The authors thank the Lerner Research Institute proteomic, genomic, and imaging cores for their assistance and support. Funding: This work was financially supported by NIH/NCI grant R00 CA172292 (to J.J.Z.) and start-up funds (to J.J.Z.) and the Clinical and Translational Science Collaborative (CTSC) of Case Western Reserve University Core Utilization Pilot Grant (to J.J.Z.). This work utilized the Leica SP8 confocal microscope that was purchased with funding from National Institutes of Health SIG grant 1S10OD019972-01.

All experiments involving animals were pre-approved by the Cleveland Clinic IACUC (Institutional Animal Care and Use Committee).
1. Synthesis of Functionalized SWCNTs
<ol>
	<li>Mix 1 mg of SWCNTs, 5 mg of DSPE-PEG2000-Amine, and 5 mL of sterilized nuclease-free water in a glass scintillation vial (20 mL). Shake it well to dissolve all reagents completely.</li>
	<li>Sonicate the vial in a water bath sonicator at a power level of 40 W for 1 h at room temperature (RT, 20 min x 3, change the water every 20 min to avoid overheating). Then, centrifuge it at 24,000 x g for 6 h and collect the supernatant solution. This functional SWCNT solution can be stored at 4 &#176;C for 2 months.</li>
	<li>Add 1 mL of SWCNT solution from step 1.2 to a 100 kDa MWCO centrifugal filter device, followed by 4 mL of sterilized nuclease-free water. Centrifuge for 10 min at 4,000 x g at RT to remove extra DSPE-PEG2000-amine. Repeat the addition of 4 mL of water and the centrifugation 5x. More than 0.5 mL of leftover SWCNT solution will be left in the filter after each centrifugation.</li>
	<li>Measure the concentration of the SWCNT solution leftover in the filter using a UV/VIS spectrometer at 808 nm after the final wash. The final concentration is typically about 50 mg/L (calculated according to the method developed by Kam et al.18). 
	NOTE: Ensure that DSPE-PEG-functionalized SWCNTs are water-soluble after step 1.4 and are stable in different biological solutions without visible aggregation after a few weeks.</li>
</ol>
2. Conjugation of Anti-MALAT1 Gapmer DNA Flanked by 2&#39;-O Modified RNAs to Functionalized SWCNT
<ol>
	<li>Add 0.5 mg of Sulfo-LC-SPDP into 450 &#181;L of DSPE-PEG2000-amine functionalized SWCNT. Add 50 &#181;L of 10x PBS and then incubate for 2 h at RT.</li>
	<li>To remove extra Sulfo-LC-SPDP, add the reaction from step 2.1 to a 100 kDa MWCO centrifugal filter device, followed by 4 mL of nuclease-free water. Centrifuge for 10 min at 4,000 x g at RT. Repeat the addition of 4 mL of water and the centrifugation 5x.</li>
	<li>Add 200 nM thiol-modified anti-MALAT1-Cy3 gapmer DNA into 1.5 mL of commercial DTT solution and incubate for 90 min at RT. Purify the product with a NAP-5 column, following the manufacturer&#39;s protocol. Elute the anti-MALAT1-Cy3 with 500 &#181;L of sterilized nuclease-free 1x PBS. 
	NOTE: The functionalized SWCNT can be stored with added DTT, which might cleave disulfide bonds formed during the storage of the thiolated anti-MALAT1 gapmer DNA. The added DTT can be removed by aNAP-5 column before conjugation with SWCNT.</li>
	<li>Collect the sulfo-LC-SPDP-treated DSPE-PEG2000-amine SWCNT solution left in the filter and dilute it with 500 &#181;L of anti-MALAT1-Cy3 solution. Then, incubate it at 4 &#176;C for 24 h. The conjugated SWCNT-anti-MALAT1 can be stored at 4 &#176;C for 3 weeks.&#160;Following the same procedure, the conjugated SWCNT with scramble antisense oligo can be synthesized and used as SWCNT-control.</li>
</ol>
3. Tail Vein Injection of SWCNT-Anti-MALAT1
<ol>
	<li>Generate an MM disseminated mouse model.
	<ol>
		<li>To achieve the best results of comparison, randomly arrange 14 NOD.CB17-Prkdcscid/J mice (8 weeks old) into trial or control groups (seven in each group) with the same male/female ratio.</li>
		<li>Clean the operation bench and sterilize it with 70% alcohol.</li>
		<li>Use a heating lamp to warm the mouse to help the tail vein to appear.Restrain the mouse properly with a tail injection restrainer.</li>
		<li>Inject 5 x 106&#160;MM.1S-Luc-mCherry cells in 50 &#181;L of PBS through the tail vein without anesthesia. Press the injection site with an alcohol swab for 30 s. Mark the injected mouse and return it to a clean cage.</li>
	</ol>
	</li>
	<li>Start the treatment on day 7 after the MM.1S cell injection.
	<ol>
		<li>Inject 50 &#181;L of PBS containing SWCNT-anti-MALAT1 into the tail vein of the mouse. Use PBS containing SWCNT-control as a control.</li>
		<li>Press the injection site with an alcohol swab for 30 s.</li>
		<li>Observe the local bleeding on the tail and the general behavior of the mouse for 1 min, and then return it to a clean cage. Observe all injected mice again before returning the cage to the rack, to make sure that the injections are tolerated well.</li>
	</ol>
	</li>
	<li>Repeat the injection every 7 days until the termination of the experiment.
	<ol>
		<li>Terminate the experiment when the general health of the mouse degrades: when not eating or drinking, the appearance of pale paws, any subcutaneous bleeding, a shortness of breath, decreased activity, a paralysis of the lower limbs, and/or a touchable mass in the abdomen is observed.</li>
	</ol>
	</li>
</ol>
4. Evaluation of the Disease Progression
<ol>
	<li>Assess the general status of the mice every day after the MM.1S-Luc-mCherry cell injection. Pay particular attention if the mice develop paralyzes of lower limbs.</li>
	<li>Evaluate the tumor growth using an in vivo imaging system 1x a week, before the SWCNT-anti-MALAT1 injection.
	<ol>
		<li>Prepare fresh 15 mg/mL D-Luciferin with 1x PBS.</li>
		<li>Anesthetize the mice with an isoflurane vaporizer (3&#8211;5% for induction and 1&#8211;3% for maintenance, depending on the status of the mice).</li>
		<li>Inject 150 mg/kg D-Luciferin in each mouse intraperitoneally, 5 min before imaging; then, image the mice in a prone position with an spectrum imaging system.</li>
		<li>Collect sequential images of the mice every 2 min, until luminescence saturation is reached. Adjust the interval time according to the D-Luciferin uptake/signal.</li>
	</ol>
	</li>
	<li>Use CO2 to sacrifice the mice once the termination of the experiment is reached.</li>
	<li>Since this is an MM disseminated model, process the mice as follows.
	<ol>
		<li>Weigh the mouse before dissection.</li>
		<li>Collect peripheral blood from the heart for a complete blood count (CBC) assay performed by a blood cell counter machine. The counts of white blood cells and red blood cells, as well as the ratio of lymphocytes, are the primary indexes.</li>
		<li>Isolate the spleen and weigh it. Calculate the ratio of spleen/body weight; consider &#62;0.5% as spleen enlargement.</li>
		<li>Collect the tissues of bone marrow, spleen, lymph node, kidney, and the tissue with visible metastasis.</li>
		<li>Collect the spine if the mouse developed a paralysis of the lower limbs.</li>
		<li>Extract RNA and protein from the bone marrow samples.</li>
		<li>Fix all remaining tissues in formalin.</li>
		<li>For decalcification, immerse the bone samples in 0.25 M EDTA solution (pH 8.0) for 5 days after 24 h of fixation.</li>
		<li>Immerse all samples in 75% alcohol for long-term storage.</li>
	</ol>
	</li>
	<li>Compare the signal strength of luciferase at the same time points in two groups. From both groups, record the sacrifice dates of each mouse and calculate the survival curves of the two groups with software. 
	NOTE: All procedures are summarized in Figure 1.</li>
</ol>

<ol><li>Jiang, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((RNase+non-sensitive+and+endocytosis+independent+siRNA+delivery+system%3A+delivery+of+siRNA+into+tumor+cells+and+high+efficiency+induction+of+apoptosis%5BTitle%5D)+AND+%22Nanoscale%22%5BJournal%5D)">RNase non-sensitive and endocytosis independent siRNA delivery system: delivery of siRNA into tumor cells and high efficiency induction of apoptosis.</a> Nanoscale. 5 (16), 7256-7264 (2013).</li>
<li>Murakami, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Water-dispersed+single-wall+carbon+nanohorns+as+drug+carriers+for+local+cancer+chemotherapy%5BTitle%5D)+AND+%22Nanomedicine+%28Lond%29%22%5BJournal%5D)">Water-dispersed single-wall carbon nanohorns as drug carriers for local cancer chemotherapy.</a> Nanomedicine (Lond). 3 (4), 453-463 (2008).</li>
<li>Kam, N. W., Dai, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Carbon+nanotubes+as+intracellular+protein+transporters%3A+generality+and+biological+functionality%5BTitle%5D)+AND+%22Journal+of+the+American+Chemical+Society%22%5BJournal%5D)">Carbon nanotubes as intracellular protein transporters: generality and biological functionality.</a> Journal of the American Chemical Society. 127 (16), 6021-6026 (2005).</li>
<li>Kam, N. W., Liu, Z., Dai, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Functionalization+of+carbon+nanotubes+via.+cleavable+disulfide+bonds+for+efficient+intracellular+delivery+of+siRNA+and+potent+gene+silencing%5BTitle%5D)+AND+%22Journal+of+the+American+Chemical+Society%22%5BJournal%5D)">Functionalization of carbon nanotubes via. cleavable disulfide bonds for efficient intracellular delivery of siRNA and potent gene silencing.</a> Journal of the American Chemical Society. 127 (36), 12492-12493 (2005).</li>
<li>Kam, N. W., Liu, Z., Dai, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Carbon+nanotubes+as+intracellular+transporters+for+proteins+and+DNA%3A+an+investigation+of+the+uptake+mechanism+and+pathway%5BTitle%5D)+AND+%22Angewandte+Chemie+International+Edition+in+English%22%5BJournal%5D)">Carbon nanotubes as intracellular transporters for proteins and DNA: an investigation of the uptake mechanism and pathway.</a> Angewandte Chemie International Edition in English. 45 (4), 577-581 (2006).</li>
<li>Ntziachristos, P., Abdel-Wahab, O., Aifantis, I. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Emerging+concepts+of+epigenetic+dysregulation+in+hematological+malignancies%5BTitle%5D)+AND+%22Nature+Immunology%22%5BJournal%5D)">Emerging concepts of epigenetic dysregulation in hematological malignancies.</a> Nature Immunology. 17 (9), 1016-1024 (2016).</li>
<li>Evans, J. R., Feng, F. Y., Chinnaiyan, A. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((The+bright+side+of+dark+matter%3A+lncRNAs+in+cancer%5BTitle%5D)+AND+%22Journal+of+Clinical+Investigation%22%5BJournal%5D)">The bright side of dark matter: lncRNAs in cancer.</a> Journal of Clinical Investigation. 126 (8), 2775-2782 (2016).</li>
<li>Ronchetti, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Distinct+lncRNA+transcriptional+fingerprints+characterize+progressive+stages+of+multiple+myeloma%5BTitle%5D)+AND+%22Oncotarget%22%5BJournal%5D)">Distinct lncRNA transcriptional fingerprints characterize progressive stages of multiple myeloma.</a> Oncotarget. 7 (12), 14814-14830 (2016).</li>
<li>Wong, K. Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Epigenetic+silencing+of+a+long+non-coding+RNA+KIAA0495+in+multiple+myeloma%5BTitle%5D)+AND+%22Molecular+Cancer%22%5BJournal%5D)">Epigenetic silencing of a long non-coding RNA KIAA0495 in multiple myeloma.</a> Molecular Cancer. 14, 175(2015).</li>
<li>Schmidt, L. H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((The+long+noncoding+MALAT-1+RNA+indicates+a+poor+prognosis+in+non-small+cell+lung+cancer+and+induces+migration+and+tumor+growth%5BTitle%5D)+AND+%22Journal+of+Thoracic+Oncology%22%5BJournal%5D)">The long noncoding MALAT-1 RNA indicates a poor prognosis in non-small cell lung cancer and induces migration and tumor growth.</a> Journal of Thoracic Oncology. 6 (12), 1984-1992 (2011).</li>
<li>Ji, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((MALAT-1%2C+a+novel+noncoding+RNA%2C+and+thymosin+beta4+predict+metastasis+and+survival+in+early-stage+non-small+cell+lung+cancer%5BTitle%5D)+AND+%22Oncogene%22%5BJournal%5D)">MALAT-1, a novel noncoding RNA, and thymosin beta4 predict metastasis and survival in early-stage non-small cell lung cancer.</a> Oncogene. 22 (39), 8031-8041 (2003).</li>
<li>Luo, J. H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Transcriptomic+and+genomic+analysis+of+human+hepatocellular+carcinomas+and+hepatoblastomas%5BTitle%5D)+AND+%22Hepatology%22%5BJournal%5D)">Transcriptomic and genomic analysis of human hepatocellular carcinomas and hepatoblastomas.</a> Hepatology. 44 (4), 1012-1024 (2006).</li>
<li>Guffanti, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((A+transcriptional+sketch+of+a+primary+human+breast+cancer+by+454+deep+sequencing%5BTitle%5D)+AND+%22BMC+Genomics%22%5BJournal%5D)">A transcriptional sketch of a primary human breast cancer by 454 deep sequencing.</a> BMC Genomics. 10, 163(2009).</li>
<li>Cho, S. F., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((MALAT1+long+non-coding+RNA+is+overexpressed+in+multiple+myeloma+and+may+serve+as+a+marker+to+predict+disease+progression%5BTitle%5D)+AND+%22BMC+Cancer%22%5BJournal%5D)">MALAT1 long non-coding RNA is overexpressed in multiple myeloma and may serve as a marker to predict disease progression.</a> BMC Cancer. 14, 809(2014).</li>
<li>Handa, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Long+non-coding+RNA+MALAT1+is+an+inducible+stress+response+gene+associated+with+extramedullary+spread+and+poor+prognosis+of+multiple+myeloma%5BTitle%5D)+AND+%22British+Journal+of+Haematology%22%5BJournal%5D)">Long non-coding RNA MALAT1 is an inducible stress response gene associated with extramedullary spread and poor prognosis of multiple myeloma.</a> British Journal of Haematology. 179 (3), 449-460 (2017).</li>
<li>Hu, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Targeting+the+MALAT1%2FPARP1%2FLIG3+complex+induces+DNA+damage+and+apoptosis+in+multiple+myeloma%5BTitle%5D)+AND+%22Leukemia%22%5BJournal%5D)">Targeting the MALAT1/PARP1/LIG3 complex induces DNA damage and apoptosis in multiple myeloma.</a> Leukemia. , (2018).</li>
<li>Lennox, K. A., Behlke, M. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Cellular+localization+of+long+non-coding+RNAs+affects+silencing+by+RNAi+more+than+by+antisense+oligonucleotides%5BTitle%5D)+AND+%22Nucleic+Acids+Research%22%5BJournal%5D)">Cellular localization of long non-coding RNAs affects silencing by RNAi more than by antisense oligonucleotides.</a> Nucleic Acids Research. 44 (2), 863-877 (2016).</li>
<li>Kam, N. W., O'Connell, M., Wisdom, J. A., Dai, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Carbon+nanotubes+as+multifunctional+biological+transporters+and+near-infrared+agents+for+selective+cancer+cell+destruction%5BTitle%5D)+AND+%22Proceedings+of+the+National+Academy+of+Sciences+of+the+United+States+of+America%22%5BJournal%5D)">Carbon nanotubes as multifunctional biological transporters and near-infrared agents for selective cancer cell destruction.</a> Proceedings of the National Academy of Sciences of the United States of America. 102 (33), 11600-11605 (2005).</li>
<li>Zeineldin, R., Al-Haik, M., Hudson, L. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Role+of+polyethylene+glycol+integrity+in+specific+receptor+targeting+of+carbon+nanotubes+to+cancer+cells%5BTitle%5D)+AND+%22Nano+Letters%22%5BJournal%5D)">Role of polyethylene glycol integrity in specific receptor targeting of carbon nanotubes to cancer cells.</a> Nano Letters. 9 (2), 751-757 (2009).</li>
<li>Amodio, N., D'Aquila, P., Passarino, G., Tassone, P., Bellizzi, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Epigenetic+modifications+in+multiple+myeloma%3A+recent+advances+on+the+role+of+DNA+and+histone+methylation%5BTitle%5D)+AND+%22Expert+Opinion+on+Therapeutic+Targets%22%5BJournal%5D)">Epigenetic modifications in multiple myeloma: recent advances on the role of DNA and histone methylation.</a> Expert Opinion on Therapeutic Targets. 21 (1), 91-101 (2017).</li>
<li>Ahmad, N., Haider, S., Jagannathan, S., Anaissie, E., Driscoll, J. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((MicroRNA+theragnostics+for+the+clinical+management+of+multiple+myeloma%5BTitle%5D)+AND+%22Leukemia%22%5BJournal%5D)">MicroRNA theragnostics for the clinical management of multiple myeloma.</a> Leukemia. 28 (4), 732-738 (2014).</li>
<li>Amodio, N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Drugging+the+lncRNA+MALAT1+via.+LNA+gapmeR+ASO+inhibits+gene+expression+of+proteasome+subunits+and+triggers+anti-multiple+myeloma+activity%5BTitle%5D)+AND+%22Leukemia%22%5BJournal%5D)">Drugging the lncRNA MALAT1 via. LNA gapmeR ASO inhibits gene expression of proteasome subunits and triggers anti-multiple myeloma activity.</a> Leukemia. , (2018).</li>
<li>Highleyman, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((FDA+approves+fomivirsen%2C+famciclovir%2C+and+Thalidomide.+Food+and+Drug+Administration%5BTitle%5D)+AND+%22BETA%22%5BJournal%5D)">FDA approves fomivirsen, famciclovir, and Thalidomide. Food and Drug Administration.</a> BETA. 5, (1998).</li>
<li>Smith, R. J., Hiatt, W. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Two+new+drugs+for+homozygous+familial+hypercholesterolemia%3A+managing+benefits+and+risks+in+a+rare+disorder%5BTitle%5D)+AND+%22JAMA+Internal+Medicine%22%5BJournal%5D)">Two new drugs for homozygous familial hypercholesterolemia: managing benefits and risks in a rare disorder.</a> JAMA Internal Medicine. 173 (16), 1491-1492 (2013).</li>
<li>Aartsma-Rus, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((FDA+Approval+of+Nusinersen+for+Spinal+Muscular+Atrophy+Makes+2016+the+Year+of+Splice+Modulating+Oligonucleotides%5BTitle%5D)+AND+%22Nucleic+Acid+Therapeutics%22%5BJournal%5D)">FDA Approval of Nusinersen for Spinal Muscular Atrophy Makes 2016 the Year of Splice Modulating Oligonucleotides.</a> Nucleic Acid Therapeutics. 27 (2), 67-69 (2017).</li>
<li>Nelson, S. F., Miceli, M. C. <a target="_blank" href="https://www.ncbi.nlm.nih.gov/pubmed/28399245">FDA Approval of Eteplirsen for Muscular Dystrophy.</a> The Journal of the American Medical Association. 317 (14), 1480(2017).</li>
<li>Liu, Z., Sun, X., Nakayama-Ratchford, N., Dai, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Supramolecular+chemistry+on+water-soluble+carbon+nanotubes+for+drug+loading+and+delivery%5BTitle%5D)+AND+%22American+Chemical+Society+Nano%22%5BJournal%5D)">Supramolecular chemistry on water-soluble carbon nanotubes for drug loading and delivery.</a> American Chemical Society Nano. 1 (1), 50-56 (2007).</li>
<li>Ali-Boucetta, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Multiwalled+carbon+nanotube-doxorubicin+supramolecular+complexes+for+cancer+therapeutics%5BTitle%5D)+AND+%22Chemical+communications+%28Cambridge%29%22%5BJournal%5D)">Multiwalled carbon nanotube-doxorubicin supramolecular complexes for cancer therapeutics.</a> Chemical communications (Cambridge). (4), 459-461 (2008).</li>
<li>Bianco, A., Kostarelos, K., Partidos, C. D., Prato, M. <a target="_blank" href="https://www.ncbi.nlm.nih.gov/pubmed/15672140">Biomedical applications of functionalised carbon nanotubes.</a> Chemical communications. (5), Cambridge. 571-577 (2005).</li>
<li>Hadidi, N., Kobarfard, F., Nafissi-Varcheh, N., Aboofazeli, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Optimization+of+single-walled+carbon+nanotube+solubility+by+noncovalent+PEGylation+using+experimental+design+methods%5BTitle%5D)+AND+%22International+Journal+of+Nanomedicine%22%5BJournal%5D)">Optimization of single-walled carbon nanotube solubility by noncovalent PEGylation using experimental design methods.</a> International Journal of Nanomedicine. 6, 737-746 (2011).</li>
<li>Padilla-Parra, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Quantitative+imaging+of+endosome+acidification+and+single+retrovirus+fusion+with+distinct+pools+of+early+endosomes%5BTitle%5D)+AND+%22Proceedings+of+the+National+Academy+of+Sciences+of+the+United+States+of+America%22%5BJournal%5D)">Quantitative imaging of endosome acidification and single retrovirus fusion with distinct pools of early endosomes.</a> Proceedings of the National Academy of Sciences of the United States of America. 109 (43), 17627-17632 (2012).</li>
<li>Wu, H., Zhu, L., Torchilin, V. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((pH-sensitive+poly%28histidine%29-PEG%2FDSPE-PEG+co-polymer+micelles+for+cytosolic+drug+delivery%5BTitle%5D)+AND+%22Biomaterials%22%5BJournal%5D)">pH-sensitive poly(histidine)-PEG/DSPE-PEG co-polymer micelles for cytosolic drug delivery.</a> Biomaterials. 34 (4), 1213-1222 (2013).</li>
<li>Oishi, M., Nagatsugi, F., Sasaki, S., Nagasaki, Y., Kataoka, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Smart+polyion+complex+micelles+for+targeted+intracellular+delivery+of+PEGylated+antisense+oligonucleotides+containing+acid-labile+linkages%5BTitle%5D)+AND+%22Chembiochem%22%5BJournal%5D)">Smart polyion complex micelles for targeted intracellular delivery of PEGylated antisense oligonucleotides containing acid-labile linkages.</a> Chembiochem. 6 (4), 718-725 (2005).</li>
<li>Dong, H., Ding, L., Yan, F., Ji, H., Ju, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((The+use+of+polyethylenimine-grafted+graphene+nanoribbon+for+cellular+delivery+of+locked+nucleic+acid+modified+molecular+beacon+for+recognition+of+microRNA%5BTitle%5D)+AND+%22Biomaterials%22%5BJournal%5D)">The use of polyethylenimine-grafted graphene nanoribbon for cellular delivery of locked nucleic acid modified molecular beacon for recognition of microRNA.</a> Biomaterials. 32 (15), 3875-3882 (2011).</li>
<li>Arunachalam, B., Phan, U. T., Geuze, H. J., Cresswell, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Enzymatic+reduction+of+disulfide+bonds+in+lysosomes%3A+characterization+of+a+gamma-interferon-inducible+lysosomal+thiol+reductase+%28GILT%29%5BTitle%5D)+AND+%22Proceedings+of+the+National+Academy+of+Sciences+of+the+United+States+of+America%22%5BJournal%5D)">Enzymatic reduction of disulfide bonds in lysosomes: characterization of a gamma-interferon-inducible lysosomal thiol reductase (GILT).</a> Proceedings of the National Academy of Sciences of the United States of America. 97 (2), 745-750 (2000).</li>
<li>Lelimousin, M., Sansom, M. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Membrane+perturbation+by+carbon+nanotube+insertion%3A+pathways+to+internalization%5BTitle%5D)+AND+%22Small%22%5BJournal%5D)">Membrane perturbation by carbon nanotube insertion: pathways to internalization.</a> Small. 9 (21), 3639-3646 (2013).</li>
<li>Thomas, M., Enciso, M., Hilder, T. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Insertion+mechanism+and+stability+of+boron+nitride+nanotubes+in+lipid+bilayers%5BTitle%5D)+AND+%22J+Phys+Chem+B%22%5BJournal%5D)">Insertion mechanism and stability of boron nitride nanotubes in lipid bilayers.</a> J Phys Chem B. 119 (15), 4929-4936 (2015).</li>
<li>Jin, H., Heller, D. A., Strano, M. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Single-particle+tracking+of+endocytosis+and+exocytosis+of+single-walled+carbon+nanotubes+in+NIH-3T3+cells%5BTitle%5D)+AND+%22Nano+Letters%22%5BJournal%5D)">Single-particle tracking of endocytosis and exocytosis of single-walled carbon nanotubes in NIH-3T3 cells.</a> Nano Letters. 8 (6), 1577-1585 (2008).</li>
<li>Jin, H., Heller, D. A., Sharma, R., Strano, M. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Size-dependent+cellular+uptake+and+expulsion+of+single-walled+carbon+nanotubes%3A+single+particle+tracking+and+a+generic+uptake+model+for+nanoparticles%5BTitle%5D)+AND+%22American+Chemical+Society+Nano%22%5BJournal%5D)">Size-dependent cellular uptake and expulsion of single-walled carbon nanotubes: single particle tracking and a generic uptake model for nanoparticles.</a> American Chemical Society Nano. 3 (1), 149-158 (2009).</li>
<li>Ruggiero, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Paradoxical+glomerular+filtration+of+carbon+nanotubes%5BTitle%5D)+AND+%22Proceedings+of+the+National+Academy+of+Sciences+of+the+United+States+of+America%22%5BJournal%5D)">Paradoxical glomerular filtration of carbon nanotubes.</a> Proceedings of the National Academy of Sciences of the United States of America. 107 (27), 12369-12374 (2010).</li>
</ol>

The authors have nothing to disclose.

Evidence has shown that lncRNAs take part in the regulation of numerous physiological and pathophysiological procedures in cancers, including MM7,8,9; they have the potential to be targeted for cancer treatment, which can be realized by antisense oligonucleotides20,21,22. The U.S. Food and Drug Administration (FDA) has approved several ...

The SWCNT is a novel nanomaterial that can deliver various types of drugs, such as proteins, small molecules, and nucleic acids, stably and efficiently with ideal tolerability and minimum toxicity in vitro1 and in vivo2. A functionalized SWCNT has great biocompatibility and water solubility, can be used as a shuttle for smaller molecules, and can carry them to penetrate the cell membrane3,4,5.
lncRNAs are a cluster of RNA (&#62;200 nt) that are transcribed from the genome to mRNA but cannot be translated to proteins. Increasing evidence has shown that lncRNAs participate in the regulation of gene expression6 and are involved in the initiation and progression of most types of cancer, including MM7,8,9. MALAT1 is a nuclear-enriched noncoding transcript 2 (NEAT2) and a highly conserved lncRNA10. MALAT1 is initially recognized in metastatic non-small-cell lung cancer (NSCLC)11, but has been overexpressed in numerous tumors5,12,13; it is one of the most highly expressed lncRNAs and is correlated with a poor prognosis in MM8,14. The expression level of MALAT1 is significantly higher in fatal course extramedullary MM patients compared to those only diagnosed as MM15.
In a previous study, we have confirmed that anti-MALAT1 oligos robustly lead to DNA damage and apoptosis in MM16 by using gapmer DNA antisense oligonucleotides targeting MALAT1 (anti-MALAT1) in MM cells. The gapmer DNA is composed of antisense DNA and linked by 2&#39;-OMe-RNAs, which could prompt MALAT1 cleavage by RNase H activity once bound17. The in vivo delivery efficiency of antisense oligos still limits its clinical usage.
To test the delivery effect of SWCNT for anti-MALAT1 gapmer oligos, the anti-MALAT1 gapmer DNA is conjugated to DSPE-PEG2000-amine functionalized SWCNT. The SWCNT-anti-MALAT1 is then injected intravenously into an MM disseminated mouse model; a striking inhibition is observed after four treatments.

<table><tbody><tr><td>SWCNTs</td><td>Millipore-Sigma</td><td>704113</td><td></td></tr><tr><td>DSPE-PEG2000-Amine</td><td>Avanti Polar Lipids</td><td>880128</td><td></td></tr><tr><td>bath sonicator</td><td>VWR</td><td>97043-992</td><td></td></tr><tr><td>4 mL centrifugal filter</td><td>Millipore-Sigma</td><td>Z740208-8EA</td><td></td></tr><tr><td>UV/VIS spectrometer</td><td>Thermo Fisher Scientific</td><td>accuSkan GO UV/Vis Microplate Spectrophotometer</td><td>extinction coefficient of 0.0465 L/mg/cm at 808 nm</td></tr><tr><td>Sulfo-LC-SPDP</td><td>ProteoChem</td><td>c1118</td><td></td></tr><tr><td>DTT solution</td><td>Millipore-Sigma</td><td>43815</td><td></td></tr><tr><td>NAP-5 column</td><td>GE Healthcare</td><td>17-0853-01</td><td></td></tr><tr><td>in vivo imaging system</td><td>PerkinElmer</td><td></td><td></td></tr><tr><td>NOD.CB17-Prkdcscid/J mice</td><td>Charles River lab</td><td>250</td><td></td></tr><tr><td>Flow cytometer</td><td>Becton Dickinso</td><td></td><td></td></tr><tr><td>Lipofectamine</td><td>Invitrogen</td><td>11668019</td><td>Lipofectamine2000</td></tr><tr><td>Fetal bovine serum (FBS)</td><td>Invitrogen</td><td>10437-028</td><td></td></tr><tr><td>RMPI-1640 medium</td><td>Invitrogen</td><td>11875-093</td><td></td></tr><tr><td>MALAT1-QF:</td><td>synthesized by IDT Company</td><td></td><td>5&amp;rsquo;- GTTCTGATCCCGCTGCTATT - 3&amp;rsquo;</td></tr><tr><td>MALAT1-QR:</td><td>synthesized by IDT Company</td><td></td><td>5&amp;rsquo;- TCCTCAACACTCAGCCTTTATC - 3&amp;rsquo;</td></tr><tr><td>GAPDH-QF:</td><td>synthesized by IDT Company</td><td></td><td>5&amp;rsquo;- CAAGAGCACAAGAGGAAGAGAG - 3&amp;rsquo;</td></tr><tr><td>GAPDH-QR:</td><td>synthesized by IDT Company</td><td></td><td>5&amp;rsquo;- CTACATGGCAACTGTGAGGAG - 3&amp;rsquo;</td></tr><tr><td>Quantitative PCR using SYBR Green PCR master mix</td><td>Thermo Fisher Scientific</td><td>A25780</td><td></td></tr><tr><td>RevertAid first-stand cDNA synthesis kit</td><td>Thermo Fisher Scientific</td><td>K1621</td><td></td></tr><tr><td>anti-MALAT1</td><td>synthesized by IDT Company</td><td></td><td>5&amp;rsquo;-mC*mG*mA*mA*mA*C*A*T*T&lt;br/&gt; *G*G*C*A*C*A*mC*mA*mG*mC*mA-3&amp;rsquo;</td></tr><tr><td>Cell Viability Assay Kit</td><td>Promega Corporation</td><td>G7570</td><td>CellTiter-GloLuminescent Cell Viability Assay Kit</td></tr><tr><td>accuSkan GO UV/Vis Microplate Spectrophotometer</td><td>Thermo Fisher Scientific</td><td></td><td></td></tr><tr><td>centrifugal filter</td><td>Millipore-Sigma</td><td>UFC910008</td><td></td></tr><tr><td>SPSS software</td><td>IBM</td><td>version 24.0</td><td></td></tr><tr><td>D-Luciferin</td><td>Millipore-Sigma</td><td>L9504</td><td></td></tr></tbody></table>

repression of multiple myeloma cell growth in vivo by single-wall carbon nanotube (swcnt)-delivered malat1 antisense oligos

The single-wall carbon nanotube (SWCNT) is a new type of nanoparticle, which has been used to deliver multiple kinds of drugs into cells, such as proteins, oligonucleotides, and synthetic small-molecule drugs. The SWCNT has customizable dimensions, a large superficial area, and can flexibly bind with drugs through different modifications on its surface; therefore, it is an ideal system to transport drugs into cells. Long noncoding RNAs (lncRNAs) are a cluster of noncoding RNA longer than 200 nt, which cannot be translated to protein but play an important role in biological and pathophysiological processes. Metastasis-associated lung adenocarcinoma transcript 1 (MALAT1) is a highly conserved lncRNA. It was demonstrated that higher MALAT1 levels are related to the poor prognosis of various cancers, including multiple myeloma (MM). We have revealed that MALAT1 regulates DNA repair and cell death in MM; thus, MALAT1 can be considered as a therapeutic target for MM. However, the efficient delivery of the antisense oligo to inhibit/knockdown MALAT1 in vivo is still a problem. In this study, we modify the SWCNT with PEG-2000 and conjugate an anti-MALAT1 oligo to it, test the delivery of this compound in vitro, inject it intravenously into a disseminated MM mouse model, and observe a significant inhibition of MM progression, which indicates that SWCNT is an ideal delivery shuttle for anti-MALAT1 gapmer DNA.

To demonstrate the inhibition effect of anti-MALAT1 gapmer DNA in MM, we knocked down the expression of MALAT1 and used it in H929 and MM.1S cells. Forty-eight hours later, cells were collected for the analysis of knock-down efficiency and the apoptosis status in cells transfected with anti-MALAT1 gapmer or control DNA. qRT-PCR results showed that anti-MALAT1 gapmer DNA knocked down the MALAT1 expression in H929 and MM.1S cells efficiently (Figure 2A<...

Watch this Scientific Journal Video about Repression of Multiple Myeloma Cell Growth In Vivo by Single-wall Carbon Nanotube SWCNT-delivered MALAT1 Antisense Oligos at JoVE.com

Repression of Multiple Myeloma Cell Growth In Vivo by Single-wall Carbon Nanotube SWCNT-delivered MALAT1 Antisense Oligos

This manuscript describes the synthesis of a single-wall carbon nanotube (SWCNT)-conjugated MALAT1 antisense gapmer DNA oligonucleotide (SWCNT-anti-MALAT1), which demonstrates the reliable delivery of the SWCNT and the potent therapeutic effect of anti-MALAT1 in vitro and in vivo. Methods used for synthesis, modification, conjugation, and injection of SWCNT-anti-MALAT1 are described.

Repression of Multiple Myeloma Cell Growth In Vivo by Single-wall Carbon Nanotube (SWCNT)-delivered MALAT1 Antisense Oligos

The single-wall carbon nanotube (SWCNT) is a new type of nanoparticle, which has been used to deliver multiple kinds of drugs into cells, such as ...

repression-multiple-myeloma-cell-growth-vivo-single-wall-carbon

Research

JoVE Journal

Cancer Research

6.4K Views.  Cleveland Clinic. De methode die we hier gebruiken kan helpen om oligonucleotide te verpakken met single-wall koolstof nanobuis, dat is een nieuw type nanodeeltje voor de levering van geneesmiddelen. Het belangrijkste voordeel van deze techniek is een efficiëntere levering van oligonucleotidegeneesmiddelen in cellen in vivo. De implicaties van deze techniek breiden zich uit tot onderzoek multipel myeloom, omdat het nanodeeltjes heeft geïntroduceerd om de levering van oligonucleotidegeneesmiddelen te verbeter...

Video: Repression of Multiple Myeloma Cell Growth In Vivo by Single-wall Carbon Nanotube SWCNT-delivered MALAT1 Antisense Oligos

Systemic Delivery of MicroRNA Using Recombinant Adeno-associated Virus Serotype 9 to Treat Neuromuscular Diseases in Rodents

RNA interference via the endogenous miRNA pathway regulates gene expression by controlling protein synthesis through post-transcriptional gene silencing. In recent years, miRNA-mediated gene regulation has shown potential for treatment of neurological disorders caused by a toxic gain of function mechanism. However, efficient delivery to target tissues has limited its application. Here we used a transgenic mouse model for spinal and bulbar muscular atrophy (SBMA), a neuromuscular disease caused by polyglutamine expansion in the androgen receptor (AR), to test gene silencing by a newly identified AR-targeting miRNA, miR-298. We overexpressed miR-298 using a recombinant adeno-associated virus (rAAV) serotype 9 vector to facilitate transduction of non-dividing cells. A single tail-vein injection in SBMA mice induced sustained and widespread overexpression of miR-298 in skeletal muscle and motor neurons and resulted in amelioration of the neuromuscular phenotype in the mice.

Here we describe the delivery of microRNA using a recombinant adeno-associated virus serotype 9 in a mouse model of a neuromuscular disease. A single peripheral administration in mice resulted in sustained miRNA overexpression in muscle and motor neurons, providing an opportunity to study miRNA function and therapeutic potential in vivo.

RNA interference via the endogenous miRNA pathway regulates gene expression by controlling protein synthesis through post-transcriptional gene silencing. ...

Genetics

Multimodal Bioluminescent and Positronic-emission Tomography/Computational Tomography Imaging of Multiple Myeloma Bone Marrow Xenografts in NOG Mice

Multiple myeloma (MM) tumors engraft in the bone marrow (BM) and their survival and progression are dependent upon complex molecular and cellular interactions that exist within this microenvironment. Yet the BM microenvironment cannot be easily replicated in vitro, which potentially limits the physiologic relevance of many in vitro and ex vivo experimental models. These issues can be overcome by utilizing a xenograft model in which luciferase (LUC)-transfected 8226 MM cells will specifically engraft in the mouse skeleton. When these mice are given the appropriate substrate, D-luciferin, the effects of therapy on tumor growth and survival can be analyzed by measuring changes in the bioluminescent images (BLI) produced by the tumors in vivo. This BLI data combined with positronic-emission tomography/computational tomography (PET/CT) analysis using the metabolic marker 2-deoxy-2-(18F)fluoro-D-glucose (18F-FDG) is used to monitor changes in tumor metabolism over time. These imaging platforms allow for multiple noninvasive measurements within the tumor/BM microenvironment.

Here we use bioluminescent, X-ray, and positron-emission tomography/computed tomography imaging to study how inhibiting mTOR activity impacts bone marrow-engrafted myeloma tumors in a xenograft model. This allows for physiologically relevant, non-invasive, and multimodal analyses of the anti-myeloma effect of therapies targeting bone marrow-engrafted myeloma tumors in vivo.

Multiple myeloma (MM) tumors engraft in the bone marrow (BM) and their survival and progression are dependent upon complex molecular and cellular ...

Establishing Cell Lines Overexpressing DR3 to Assess the Apoptotic Response to Anti-mitotic Therapeutics

Studying the function of a gene of interest can be achieved by manipulating its level of expression, such as decreasing its expression with knockdown cell lines or increasing its expression with overexpression cell lines. Transient and stable transfection are two methods that are often used for exogenous gene expression. Transient transfection is only useful for short-term expression, whereas stable transfection allows exogenous genes to be integrated into the host cell genome where it will be continuously expressed. As a result, stable transfection is usually employed for research into long-term genetic regulation. Here we describe a simple protocol to generate a stable cell line overexpressing tagged death receptor 3 (DR3) to explore DR3 function. We picked single clones after a retroviral infection in order to maintain the homogeneity and purity of the stable cell lines. The stable cell lines generated using this protocol render DR3-deficient HT29 cells sensitive to antimitotic drugs, thus reconstituting the apoptotic response in HT29 cells. Moreover, the FLAG tag on DR3 compensates for the unavailability of good DR3 antibody and facilitates the biochemical study of the molecular mechanism by which antimitotic agents induce apoptosis.

Establishing a stable cell line overexpressing a gene of interest to study gene function can be done by stable transfection-picking single clones after transfecting them via retroviral infection. Here we show that HT29-DR3 cell lines generated in this way elucidate the mechanisms by which death receptor 3 (DR3) contributes to antimitotics-induced apoptosis.

Studying the function of a gene of interest can be achieved by manipulating its level of expression, such as decreasing its expression with knockdown cell ...

Investigation of Genetic Dependencies Using CRISPR-Cas9-based Competition Assays

Gene perturbation studies have been extensively used to investigate the role of individual genes in AML pathogenesis. For achieving complete gene disruption, many of these studies have made use of complex gene knockout models. While these studies with knockout mice offer an elegant and time-tested system for investigating genotype-to-phenotype relationships, a rapid and scalable method for assessing candidate genes that play a role in AML cell proliferation or survival in AML models will help accelerate the parallel interrogation of multiple candidate genes. Recent advances in genome-editing technologies have dramatically enhanced our ability to perform genetic perturbations at an unprecedented scale. One such system of genome editing is the CRISPR-Cas9-based method that can be used to make rapid and efficacious alterations in the target cell genome. The ease and scalability of CRISPR/Cas9-mediated gene-deletion makes it one of the most attractive techniques for the interrogation of a large number of genes in phenotypic assays. Here, we present a simple assay using CRISPR/Cas9 mediated gene-disruption combined with high-throughput flow-cytometry-based competition assays to investigate the role of genes that may play an important role in the proliferation or survival of human and murine AML cell lines.

This manuscript describes a Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR) CRISPR-Cas9-based method for simple and expeditious investigation of the role of multiple candidate genes in Acute Myeloid Leukemia (AML) cell proliferation in parallel. This technique is scalable and can be applied in other cancer cell lines as well.

Gene perturbation studies have been extensively used to investigate the role of individual genes in AML pathogenesis. For achieving complete gene ...

In Vivo Inhibition of MicroRNA to Decrease Tumor Growth in Mice

MicroRNAs (miRNAs) are important regulators of gene expression through their ability to destabilize mRNA and inhibit translation of target mRNAs. An ever-increasing number of studies have identified miRNAs as potential biomarkers for cancer diagnosis and prognosis, and also as therapeutic targets, adding an extra dimension to cancer evaluation and treatment. In the context of thyroid cancer, tumorigenesis results not only from mutations in important genes, but also from the overexpression of many miRNAs. Accordingly, the role of miRNAs in the control of thyroid gene expression is evolving as an important mechanism in cancer. Herein, we present a protocol to examine the effects of miRNA-inhibitor delivery as a therapeutic modality in thyroid cancer using human tumor xenograft and orthotopic mouse models. After engineering stable thyroid tumoral cells expressing GFP and luciferase, cells are injected into nude mice to develop tumors, which can be followed by bioluminescence. The in vivo inhibition of a miRNA can reduce tumor growth and upregulate miRNA gene targets. This method can be used to assess the importance of a determined miRNA in vivo, in addition to identifying new therapeutic targets.

This protocol describes xenograft and orthotopic mouse models of human thyroid tumorigenesis as a platform to test microRNA-based inhibitor treatments. This approach is ideal to study the function of non-coding RNAs and their potential as new therapeutic targets.

MicroRNAs (miRNAs) are important regulators of gene expression through their ability to destabilize mRNA and inhibit translation of target mRNAs. An ...

A Robust Discovery Platform for the Identification of Novel Mediators of Melanoma Metastasis

Metastasis is a complex process, requiring cells to overcome barriers that are only incompletely modeled by in vitro assays. A systematic workflow was established using robust, reproducible in vivo models and standardized methods to identify novel players in melanoma metastasis. This approach allows for data inference at specific experimental stages to precisely characterize a gene's role in metastasis. Models are established by introducing genetically modified melanoma cells via intracardiac, intradermal, or subcutaneous injections into mice, followed by monitoring with serial in vivo imaging. Once preestablished endpoints are reached, primary tumors and/or metastases-bearing organs are harvested and processed for various analyses. Tumor cells can be sorted and subjected to any of several 'omics' platforms, including single-cell RNA sequencing. Organs undergo imaging and immunohistopathological analyses to quantify the overall burden of metastases and map their specific anatomic location. This optimized pipeline, including standardized protocols for engraftment, monitoring, tissue harvesting, processing, and analysis, can be adopted for patient-derived, short-term cultures and established human and murine cell lines of various solid cancer types.

This article describes a workflow of techniques employed for testing novel candidate mediators of melanoma metastasis and their mechanism(s) of action.

Metastasis is a complex process, requiring cells to overcome barriers that are only incompletely modeled by in vitro assays. A systematic workflow was ...

Chemical Inactivation of the E3 Ubiquitin Ligase Cereblon by Pomalidomide-based Homo-PROTACs

The immunomodulatory drugs (IMiDs) thalidomide and its analogs, lenalidomide and pomalidomide, all FDA approved drugs for the treatment of multiple myeloma, induce ubiquitination and degradation of the lymphoid transcription factors Ikaros (IKZF1) and Aiolos (IKZF3) via the cereblon (CRBN) E3 ubiquitin ligase for proteasomal degradation. IMiDs have recently been utilized for the generation of bifunctional proteolysis targeting chimeras (PROTACs) to target other proteins for ubiquitination and proteasomal degradation by the CRBN E3 ligase. We designed and synthesized pomalidomide-based homobifunctional PROTACs and analyzed their ability to induce self-directed ubiquitination and degradation of CRBN. Here, CRBN serves as both, the E3 ubiquitin ligase and the target at the same time. The homo-PROTAC compound 8 degrades CRBN with a high potency with only minimal remaining effects on IKZF1 and IKZF3. CRBN inactivation by compound 8 had no effect on cell viability and proliferation of different multiple myeloma cell lines. This homo-PROTAC abrogates the effects of IMiDs in multiple myeloma cells. Therefore, our homodimeric pomalidomide-based compounds may help to identify CRBN&#8216;s endogenous substrates and physiological functions and investigate the molecular mechanism of IMiDs.

This work describes the synthesis and characterization of a pomalidomide-based, bifunctional homo-PROTAC as a novel approach to induce ubiquitination and degradation of the E3 ubiquitin ligase cereblon (CRBN), the target of thalidomide analogs.

The immunomodulatory drugs (IMiDs) thalidomide and its analogs, lenalidomide and pomalidomide, all FDA approved drugs for the treatment of multiple ...

Chemistry

Antisense Oligonucleotides as a Tool for Prolonged Knockdown of Nuclear lncRNAs in Human Cell Lines

Long noncoding RNAs (lncRNAs) play key regulatory roles in gene expression at the transcriptional level. Experimental evidence has established that a substantial fraction of lncRNA preferentially accumulates in the nucleus. For analysis of the function of nuclear lncRNAs, it is important to achieve efficient knockdown of these transcripts inside the nucleus. In contrast to the use of RNA interference, a technology that depends on the cytoplasmic silencing machinery, an antisense oligonucleotide (ASO) technology can achieve RNA knockdown by recruiting RNase H to the RNA-DNA duplexes for nuclear RNA cleavage. Unlike the use of CRISPR-Cas tools for genome engineering, where possible alterations in the chromatin state can occur, ASOs allow the efficient knockdown of nuclear transcripts without modifying the genome. Nevertheless, one of the major obstacles to ASO-mediated knockdown is its transitory effect. For the study of long-lasting effects of lncRNA silencing, maintaining efficient knockdown for a long time is needed. In this study, a protocol was developed to achieve a knockdown effect for over 21 days. The purpose was to evaluate the cis-regulatory effects of lncRNA knockdown on the adjacent coding gene RFC4, which is related to chromosomal instability, a condition that is observed only through time and cell aging. Two different human cell lines were used: PrEC, normal primary prostate epithelial cells, and HCT116, an epithelial cell line isolated from colorectal carcinoma, achieving successful knockdown in the assayed cell lines.

To analyze the function of lncRNAs in time-dependent processes such as chromosomal instability, a prolonged knockdown effect must be achieved. To that purpose, presented here is a protocol that uses modified antisense oligonucleotides to achieve effective knockdown in cell lines for 21 days.

Long noncoding RNAs (lncRNAs) play key regulatory roles in gene expression at the transcriptional level. Experimental evidence has established that a ...

Establishment of a Human Multiple Myeloma Xenograft Model in the Chicken to Study Tumor Growth, Invasion and Angiogenesis

Multiple myeloma (MM), a malignant plasma cell disease, remains incurable and novel drugs are required to improve the prognosis of patients. Due to the lack of the bone microenvironment and auto/paracrine growth factors human MM cells are difficult to cultivate. Therefore, there is an urgent need to establish proper in vitro and in vivo culture systems to study the action of novel therapeutics on human MM cells. Here we present a model to grow human multiple myeloma cells in a complex 3D environment in vitro and in vivo. MM cell lines OPM-2 and RPMI-8226 were transfected to express the transgene GFP and were cultivated in the presence of human mesenchymal cells and collagen type-I matrix as three-dimensional spheroids. In addition, spheroids were grafted on the chorioallantoic membrane (CAM) of chicken embryos and tumor growth was monitored by stereo fluorescence microscopy. Both models allow the study of novel therapeutic drugs in a complex 3D environment and the quantification of the tumor cell mass after homogenization of grafts in a transgene-specific GFP-ELISA. Moreover, angiogenic responses of the host and invasion of tumor cells into the subjacent host tissue can be monitored daily by a stereo microscope and analyzed by immunohistochemical staining against human tumor cells (Ki-67, CD138, Vimentin) or host mural cells covering blood vessels (desmin/ASMA).
In conclusion, the onplant system allows studying MM cell growth and angiogenesis in a complex 3D environment and enables screening for novel therapeutic compounds targeting survival and proliferation of MM cells.

Human multiple myeloma (MM) cells require the supportive microenvironment of mesenchymal cells and extracellular matrix components for survival and proliferation. We established an in vivo chicken embryo model with engrafted human myeloma and mesenchymal cells to study effects of cancer drugs on tumor growth, invasion and angiogenesis.

Multiple myeloma (MM), a malignant plasma cell disease, remains incurable and novel drugs are required to improve the prognosis of patients. Due to the ...

Medicine

Intrathecal Delivery of Antisense Oligonucleotides in the Rat Central Nervous System

The blood brain barrier (BBB) is an important defense against the entrance of potentially toxic or pathogenic agents from the blood into the central nervous system (CNS). However, its existence also dramatically lowers the accessibility of systemically administered therapeutic agents to the CNS. One method to overcome this, is to inject those agents directly into the cerebrospinal fluid (CSF), thus bypassing the BBB. This can be done via implantation of a catheter for either continuous infusion using an osmotic pump, or for single bolus delivery. In this article, we describe a surgical protocol for delivery of CNS-targeting antisense oligonucleotides (ASOs) via a catheter implanted directly into the cauda equina space of the adult rat spine. As representative results, we show the efficacy of a single bolus ASO intrathecal (IT) injection via this catheterization system in knocking down the target RNA in different regions of the rat CNS. The procedure is safe, effective and does not require expensive equipment or surgical tools. The technique described here can be adapted to deliver drugs in other modalities as well.

Here, we describe a method for delivering drugs to the rat central nervous system by implanting a catheter into the lumbar intrathecal space of the spine. We focus on the delivery of antisense oligonucleotides, though this method is suitable for delivery of other therapeutic modalities as well.

The blood brain barrier (BBB) is an important defense against the entrance of potentially toxic or pathogenic agents from the blood into the central ...

Repression of Multiple Myeloma Cell Growth In Vivo by Single-wall Carbon Nanotube (SWCNT)-delivered MALAT1 Antisense Oligos

Samenvatting

Meer video's verkennen