winship Cancer&#160;Institute comprehensive cancer center grant, P30CA138292, and the Crohn's and Colitis Foundation of America Career Development award to C.T.C. and Fellowship Award to A.E.F.

Versuchen verwendeten C57BL / 6-Mäusen, 10 bis 12 Wochen alt sind. Alle Verfahren unter Verwendung von Tieren wurden überprüft und von der Emory University Institutional Animal Care und Verwenden Committee genehmigt und wurden nach den National Institutes of Health Kriterien durchgeführt. 1. Versuchsaufbau <ol><li> Einrichten des Kryostaten <ol><li> Äquilibrieren Kryostaten auf -20 ° C, einschließlich der Mikrotomklinge und Spannfutter (äußerst vorsichtig vorgehen, um die Klinge!). </li><li> Füllen Sie eine leere cryomold mit OCT (optimale Schnitt Temperatur-Verbindung) und ins Gleichgewicht zu -20 ° C (~ 30 min). Entfernen Sie die gefrorenen Oktober aus der Form und befestigen Sie es am Spannfutter mit flüssigem Oktober Setzen Sie den Block / Spannfutter im Mikrotom Arm und lassen Sie das OAT 10 min eingestellt. </li><li> Stellen Sie den Kryostaten bis 10 &amp; mgr; m pro Schnitt und Rasur des Office-Block, bis es flach ist. Rücken des Mikrotoms Arm weg von der Klinge um mehrere Zentimeter. An dieser Stelle nicht das Messer oder Spannfutter für den Rest der Erfahrung anzupassen weißBeispiel. </li></ol></li><li> Bereiten Sie die Rasierklingen: Bereiten Sie 2 Rasierklingen pro Probe. Unter Verwendung einer Metallfeile, dumpf die sharped Rand der Blätter. Dann entfernen Sie den Flansch aus Aluminium mit einer Pinzette. </li><li> Pre-Chillen ein Pyrex Gericht oder einer anderen flachen Oberfläche auf Trockeneis. </li><li> Bereiten Sie eine Dissektion Gericht mit 10-15 Dissektion Stifte. A 10 cm Gewebekulturschale mit 50% Silizium gefüllt wird ausreichen. 5 ml Hanks-Puffer bei RT. </li></ol> 2. Präparation der Distal Kolongewebe <ol><li> Platz Mäusen in einer abgedichteten Kammer und einschläfern Mäusen durch Isofluran-Inhalation und Genickbruch, dann sprühen 70% Ethanol auf den Bauch und Brustkorb 12. </li><li> Machen Sie einen kleinen Schnitt in der Haut des Bauches mit einer Schere und dann ein Einschnitt in die Bauchhöhle aus. Ähnliche Verfahren können hier 12 beschrieben gefunden werden. </li><li> Schneiden Sie den Dickdarm am Rande anal und necken neben der Gekröse, bis der Doppelpunkt ist frei. </li><li> Auszuschneiden einen distalen KolonSegment zwischen 0 und 6 cm vom Anus. Hier ist die Kryptentiefe ~ 150 &amp; mgr; m (siehe Abbildung 1B). Schneiden Sie den Doppelpunkt in Längsrichtung mit einer Schere und die fäkale Inhalt zu entfernen. </li><li> Pin das Gewebe auf die Dissektion Gericht mit der Schleimhautoberfläche nach oben zeigt. Dehnen die Verwendung Gewebedissektion Stifte auf einem Silizium-Gericht in Hanks-Puffer und ruhen lassen für 10 Minuten bei RT (1C). Dies entfernt Falten aus dem Gewebe und erlaubt die Muskelschichten zu entspannen. </li></ol> 3. Montieren Tissue auf dem Kryostat zum Schneiden <ol><li> Schieben einer Rasierklinge unter der gewünschten Gewebebereich und dann abgießen Hanks-Puffer. Einen weiteren hinzufügen Rasierklinge nach oben, so dass ein Sandwich. Schneiden Sie das Gewebesegment und die Stifte zu entfernen. Übertragen Sie die Rasierklinge / Gewebe-Sandwich auf Trockeneis. Lassen Sie das Gewebe einzufrieren (5-10 min, 1D). </li><li> Nehmen Sie den Rasierer / Gewebe Sandwich und lassen Sie ihn leicht, indem Sie einen Finger auf die Oberseite bl wärmenade (Schleimhautseite nach oben. Dieser richtet das Gewebe, so dass die basalen Muskelschichten werden zuerst geschnitten.). Trennen Sie die Sandwich-und schneiden um die Ränder des Gewebesegment. Schneiden Sie ein Gewebesegment rund, 0.5 cm x 1 cm. Randbereiche haben eine Tendenz zu kräuseln, wodurch die Serienschnitte vieler Gewebeschichten. Beachten Sie, dass Überschneiden ist besser als unter Schneiden, so irren auf der Seite der Vorsicht. </li><li> Damit das Gewebe erwärmt, bis das Eis auf der Oberseite des Gewebes zu schmelzen beginnt. An dieser Stelle schnell und sorgfältig drücken das Gewebe in OCT-Block in den Kryostaten. </li><li> Entfernen Sie das Blade, indem Sie einen Finger über die Probe. Die Wärmeübertragung ermöglicht es Ihnen, die Klinge, ohne das Gewebe zu stören zu entfernen. </li><li> Coat das Gewebe mit OAT und ins Gleichgewicht für 5 min. Zuschnitte bei 10 um (1E, F). Sichtprüfung der Abschnitte bis die Krypten zu sehen sind. Platz Abschnitte in ein 1,5 ml Röhrchen oder auf Objektträgern. </li><li> Für die Analyse von mRNA oder Protein, Ort ter Proben in Röhrchen mit 5 Krypta-Basis, 5 Übergangs und 5 Flächenabschnitte pro Röhrchen. Für die RNA-Sammlung 1 ml kommerziellen Isolation-Reagenz und Inkubation bei Raumtemperatur für 10 min. Zuführen RNA-Reinigung gemß den Herstelleranweisungen. Verwenden 5-10 ug Gesamt-RNA für die cDNA-Generation. </li><li> Zur Proteinreinigung, fügen Sie 0,5 ml kaltem RIPA Lysepuffer (plus Protease-Inhibitoren) je 5 Sektionen. Beschallen 3 mal in einer 70% igen Zyklus, auf Eis. <ol><li> Proben, die SDS-PAGE-Ladepuffer (Laemmli-Puffer) hinzufügen und Inkubation bei 100 ° C für 10 min. Betreff Proben SDS-PAGE und Transfer, dann in 5% Milch / PBS Block 2 Stunden. Western Blot-Analyse durchzuführen, gefolgt von einer Inkubation mit KLF4 Antikörper (1: 500) O / N bei 4 ° C. </li></ol></li></ol>

<ol>
	<li>Noah, T. K., Donahue, B., Shroyer, N. F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Intestinal+development+and+differentiation.">Intestinal development and differentiation.</a> Exp Cell Res. 317, 2702-2710 (2011).</li><li>Humphries, A., Wright, N. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Colonic+crypt+organization+and+tumorigenesis.">Colonic crypt organization and tumorigenesis.</a> Nat Rev Cancer. 8, 415-424 (2008).</li><li>Weber, C. R., Turner, J. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Inflammatory+bowel+disease:+is+it+really+just+another+break+in+the+wall.">Inflammatory bowel disease: is it really just another break in the wall.</a> Gut. 56, 6-8 (2007).</li><li>Bjerknes, M., Cheng, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Methods+for+the+isolation+of+intact+epithelium+from+the+mouse+intestine.">Methods for the isolation of intact epithelium from the mouse intestine.</a> Anat Rec. 199, 565-574 (1981).</li><li>Sato, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Single+Lgr5+stem+cells+build+crypt-villus+structures+in+vitro+without+a+mesenchymal+niche.">Single Lgr5 stem cells build crypt-villus structures in vitro without a mesenchymal niche.</a> Nature. 459, 262-265 (2009).</li><li>Rand, M. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Calcium+depletion+dissociates+and+activates+heterodimeric+notch+receptors.">Calcium depletion dissociates and activates heterodimeric notch receptors.</a> Mol Cell Biol. 20, 1825-1835 (2000).</li><li>Gjorevski, N., Boghaert, E., Nelson, C. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Regulation+of+Epithelial-Mesenchymal+Transition+by+Transmission+of+Mechanical+Stress+through+Epithelial+Tissues.">Regulation of Epithelial-Mesenchymal Transition by Transmission of Mechanical Stress through Epithelial Tissues.</a> Cancer Microenviron. 5, 29-38 (2012).</li><li>Lechner, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Gene+expression+pattern+of+laser+microdissected+colonic+crypts+of+adenomas+with+low+grade+dysplasia.">Gene expression pattern of laser microdissected colonic crypts of adenomas with low grade dysplasia.</a> Gut. 52, 1148-1153 (2003).</li><li>Reizel, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Colon+stem+cell+and+crypt+dynamics+exposed+by+cell+lineage+reconstruction.">Colon stem cell and crypt dynamics exposed by cell lineage reconstruction.</a> PLoS Genet. 7, e1002192 (2011).</li><li>Kosinski, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Gene+expression+patterns+of+human+colon+tops+and+basal+crypts+and+BMP+antagonists+as+intestinal+stem+cell+niche+factors.">Gene expression patterns of human colon tops and basal crypts and BMP antagonists as intestinal stem cell niche factors.</a> Proc Natl Acad Sci U S A. 104, 15418-15423 (2007).</li><li>Tamura, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Pit+pattern+and+three-dimensional+configuration+of+isolated+crypts+from+the+patients+with+colorectal+neoplasm.">Pit pattern and three-dimensional configuration of isolated crypts from the patients with colorectal neoplasm.</a> J Gastroenterol. 37, 798-806 (2002).</li><li>Geem, D., Medina-Contreras, O., Kim, W., Huang, C. S., Denning, T. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Isolation+and+characterization+of+dendritic+cells+and+macrophages+from+the+mouse+intestine.">Isolation and characterization of dendritic cells and macrophages from the mouse intestine.</a> Journal of visualized experiments : JoVE. , e4040 (2012).</li><li>Laukoetter, M. G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=JAM-A+regulates+permeability+and+inflammation+in+the+intestine+in+vivo.">JAM-A regulates permeability and inflammation in the intestine in vivo.</a> J Exp Med. 204, 3067-3076 (2007).</li><li>Neumann, P. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Gut+commensal+bacteria+and+regional+Wnt+gene+expression+in+the+proximal+versus+distal+colon.">Gut commensal bacteria and regional Wnt gene expression in the proximal versus distal colon.</a> Am J Pathol. 184, 592-599 (2014).</li><li>Capaldo, C. T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Proinflammatory+cytokine-induced+tight+junction+remodeling+through+dynamic+self-assembly+of+claudins.">Proinflammatory cytokine-induced tight junction remodeling through dynamic self-assembly of claudins.</a> Mol Biol Cell. 25, 2710-2719 (2014).</li><li>Wells, J. M., Spence, J. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=How+to+make+an+intestine.">How to make an intestine.</a> Development. 141, 752-760 (2014).</li></ol>

The authors have nothing to disclose

Die molekularen Mechanismen in Kolonepithelzellen Zellproliferation und -differenzierung beteiligt sind kaum verstanden. Dies schließt Lücken in unserem Verständnis der zellulären Signalumgebung des Stammzellkompartiments an der Basis der Krypten Kolonepithel. Es besteht auch ein zunehmendes Interesse an der Prozesse, die Enterozyten Differenzierung unterliegen. Zum Beispiel, ein besseres Verständnis der in vivo Differenzierung wird als Benchmark für Studien an der Herstellung von in vitro Primärdarmsysteme 16 ausgerichtet erforderlich. Das obige Verfahren beinhaltet mehrere Schritte, die besondere Maßnahmen erfordern. Erstens, das Entfernen der Ränder um die gefrorenen Gewebesegment (wie in Abschnitt 3.2 diskutiert) als die Geweberänder beim Präparieren und Einfrieren curl erforderlich. Die Nichtbeachtung dieser Kanten Ergebnisse zu bewegen ist eine Mischpopulation von Oberfläche und Krypta Basiszellen. Montage des Gewebes auf einem vorgekühlten, eingeebnet Oktober Block ist auch wichtig. Tseinem Protokoll kann zu anderen Bereichen des distalen Kolons durch Verändern der Anzahl von Abschnitten in jedem Pool angepasst werden. Zum Beispiel, wie in 1B gezeigt, variiert Mukosakryptenbereichs Länge zwischen 150-300 um. Daher wird, wenn die Untersuchung der Bereich zwischen 4 cm 6 cm vom Anus aus, die Anzahl der Abschnitte ist von 15 bis 30. Es ist wichtig erhöht werden, wird dieses Protokoll nicht für das proximale Colon vorgeschlagen (7 cm-9 cm) durch Falten ( plicae obliquae), die in das Lumen zu verlängern macht es unmöglich, getrennte Oberfläche und Krypta-Basiszellen durch Serienschnitt. Serienschnitt Techniken wurden verwendet, um Krypta-Basis zu studieren und Oberfläche epithelialen Zellpopulationen in den Menschen. Fügt jedoch unser Protokoll zusätzliche Schritte, die aufgrund der geringen Größe des Maus-Gewebe erforderlich sind. Wir schlagen vor, dass das obige Protokoll wird für die Untersuchung der Krypta-Basis und Oberfläche epithelialen Zellpopulation in genetisch tractable Maus-Systeme ermöglichen. Tatsächlich vereinigt Abschnitte Yield hochwertiges Protein und RNA geeigneten nachgeschalteten Analyse. Zukünftige Anwendungen könnte die Untersuchung von Zellsignalwege oder Chromatinimmunpräzipitation enthalten. Es sollte jedoch beachtet werden, dass, wie einige der vorstehend beschriebenen alternativen Verfahren, enthalten die resultierenden Abschnitte eine Mischung von epithelialen und interstitielle Lamina propria Zellen sein. Im Ergebnis ist die hier beschriebene Protokoll stellt eine schnelle, hohe Ausbeute Methode für die Analyse von molekularen Prozessen in räumlich unterschiedlichen Regionen des murinen Colon-Schleimhaut.

Die Colon-Epithel ist ein hoch regenerativer Gewebe, mit Wohnsitz Stammzellen Auffüllen der Gewebe alle paar Tage ein. Dieser Prozess der Regeneration erfordert die Aufrechterhaltung einer proliferativen Stammzellkompartiments. Im Laufe der Zeit können die neu erzeugten Tochterzellen verlieren ihre proliferative Potenzial und wandern zu der luminalen Oberfläche des Darms. Gleichzeitig mit der Migration zu unterscheiden Vorläuferzellen in reife Barriere bildenden Enterozyten oder Schleimhaut produzierenden Becherzellen. Ausfall dieses Differenzierungsprogramms wird angenommen, tragen zur Epithelbarriere beeinträchtigt, wie es in entzündliche Darmerkrankungen und Kolonkrebs 2,3 beobachtet. Studieren der obigen Prozesse werden Methoden zur Isolierung von Krypta-Basis- und Oberflächenzellpopulationen erforderlich. Mehrere Methoden existieren, die jeweils mit einzigartigen Vorteilen und Nachteilen. Aktuelle Verfahren für die Isolierung von intestinalen Epithelzellen schließen CHelating Mittel sowie mechanische Dissoziation, was in der Isolierung des gesamten Krypten Epithellappen oder Einzelzellen, abhängig von den experimentellen Bedingungen 4,5. Dies sind Hochzinsmethoden, noch Änderungen der interzellulären Signalübertragung haben unter diesen Bedingungen, die nicht der nativen Umgebung 6,7 darstellen können gemeldet. Laser Mikrodissektion ermöglicht die Sammlung von Raum unterschiedlichen Material, sondern erreicht mit niedrigem Molekular Ausbeute 8,9. In menschlichen Dickdarmgewebe, haben Serien horizontal Kryoschneiden Methoden entwickelt worden 10. Allerdings sind murine Schleimhautgewebe unerschwinglich klein für die direkte Verwendung dieser Technik. Beim Menschen Darm Krypta Längen (die ferne zwischen der Krypta-Basis und Oberflächenzellen) in den Dickdarm liegt zwischen ~ 100-1000 &amp; mgr; m 11. Bei Mäusen sind crypt Längen zwischen ~ 50-300 &amp; mgr; m (siehe Abbildung 1A). Die geringe Größe der murine Krypten stellt eine Herausforderung für die isolation dieser beiden Zellpopulationen in einem der vorhandenen Protokolle. Wir beschreiben nun eine kostengünstige, High-Yield-Verfahren zur Isolierung von Krypta-Basis und Oberfläche epithelialen Zellpopulation in murinen Dickdarmgewebe. Gewebe in dieser Weise geerntet kann dann durch eine Reihe von Standard-Downstream-Anwendungen, einschließlich Immunfluoreszenzfärbung, RT-PCR (Echtzeit-Polymerase-Kettenreaktion) oder Western-Blot analysiert werden.

<table border="0" cellpadding="0" cellspacing="0">
	<tbody>
		<tr>
			<td>Microtome</td>
			<td>Leica Biosystems, Nussloch Germany</td>
			<td>CM 1510-3</td>
			<td></td>
		</tr>
		<tr>
			<td>MyiQ real time PCR detector</td>
			<td>BioRad</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>LSM 510&#160;</td>
			<td>Carl Zeiss</td>
			<td></td>
			<td>Confocal microscope</td>
		</tr>
		<tr>
			<td>Materials</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>OCT</td>
			<td>Tissue-Tek, Sakura Finetek, Torrance CA</td>
			<td>4583</td>
			<td></td>
		</tr>
		<tr>
			<td>cryo-mold</td>
			<td>Tissue-Tek, Sakura Finetek, Torrance CA</td>
			<td>4557</td>
			<td>25mmx20mmx5mm</td>
		</tr>
		<tr>
			<td>High profile microtome blade</td>
			<td>Leica Biosystems, Nussloch germany</td>
			<td>818</td>
			<td></td>
		</tr>
		<tr>
			<td>GEM industrial blades</td>
			<td>American Safety Razor Blades</td>
			<td>62-0314</td>
			<td></td>
		</tr>
		<tr>
			<td>Sylgard silicon elastomere base</td>
			<td>Dow Corning, Midland MI</td>
			<td>3097358</td>
			<td></td>
		</tr>
		<tr>
			<td>27 1/2 g needle</td>
			<td>Becton-Dickinson, Franklin Lakes, NJ</td>
			<td>305109</td>
			<td>pins for dissection</td>
		</tr>
		<tr>
			<td>TRizol</td>
			<td>Life Technologies</td>
			<td>15596018</td>
			<td></td>
		</tr>
		<tr>
			<td>Rneasy</td>
			<td>Qiagen</td>
			<td>74104</td>
			<td></td>
		</tr>
		<tr>
			<td>DNAse</td>
			<td>Qiagen</td>
			<td>79254</td>
			<td></td>
		</tr>
		<tr>
			<td>Reagents</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Antibody ZO-1</td>
			<td>Invitrogen&#160;</td>
			<td>187430</td>
			<td></td>
		</tr>
		<tr>
			<td>Antibody KLF4</td>
			<td>Cell Signaling</td>
			<td>4038S</td>
			<td></td>
		</tr>
		<tr>
			<td>Antibody mGAPDH</td>
			<td>Sigma</td>
			<td>G8795</td>
			<td></td>
		</tr>
		<tr>
			<td>Antibody Secondary Alexa conjugate</td>
			<td>Invitrogen</td>
			<td>A11034</td>
			<td>488 anti-rabbit</td>
		</tr>
		<tr>
			<td>Antibody Secondary HRP conjugate</td>
			<td>Jackson</td>
			<td>111/115-001-003</td>
			<td>rabbit/mouse&#160;</td>
		</tr>
		<tr>
			<td>Topro-3</td>
			<td>Invitrogen</td>
			<td>T3605</td>
			<td></td>
		</tr>
		<tr>
			<td>HANKs balanced salt buffer</td>
			<td>Life Technologies</td>
			<td>14025092</td>
			<td></td>
		</tr>
		<tr>
			<td>RIPA lysis buffer</td>
			<td></td>
			<td></td>
			<td>50mM Tris-HCl pH 7.4 150mM NaCl 1% NP40 0.25% Na-deoxycholate</td>
		</tr>
		<tr>
			<td>PCR Primers</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>primer TBP 3&#39;</td>
			<td></td>
			<td></td>
			<td>GGAATTGTACCGCAGCTTCAAA</td>
		</tr>
		<tr>
			<td>primer TBP 5&#39;</td>
			<td></td>
			<td></td>
			<td>GATGACTGCAGCAAATCGCTT</td>
		</tr>
		<tr>
			<td>primer KLF4 3&#39;</td>
			<td></td>
			<td></td>
			<td>TGTGACTATGCAGGCTGTGGCAAA</td>
		</tr>
		<tr>
			<td>primer KLF4 5&#39;</td>
			<td></td>
			<td></td>
			<td>ACAGTGGTAAGGTTTCTCGCCTGT</td>
		</tr>
	</tbody>
</table>

cryosectioning method for microdissection of murine colonic mucosa

The colonic mucosal tissue provides a vital barrier to luminal antigens. This barrier is composed of a monolayer of simple columnar epithelial cells. The colonic epithelium is dynamically turned over and epithelial cells are generated in the stem cell containing crypts of Lieberk&#252;hn. Progenitor cells produced in the crypt-bases migrate toward the luminal surface, undergoing a process of cellular differentiation before being shed into the gut lumen. In order to study these processes at the molecular level, we have developed a simple method for the microdissection of two spatially distinct regions of the colonic mucosa; the proliferative crypt zone, and the differentiated surface epithelial cells. Our objective is to isolate specific crypt and surface epithelial cell populations from mouse colonic mucosa for the isolation of RNA and protein.

Dickdarmgewebeschnitte wurden für die histologische Beurteilung und H &amp; E Färbung 13 verarbeitet. Eine traditionelle Querschnittsansicht der Schleimhaut ist in 2A gesehen. Basal-Bereiche enthalten die Muscularis externa, vor allem der Kreis muscularis besteht. Ausgehend Richtung der Lumen ist die Muscularis mucosa verständlich neben dem Krypta-Basis Epithelzellen, sind Übergangszellen in der Mitte des Gewebes und schließlich Oberfläche Zellpopulationen konfrontiert das Darmlumen. Die hier beschriebene serielle Schnittverfahren unterhält eine Orientierung, so dass die Längs- und Rund muscularis zuerst angetroffen (2B), gefolgt von der Muscularis mucosa (2C). Beachten Sie die Darstellung der Nicht-Muskel interstitieller Zellen in der linken oberen Ecke des Bildes. Für die unten beschriebenen abwärts Analyse werden Muskelabschnitte verworfen. Die folgenden Abschnitte enthalten Epithelzellen und Zwischengewebe (Lamina propria), Mit Krypta-Basiszellen (2D). Bemerke die Abwesenheit eines zentralen Lumens in den meisten der Krypten, die dunkler erscheinen aufgrund der eng gepackten Kernen. Diese Schichten enthalten die proliferative Fach. Die Übergangs Zellen erscheinen als dicht gepackte Drüsen mit prominenten zentralen Lumen (2E). Schließlich Oberfläche Zellpopulationen eine unregelmäßige Struktur mit Bereichen des epithelialen Mono angesehen en face (2F). Serienschnitte, wie oben beschrieben, können auch für die Immunfluoreszenz Kennzeichnung und konfokale Mikroskopie verarbeitet werden (wie hier 14 beschrieben). 2G zeigt isolierten Krypten fixiert und in 100% Methanol permeabilisiert und anschließend für Kerne (blau) und der Zell-Zell-junction-Protein Zonula gefärbten occludens 1 (ZO-1, grün). In der traditionellen Schnitte Orientierung kann Krypta und Oberflächenzelle gleichzeitig angezeigt werden (Abbildung 2G </strong&gt;). Beachten Sie, dass die ZO-1 junctional Fleck Linien das Lumen des Darm Krypta. Diese Z0-1 Auskleidung des Lumens können auch in serieller Schnittproben von Übergangszellpopulationen zu erkennen ist, in der Mitte der kreisförmigen Drüsen (Figur 2G). Verbesserte ZO-1-Färbung wird in Oberflächenzellpopulationen (2I und J) zu sehen. Mehrere Differenzierungsfaktoren sind bekannt, in einem räumlich-zeitliche Art und Weise entlang der Krypta-zu-Oberfläche-Achse ausgedrückt werden. Dies schließt den Transkriptionsfaktor Kruppel artigen Faktor 4 (KLF4), die dafür bekannt ist, in der Oberflächenzellpopulationen angereichert werden. Mit herkömmlichen Schneideverfahren wird KLF4 in den Kernen der Lumen zugewandte Oberfläche Zellpopulationen (2k) gefunden. Wir haben daher vermutet, dass KLF4 mRNA würden vorwiegend in der Oberflächenzellpopulationen exprimiert werden. Um dies zu testen, wurden Serienschnitte gesammelt und in Oberflächenwasser, Übergangs- und Krypta-Basis Proben gruppiert. Subsequently, RNA wurde mit Trizol Standardextraktion geerntet, mit einer zusätzlichen Reinigung durch RNeasy Säule und DNAse-Behandlung. RNA wurde aus 5 gesammelt aufeinanderfolgende Abschnitte, die zwischen 5-10 ug Gesamt-RNA pro Probe ergab gesammelt. Diese Proben wurden dann auf semi-quantitative Echtzeit-PCR sowohl KLF4 und eines Referenzgens, TATA Box-Bindungsprotein 1 (TBP-1) (2L) 14 unterzogen. Wie in Figur 2L gezeigt ist, nach der Normalisierung zu TBP-1 wurden Oberflächenzellen bis zu 8-fache der KLF4 mRNA, die in Krypta-Zellen exprimiert wird, auszudrücken. In ähnlicher Weise wurden KLF4 Proteinspiegel festgestellt, dass räumliche Regelung entlang der Krypta-Flächenachse aufweisen. Serielle Schnitte wurden wie oben für 20 min bei 4 ° C beschrieben, und dann in Lysepuffer gepoolt. Dies ergab 200-250 ug Protein pro Probe. Proben wurden dann Analyse durch SDS-PAGE (2M) 15 unterzogen. Wie in Fig 2M gezeigt KLF4 protein Ebenen sind dramatisch in Oberflächenzellpopulationen höher. Die obigen Ergebnisse zeigen die Fähigkeit dieses Protokoll, um große Mengen von Oberflächen Krypta Epithelzellen aus dem murinen Kolonschleimhaut isolieren. <img alt="Abbildung 1" src="/files/ftp_upload/53112/53112fig1.jpg" /> Figur 1: (A) schematische Darstellung murine Colon-Mucosa und äußeren Muskelschichten. Unsere Methode zielt darauf ab, diskrete Oberflächenzelle und Krypta-Basiszellpopulationen durch serielle Kryoschneiden (jeweils 10 &amp; mgr; m) zu sammeln. Die äußeren Muskelschichten werden verworfen. (B) Crypt Höhe entlang der Länge des Dickdarms (Abstand zwischen Krypta-Basis und Deckschichten). Datenpunkte zeigen einzelne Krypta Messungen und Symbole zeigen biologischen Wiederholungen (n = 4). (C) Colon Segmente gesammelt, halbiert, und auf einen Silicium Sezieren Gericht festgesteckt. (D) Ein Gewebe segment etwa 3 cm vom Anus zwischen zu Rasierklingen gedrückt wird und das auf Trockeneis gefroren. (E) Das Gewebe wird dann auf eine vorge nivelliert Oktober Block montiert. (F) Kryoschnitte entnommen und visuell untersucht. <img alt="Figur 2" src="/files/ftp_upload/53112/53112fig2.jpg" /> Abb. 2: Repräsentative Daten (A) Dickdarmgewebe mit Hämatoxylin-Eosin gefärbt im Querschnitt, die die kreisförmige muscularis (cm), die Muscularis mucosa (mm), Krypta-Basiszellen, Übergangszellen und Oberflächenzellen. (B - C) Darmmuskelschichten. (D) Crypt-Basiszellen. Bemerke die Abwesenheit eines zentralen Lumens. (E) Transitional-Zellen. (F) Oberflächenzellen. (G) Immunfluoreszenzfärbung von isolierten Kolonkrypten. ZO-1 (grün) und Zellkerne (blau) sind im Querschnitt beobachtet. (HALLO) ZO-1 und Kernfärbung in Übergangs- und Oberflächenzellen. (J) vergrößerte Ansicht ZO-1-Färbung. (K) KLF4 (grün) in Oberflächenzellpopulationen angereichert. (L) Real-time PCR Beurteilung KLF4 mRNA-Spiegel zwischen den drei Kammern. (M) Western Blot-Analyse von Protein KLF4 Niveau in diesen Zellpopulationen.

Watch this Scientific Journal Video about Cryosectioning Method for Microdissection of Murine Colonic Mucosa at JoVE.com

Cryosectioning Method for Microdissection of Murine Colonic Mucosa

Here we describe a simple method for the isolation of spatially distinct murine colonic epithelial surface cells from the underlying crypt-base cells.

Kryoschneiden Verfahren zur Mikrodissektion von Murine Kolonschleimhaut

The colonic mucosal tissue provides a vital barrier to luminal antigens. This barrier is composed of a monolayer of simple columnar epithelial cells. The ...

cryosectioning-method-for-microdissection-of-murine-colonic-mucosa

Research

JoVE Journal

Biology

17.2K Aufrufe.  Emory University, Atlanta, Georgia. Here we describe a simple method for the isolation of spatially distinct murine colonic epithelial surface cells from the underlying crypt-base cells.

Serie: Cryosectioning Method for Microdissection of Murine Colonic Mucosa

Flash Freezing and Cryosectioning E12.5 Mouse Brain

Demonstrated in this video are the techniques for flash freezing and sectioning embryonic brain tissue from mouse. Useful tips for using the cryostat are given, including troubleshooting methods that can be used while cutting to ensure that the resultant tissues sections are free of cracks and other distortions.

Flash-Freezing und Kryoschneiden E12.5 Gehirn der Maus

Forschung

Biologie

Laser Capture Microdissection of Mammalian Tissue

Laser capture microscopy, also known as laser microdissection (LMD), enables the user to isolate small numbers of cells or tissues from frozen or formalin-fixed, paraffin-embedded tissue sections. LMD techniques rely on a thermo labile membrane placed either on top of, or underneath, the tissue section. In one method, focused laser energy is used to melt the membrane onto the underlying cells, which can then be lifted out of the tissue section. In the other, the laser energy vaporizes the foil along a path "drawn" on the tissue, allowing the selected cells to fall into a collection device. Each technique allows the selection of cells with a minimum resolution of several microns. DNA, RNA, protein, and lipid samples may be isolated and analyzed from micro-dissected samples. In this video, we demonstrate the use of the Leica AS-LMD laser microdissection instrument in seven segments, including an introduction to the principles of LMD, initializing the instrument for use, general considerations for sample preparation, mounting the specimen and setting up capture tubes, aligning the microscope, adjusting the capture controls, and capturing tissue specimens. Laser-capture micro-dissection enables the investigator to isolate samples of pure cell populations as small as a few cell-equivalents. This allows the analysis of cells of interest that are free of neighboring contaminants, which may confound experimental results.

Laser Capture Mikrodissektion von Säugetiergewebe

Laser capture microscopy, also known as laser microdissection (LMD), enables the user to isolate small numbers of cells or tissues from frozen or ...

Microdissection of Zebrafish Embryonic Eye Tissues

Zebrafish is a popular animal model for research on eye development because of its rapid ex utero development and good fecundity. By 3 days post fertilization (dpf), the larvae will show the first visual response. Many genes have been identified to control a proper eye development, but we are far from a complete understanding of the underlying genetic architecture. Whole genome gene expression profiling is a useful tool to elucidate genetic regulatory network for eye development. However, the small size of the embryonic eye in zebrafish makes it challenging to obtain intact and pure eye tissues for expression analysis. For example, the anterior-posterior length of the eye between day 2 and 3 is only approximately 200-300 &mu;m, while the diameter of the lens is less 100 &mu;m. Also, the retinal pigment epithelium (RPE) underlying the retina is just a single-layer epithelium. While gene expression profiles can be obtained from the whole embryo, they do not accurately represent the expression of these tissues. Therefore pure tissue must be obtained for a successful gene expression profiling of eye development. To address this issue, we have developed an approach to microdissect intact retina and retina with RPE attached from 1-3 dpf, which cover major stages of eye morphogenesis. All procedures can be done with fine forceps and general laboratory supplies under standard stereomicroscopes. For retinal dissection, the single-layer RPE is removed and peeled off by brushing action and the preferential adherence of the RPE remnants to the surface of the culture plate for dissection. For RPE-attached retinal dissection, the adherence of RPE to the dissection plate is removed before the dissection so that the RPE can be completely preserved with the retina. A careful lifting action of this tissue can efficiently separate the presumptive choroid and sclera. The lens can be removed in both cases by a chemically etched tungsten needle. In short, our approach can obtain intact eye tissues and has been successfully utilized to study tissue-specific expression profiles of zebrafish retina1, 2 and retinal pigment epithelium3.

This article describes an approach to microdissect zebrafish retinas with and without retinal pigment epithelium attached, from one to three days postfertilization embryos.

Mikrodissektion von Zebrafisch Embryonale Augentücher

Zebrafish is a popular animal model for research on eye development because of its rapid ex utero development and good fecundity. By 3 days post ...

Microdissection of Black Widow Spider Silk-producing Glands

Modern spiders spin high-performance silk fibers with a broad range of biological functions, including locomotion, prey capture and protection of developing offspring 1,2. Spiders accomplish these tasks by spinning several distinct fiber types that have diverse mechanical properties. Such specialization of fiber types has occurred through the evolution of different silk-producing glands, which function as small biofactories. These biofactories manufacture and store large quantities of silk proteins for fiber production. Through a complex series of biochemical events, these silk proteins are converted from a liquid into a solid material upon extrusion.
Mechanical studies have demonstrated that spider silks are stronger than high-tensile steel 3. Analyses to understand the relationship between the structure and function of spider silk threads have revealed that spider silk consists largely of proteins, or fibroins, that have block repeats within their protein sequences 4. Common molecular signatures that contribute to the incredible tensile strength and extensibility of spider silks are being unraveled through the analyses of translated silk cDNAs. Given the extraordinary material properties of spider silks, research labs across the globe are racing to understand and mimic the spinning process to produce synthetic silk fibers for commercial, military and industrial applications. One of the main challenges to spinning artificial spider silk in the research lab involves a complete understanding of the biochemical processes that occur during extrusion of the fibers from the silk-producing glands.
Here we present a method for the isolation of the seven different silk-producing glands from the cobweaving black widow spider, which includes the major and minor ampullate glands [manufactures dragline and scaffolding silk] 5,6, tubuliform [synthesizes egg case silk] 7,8, flagelliform [unknown function in cob-weavers], aggregate [makes glue silk], aciniform [synthesizes prey wrapping and egg case threads] 9 and pyriform [produces attachment disc silk] 10. This approach is based upon anesthetizing the spider with carbon dioxide gas, subsequent separation of the cephalothorax from the abdomen, and microdissection of the abdomen to obtain the silk-producing glands. Following the separation of the different silk-producing glands, these tissues can be used to retrieve different macromolecules for distinct biochemical analyses, including quantitative real-time PCR, northern- and western blotting, mass spectrometry (MS or MS/MS) analyses to identify new silk protein sequences, search for proteins that participate in the silk assembly pathway, or use the intact tissue for cell culture or histological experiments.

Here we describe an efficient strategy to remove the silk-producing glands from the abdomen of female black widow spiders. This procedure allows the rapid isolation of the seven distinct silk-producing glands in a highly purified fashion, an important process for investigators studying spider silk production and fiber assembly.

Mikrodissektion von Black Widow Spider Silk-produzierenden Drüsen

Modern spiders spin high-performance silk fibers with a broad range of biological functions, including locomotion, prey capture and protection of ...

A Novel Method for the Culture and Polarized Stimulation of Human Intestinal Mucosa Explants

Few models currently exist to realistically simulate the complex human intestine's micro-environment, where a variety of interactions take place. Proper homeostasis directly depends on these interactions, as they shape an entire immunological response inducing tolerance against food antigens while at the same time mounting effective immune responses against pathogenic microbes accidentally ingested with food.
Intestinal homeostasis is preserved also through various complex interactions between the microbiota (including food-associated beneficial bacterial strains) and the host, that regulate the attachment/degradation of mucus, the production of antimicrobial peptides by the epithelial barrier, and the "education" of epithelial cells' that controls the tolerogenic or immunogenic phenotype of unique, gut-resident lymphoid cells' populations. These interactions have been so far very difficult to reproduce with in vitro assays using either cultured cell lines or peripheral blood mononuclear cells. In addition, mouse models differ substantially in components of the intestinal mucosa (mucus layer organization, commensal bacteria community) with respect to the human gut. Thus, studies of a variety of treatments to be brought in the clinics for important stress-related or pathological conditions such as irritable bowel syndrome, inflammatory bowel disease or colorectal cancer have been difficult to carry out.
To address these issues, we developed a novel system that enables us to stimulate explants of human intestinal mucosa that retain their in situ conditioning by the host microbiota and immune response, in a polarized fashion. Polarized apical stimulation is of great importance for the outcome of the elicited immune response. It has been repeatedly shown that the same stimuli can produce completely different responses when they bypass the apical face of the intestinal epithelium, stimulating epithelial cells basolaterally or coming into direct contact with lamina propria components, switching the phenotype from tolerogenic to immunogenic and causing unnecessary and excessive inflammation in the area.
We achieved polarized stimulation by gluing a cave cylinder which delimited the area of stimulation on the apical face of the mucosa as will be described in the protocol. We used this model to examine, among others, differential effects of three different Lactobacilli strains. We show that this model system is very powerful to assess the immunomodulatory properties of probiotics in healthy and disease conditions.

We introduce a novel method for the maintenance of human intestinal mucosa in culture and monitoring of the response to various types of stimuli over at least 24 hrs. With our method, the polarity of the tissue is maintained, allowing for a physiological stimulation via the apical route.

Eine neue Methode für die Kultur und polarisierte Stimulation der menschlichen Darmschleimhaut Explantate

Few models currently exist to realistically simulate the complex human intestine's micro-environment, where a variety of interactions take place. Proper ...

Cryosectioning Yeast Communities for Examining Fluorescence Patterns

Microbes typically live in communities. The spatial organization of cells within a community is believed to impact the survival and function of the community1. Optical sectioning techniques, including confocal and two-photon microscopy, have proven useful for observing spatial organization of bacterial and archaeal communities2,3. A combination of confocal imaging and physical sectioning of yeast colonies has revealed internal organization of cells4. However, direct optical sectioning using confocal or two-photon microscopy has been only able to reach a few cell layers deep into yeast colonies. This limitation is likely because of strong scattering of light from yeast cells4.
Here, we present a method based on fixing and cryosectioning to obtain spatial distribution of fluorescent cells within Saccharomyces cerevisiae communities. We use methanol as the fixative agent to preserve the spatial distribution of cells. Fixed communities are infiltrated with OCT compound, frozen, and cryosectioned in a cryostat. Fluorescence imaging of the sections reveals the internal organization of fluorescent cells within the community.
Examples of yeast communities consisting of strains expressing red and green fluorescent proteins demonstrate the potentials of the cryosectioning method to reveal the spatial distribution of fluorescent cells as well as that of gene expression within yeast colonies2,3. Even though our focus has been on Saccharomyces cerevisiae communities, the same method can potentially be applied to examine other microbial communities.

We present a protocol for freezing and cryosectioning yeast communities to observe internal patterns of fluorescent cells. The method relies on methanol-fixing and OCT-embedding to preserve the spatial distribution of cells without inactivating fluorescent proteins within a community.

Kryoschneiden Hefe Gemeinschaften für die Prüfung Fluoreszenzmuster

Microbes typically live  in communities. The spatial organization  of cells within a community is believed to impact the survival and function of the  ...

Isolation of Murine Valve Endothelial Cells

Normal valve structures consist of stratified layers of specialized extracellular matrix (ECM) interspersed with valve interstitial cells (VICs) and surrounded by a monolayer of valve endothelial cells (VECs). VECs play essential roles in establishing the valve structures during embryonic development, and are important for maintaining life-long valve integrity and function. In contrast to a continuous endothelium over the surface of healthy valve leaflets, VEC disruption is commonly observed in malfunctioning valves and is associated with pathological processes that promote valve disease and dysfunction. Despite the clinical relevance, focused studies determining the contribution of VECs to development and disease processes are limited. The isolation of VECs from animal models would allow for cell-specific experimentation. VECs have been isolated from large animal adult models but due to their small population size, fragileness, and lack of specific markers, no reports of VEC isolations in embryos or adult small animal models have been reported. Here we describe a novel method that allows for the direct isolation of VECs from mice at embryonic and adult stages. Utilizing the Tie2-GFP reporter model that labels all endothelial cells with Green Fluorescent Protein (GFP), we have been successful in isolating GFP-positive (and negative) cells from the semilunar and atrioventricular valve regions using fluorescence activated cell sorting (FACS). Isolated GFP-positive VECs are enriched for endothelial markers, including CD31 and von Willebrand Factor (vWF), and retain endothelial cell expression when cultured; while, GFP-negative cells exhibit molecular profiles and cell shapes consistent with VIC phenotypes. The ability to isolate embryonic and adult murine VECs allows for previously unattainable molecular and functional studies to be carried out on a specific valve cell population, which will greatly improve our understanding of valve development and disease mechanisms.

The ability to isolate heart valve endothelial cells (VECs) is critical for understanding mechanisms of valve development, maintenance, and disease. Here we describe the isolation of VECs from embryonic and adult Tie2-GFP mice using FACS that will allow for studies determining the contribution of VECs in developmental and disease processes.

Isolierung von murinen Ventil Endothelzellen

Normal valve structures consist of stratified layers of specialized extracellular matrix (ECM) interspersed with valve interstitial cells (VICs) and ...

Laser-assisted Microdissection (LAM) as a Tool for Transcriptional Profiling of Individual Cell Types

The understanding of developmental processes at the molecular level requires insights into transcriptional regulation, and thus the transcriptome, at the level of individual cell types. While the methods described here are generally applicable to a wide range of species and cell types, our research focuses on plant reproduction. Plant cultivation and seed production is of crucial importance for human and animal nutrition. A detailed understanding of the regulatory networks that govern the formation of the reproductive lineage (germline) and ultimately of seeds is a precondition for the targeted manipulation of plant reproduction. In particular, the engineering of apomixis (asexual reproduction through seeds) into crop plants promises great improvements, as it leads to the formation of clonal seeds that are genetically identical to the mother plant. Consequently, the cell types of the female germline are of major importance for the understanding and engineering of apomixis. However, as the corresponding cells are deeply embedded within the floral tissues, they are very difficult to access for experimental analyses, including cell-type specific transcriptomics. To overcome this limitation, sections of individual cells can be isolated by laser-assisted microdissection (LAM). While LAM in combination with transcriptional profiling allows the identification of genes and pathways active in any cell type with high specificity, establishing a suitable protocol can be challenging. Specifically, the quality of RNA obtained after LAM can be compromised, especially when small, single cells are targeted. To circumvent this problem, we have established a workflow for LAM that reproducibly results in high RNA quality that is well suitable for transcriptomics, as exemplified here by the isolation of cells of the female germline in apomictic Boechera. In this protocol, procedures are described for tissue preparation and LAM, also with regard to RNA extraction and quality control.

Laser-assisted Microdissection LAM as a Tool for Transcriptional Profiling of Individual Cell Types

Here we present a protocol for laser-assisted microdissection of specific plant cell types for transcriptional profiling. While the protocol is suitable for different species and cell types, the focus is on highly inaccessible cells of the female germline important for sexual and apomictic reproduction in the crucifer genus Boechera.

Lasergestützte Mikrodissektion (LAM) als Werkzeug für die Transkriptionsprofilierung einzelner Zelltypen

The understanding of developmental processes at the molecular level requires insights into transcriptional regulation, and thus the transcriptome, at the ...

Cryosectioning of Contiguous Regions of a Single Mouse Skeletal Muscle for Gene Expression and Histological Analyses

With this method, consecutive cryosections are collected to enable both microscopy applications for tissue histology and enrichment of RNA for gene expression using adjacent regions from a single mouse skeletal muscle. Typically, it is challenging to achieve adequate homogenization of small skeletal muscle samples because buffer volumes may be too low for efficient grinding applications, yet without sufficient mechanical disruption, the dense tissue architecture of muscle limits penetration of buffer reagents, ultimately causing low RNA yield. By following the protocol reported here, 30 &#956;m sections are collected and pooled allowing cryosectioning and subsequent needle homogenization to mechanically disrupt the muscle, increasing the surface area exposed for buffer penetration. The primary limitations of the technique are that it requires a cryostat, and it is relatively low throughput. However, high-quality RNA can be obtained from small samples of pooled muscle cryosections, making this method accessible for many different skeletal muscles and other tissues. Furthermore, this technique enables matched analyses (e.g., tissue histopathology and gene expression) from adjacent regions of a single skeletal muscle so that measurements can be directly compared across applications to reduce experimental uncertainty and to reduce replicative animal experiments necessary to source a small tissue for multiple applications.

Consecutive cryo-sections are collected to enable histological applications and enrichment of RNA for gene expression measurements using adjacent regions from a single mouse skeletal muscle. High-quality RNA is obtained from 20 - 30 mg of pooled cryosections and measurements are directly compared across applications.

Kryoschneiden von benachbarten Regionen eines einzelnen Maus Skelettmuskel für die Genexpression und histologische Analysen

With this method, consecutive cryosections are collected to enable both microscopy applications for tissue histology and enrichment of RNA for gene ...

A Morphometric and Cellular Analysis Method for the Murine Mandibular Condyle

The temporomandibular joint (TMJ) has the capacity to adapt to external stimuli, and loading changes can affect the position of condyles, as well as the structural and cellular components of the mandibular condylar cartilage (MCC). This manuscript describes methods for analyzing these changes and a method for altering the loading of the TMJ in mice (i.e., compressive static TMJ loading). The structural evaluation illustrated here is a simple morphometric approach that uses the Digimizer software and is performed in radiographs of small bones. In addition, the analysis of cellular changes leading to alterations in collagen expression, bone remodeling, cell division, and proteoglycan distribution in the MCC is described. The quantification of these changes in histological sections - by counting the positive fluorescent pixels using image software and measuring the distance mapping and stained area with Digimizer - is also demonstrated. The methods shown here are not limited to the murine TMJ, but could be used on additional bones of small experimental animals and in other regions of endochondral ossification.

This manuscript presents methods for analyzing morphometric and cellular changes within the mandibular condyle of rodents.

Eine morphometrische und zelluläre Analysemethode für das Murine mandibulares Kondylus

The temporomandibular joint (TMJ) has the capacity to adapt to external stimuli, and loading changes can affect the position of condyles, as well as the ...