The authors thank the Lerner Research Institute proteomic, genomic, and imaging cores for their assistance and support. Funding: This work was financially supported by NIH/NCI grant R00 CA172292 (to J.J.Z.) and start-up funds (to J.J.Z.) and the Clinical and Translational Science Collaborative (CTSC) of Case Western Reserve University Core Utilization Pilot Grant (to J.J.Z.). This work utilized the Leica SP8 confocal microscope that was purchased with funding from National Institutes of Health SIG grant 1S10OD019972-01.

All experiments involving animals were pre-approved by the Cleveland Clinic IACUC (Institutional Animal Care and Use Committee).
1. Synthesis of Functionalized SWCNTs
<ol>
	<li>Mix 1 mg of SWCNTs, 5 mg of DSPE-PEG2000-Amine, and 5 mL of sterilized nuclease-free water in a glass scintillation vial (20 mL). Shake it well to dissolve all reagents completely.</li>
	<li>Sonicate the vial in a water bath sonicator at a power level of 40 W for 1 h at room temperature (RT, 20 min x 3, change the wat...

<ol>
	<li>Jiang, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=RNase+non-sensitive+and+endocytosis+independent+siRNA+delivery+system:+delivery+of+siRNA+into+tumor+cells+and+high+efficiency+induction+of+apoptosis.">RNase non-sensitive and endocytosis independent siRNA delivery system: delivery of siRNA into tumor cells and high efficiency induction of apoptosis.</a> Nanoscale. 5 (16), 7256-7264 (2013).</li><li>Murakami, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Water-dispersed+single-wall+carbon+nanohorns+as+drug+carriers+for+local+cancer+chemotherapy.">Water-dispersed single-wall carbon nanohorns as drug carriers for local cancer chemotherapy.</a> Nanomedicine (Lond). 3 (4), 453-463 (2008).</li><li>Kam, N. W., Dai, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Carbon+nanotubes+as+intracellular+protein+transporters:+generality+and+biological+functionality.">Carbon nanotubes as intracellular protein transporters: generality and biological functionality.</a> Journal of the American Chemical Society. 127 (16), 6021-6026 (2005).</li><li>Kam, N. W., Liu, Z., Dai, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Functionalization+of+carbon+nanotubes+via.+cleavable+disulfide+bonds+for+efficient+intracellular+delivery+of+siRNA+and+potent+gene+silencing.">Functionalization of carbon nanotubes via. cleavable disulfide bonds for efficient intracellular delivery of siRNA and potent gene silencing.</a> Journal of the American Chemical Society. 127 (36), 12492-12493 (2005).</li><li>Kam, N. W., Liu, Z., Dai, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Carbon+nanotubes+as+intracellular+transporters+for+proteins+and+DNA:+an+investigation+of+the+uptake+mechanism+and+pathway.">Carbon nanotubes as intracellular transporters for proteins and DNA: an investigation of the uptake mechanism and pathway.</a> Angewandte Chemie International Edition in English. 45 (4), 577-581 (2006).</li><li>Ntziachristos, P., Abdel-Wahab, O., Aifantis, I. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Emerging+concepts+of+epigenetic+dysregulation+in+hematological+malignancies.">Emerging concepts of epigenetic dysregulation in hematological malignancies.</a> Nature Immunology. 17 (9), 1016-1024 (2016).</li><li>Evans, J. R., Feng, F. Y., Chinnaiyan, A. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+bright+side+of+dark+matter:+lncRNAs+in+cancer.">The bright side of dark matter: lncRNAs in cancer.</a> Journal of Clinical Investigation. 126 (8), 2775-2782 (2016).</li><li>Ronchetti, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Distinct+lncRNA+transcriptional+fingerprints+characterize+progressive+stages+of+multiple+myeloma.">Distinct lncRNA transcriptional fingerprints characterize progressive stages of multiple myeloma.</a> Oncotarget. 7 (12), 14814-14830 (2016).</li><li>Wong, K. Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Epigenetic+silencing+of+a+long+non-coding+RNA+KIAA0495+in+multiple+myeloma.">Epigenetic silencing of a long non-coding RNA KIAA0495 in multiple myeloma.</a> Molecular Cancer. 14, 175 (2015).</li><li>Schmidt, L. H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+long+noncoding+MALAT-1+RNA+indicates+a+poor+prognosis+in+non-small+cell+lung+cancer+and+induces+migration+and+tumor+growth.">The long noncoding MALAT-1 RNA indicates a poor prognosis in non-small cell lung cancer and induces migration and tumor growth.</a> Journal of Thoracic Oncology. 6 (12), 1984-1992 (2011).</li><li>Ji, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=MALAT-1,+a+novel+noncoding+RNA,+and+thymosin+beta4+predict+metastasis+and+survival+in+early-stage+non-small+cell+lung+cancer.">MALAT-1, a novel noncoding RNA, and thymosin beta4 predict metastasis and survival in early-stage non-small cell lung cancer.</a> Oncogene. 22 (39), 8031-8041 (2003).</li><li>Luo, J. H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transcriptomic+and+genomic+analysis+of+human+hepatocellular+carcinomas+and+hepatoblastomas.">Transcriptomic and genomic analysis of human hepatocellular carcinomas and hepatoblastomas.</a> Hepatology. 44 (4), 1012-1024 (2006).</li><li>Guffanti, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+transcriptional+sketch+of+a+primary+human+breast+cancer+by+454+deep+sequencing.">A transcriptional sketch of a primary human breast cancer by 454 deep sequencing.</a> BMC Genomics. 10, 163 (2009).</li><li>Cho, S. F., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=MALAT1+long+non-coding+RNA+is+overexpressed+in+multiple+myeloma+and+may+serve+as+a+marker+to+predict+disease+progression.">MALAT1 long non-coding RNA is overexpressed in multiple myeloma and may serve as a marker to predict disease progression.</a> BMC Cancer. 14, 809 (2014).</li><li>Handa, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Long+non-coding+RNA+MALAT1+is+an+inducible+stress+response+gene+associated+with+extramedullary+spread+and+poor+prognosis+of+multiple+myeloma.">Long non-coding RNA MALAT1 is an inducible stress response gene associated with extramedullary spread and poor prognosis of multiple myeloma.</a> British Journal of Haematology. 179 (3), 449-460 (2017).</li><li>Hu, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Targeting+the+MALAT1/PARP1/LIG3+complex+induces+DNA+damage+and+apoptosis+in+multiple+myeloma.">Targeting the MALAT1/PARP1/LIG3 complex induces DNA damage and apoptosis in multiple myeloma.</a> Leukemia. , (2018).</li><li>Lennox, K. A., Behlke, M. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cellular+localization+of+long+non-coding+RNAs+affects+silencing+by+RNAi+more+than+by+antisense+oligonucleotides.">Cellular localization of long non-coding RNAs affects silencing by RNAi more than by antisense oligonucleotides.</a> Nucleic Acids Research. 44 (2), 863-877 (2016).</li><li>Kam, N. W., O'Connell, M., Wisdom, J. A., Dai, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Carbon+nanotubes+as+multifunctional+biological+transporters+and+near-infrared+agents+for+selective+cancer+cell+destruction.">Carbon nanotubes as multifunctional biological transporters and near-infrared agents for selective cancer cell destruction.</a> Proceedings of the National Academy of Sciences of the United States of America. 102 (33), 11600-11605 (2005).</li><li>Zeineldin, R., Al-Haik, M., Hudson, L. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Role+of+polyethylene+glycol+integrity+in+specific+receptor+targeting+of+carbon+nanotubes+to+cancer+cells.">Role of polyethylene glycol integrity in specific receptor targeting of carbon nanotubes to cancer cells.</a> Nano Letters. 9 (2), 751-757 (2009).</li><li>Amodio, N., D'Aquila, P., Passarino, G., Tassone, P., Bellizzi, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Epigenetic+modifications+in+multiple+myeloma:+recent+advances+on+the+role+of+DNA+and+histone+methylation.">Epigenetic modifications in multiple myeloma: recent advances on the role of DNA and histone methylation.</a> Expert Opinion on Therapeutic Targets. 21 (1), 91-101 (2017).</li><li>Ahmad, N., Haider, S., Jagannathan, S., Anaissie, E., Driscoll, J. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=MicroRNA+theragnostics+for+the+clinical+management+of+multiple+myeloma.">MicroRNA theragnostics for the clinical management of multiple myeloma.</a> Leukemia. 28 (4), 732-738 (2014).</li><li>Amodio, N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Drugging+the+lncRNA+MALAT1+via.+LNA+gapmeR+ASO+inhibits+gene+expression+of+proteasome+subunits+and+triggers+anti-multiple+myeloma+activity.">Drugging the lncRNA MALAT1 via. LNA gapmeR ASO inhibits gene expression of proteasome subunits and triggers anti-multiple myeloma activity.</a> Leukemia. , (2018).</li><li>Highleyman, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=FDA+approves+fomivirsen,+famciclovir,+and+Thalidomide.+Food+and+Drug+Administration.">FDA approves fomivirsen, famciclovir, and Thalidomide. Food and Drug Administration.</a> BETA. 5, (1998).</li><li>Smith, R. J., Hiatt, W. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Two+new+drugs+for+homozygous+familial+hypercholesterolemia:+managing+benefits+and+risks+in+a+rare+disorder.">Two new drugs for homozygous familial hypercholesterolemia: managing benefits and risks in a rare disorder.</a> JAMA Internal Medicine. 173 (16), 1491-1492 (2013).</li><li>Aartsma-Rus, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=FDA+Approval+of+Nusinersen+for+Spinal+Muscular+Atrophy+Makes+2016+the+Year+of+Splice+Modulating+Oligonucleotides.">FDA Approval of Nusinersen for Spinal Muscular Atrophy Makes 2016 the Year of Splice Modulating Oligonucleotides.</a> Nucleic Acid Therapeutics. 27 (2), 67-69 (2017).</li><li>Nelson, S. F., Miceli, M. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=FDA+Approval+of+Eteplirsen+for+Muscular+Dystrophy.">FDA Approval of Eteplirsen for Muscular Dystrophy.</a> The Journal of the American Medical Association. 317 (14), 1480 (2017).</li><li>Liu, Z., Sun, X., Nakayama-Ratchford, N., Dai, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Supramolecular+chemistry+on+water-soluble+carbon+nanotubes+for+drug+loading+and+delivery.">Supramolecular chemistry on water-soluble carbon nanotubes for drug loading and delivery.</a> American Chemical Society Nano. 1 (1), 50-56 (2007).</li><li>Ali-Boucetta, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Multiwalled+carbon+nanotube-doxorubicin+supramolecular+complexes+for+cancer+therapeutics.">Multiwalled carbon nanotube-doxorubicin supramolecular complexes for cancer therapeutics.</a> Chemical communications (Cambridge). (4), 459-461 (2008).</li><li>Bianco, A., Kostarelos, K., Partidos, C. D., Prato, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Biomedical+applications+of+functionalised+carbon+nanotubes.">Biomedical applications of functionalised carbon nanotubes.</a> Chemical communications. (5), 571-577 (2005).</li><li>Hadidi, N., Kobarfard, F., Nafissi-Varcheh, N., Aboofazeli, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Optimization+of+single-walled+carbon+nanotube+solubility+by+noncovalent+PEGylation+using+experimental+design+methods.">Optimization of single-walled carbon nanotube solubility by noncovalent PEGylation using experimental design methods.</a> International Journal of Nanomedicine. 6, 737-746 (2011).</li><li>Padilla-Parra, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Quantitative+imaging+of+endosome+acidification+and+single+retrovirus+fusion+with+distinct+pools+of+early+endosomes.">Quantitative imaging of endosome acidification and single retrovirus fusion with distinct pools of early endosomes.</a> Proceedings of the National Academy of Sciences of the United States of America. 109 (43), 17627-17632 (2012).</li><li>Wu, H., Zhu, L., Torchilin, V. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=pH-sensitive+poly(histidine)-PEG/DSPE-PEG+co-polymer+micelles+for+cytosolic+drug+delivery.">pH-sensitive poly(histidine)-PEG/DSPE-PEG co-polymer micelles for cytosolic drug delivery.</a> Biomaterials. 34 (4), 1213-1222 (2013).</li><li>Oishi, M., Nagatsugi, F., Sasaki, S., Nagasaki, Y., Kataoka, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Smart+polyion+complex+micelles+for+targeted+intracellular+delivery+of+PEGylated+antisense+oligonucleotides+containing+acid-labile+linkages.">Smart polyion complex micelles for targeted intracellular delivery of PEGylated antisense oligonucleotides containing acid-labile linkages.</a> Chembiochem. 6 (4), 718-725 (2005).</li><li>Dong, H., Ding, L., Yan, F., Ji, H., Ju, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+use+of+polyethylenimine-grafted+graphene+nanoribbon+for+cellular+delivery+of+locked+nucleic+acid+modified+molecular+beacon+for+recognition+of+microRNA.">The use of polyethylenimine-grafted graphene nanoribbon for cellular delivery of locked nucleic acid modified molecular beacon for recognition of microRNA.</a> Biomaterials. 32 (15), 3875-3882 (2011).</li><li>Arunachalam, B., Phan, U. T., Geuze, H. J., Cresswell, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Enzymatic+reduction+of+disulfide+bonds+in+lysosomes:+characterization+of+a+gamma-interferon-inducible+lysosomal+thiol+reductase+(GILT).">Enzymatic reduction of disulfide bonds in lysosomes: characterization of a gamma-interferon-inducible lysosomal thiol reductase (GILT).</a> Proceedings of the National Academy of Sciences of the United States of America. 97 (2), 745-750 (2000).</li><li>Lelimousin, M., Sansom, M. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Membrane+perturbation+by+carbon+nanotube+insertion:+pathways+to+internalization.">Membrane perturbation by carbon nanotube insertion: pathways to internalization.</a> Small. 9 (21), 3639-3646 (2013).</li><li>Thomas, M., Enciso, M., Hilder, T. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Insertion+mechanism+and+stability+of+boron+nitride+nanotubes+in+lipid+bilayers.">Insertion mechanism and stability of boron nitride nanotubes in lipid bilayers.</a> J Phys Chem B. 119 (15), 4929-4936 (2015).</li><li>Jin, H., Heller, D. A., Strano, M. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Single-particle+tracking+of+endocytosis+and+exocytosis+of+single-walled+carbon+nanotubes+in+NIH-3T3+cells.">Single-particle tracking of endocytosis and exocytosis of single-walled carbon nanotubes in NIH-3T3 cells.</a> Nano Letters. 8 (6), 1577-1585 (2008).</li><li>Jin, H., Heller, D. A., Sharma, R., Strano, M. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Size-dependent+cellular+uptake+and+expulsion+of+single-walled+carbon+nanotubes:+single+particle+tracking+and+a+generic+uptake+model+for+nanoparticles.">Size-dependent cellular uptake and expulsion of single-walled carbon nanotubes: single particle tracking and a generic uptake model for nanoparticles.</a> American Chemical Society Nano. 3 (1), 149-158 (2009).</li><li>Ruggiero, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Paradoxical+glomerular+filtration+of+carbon+nanotubes.">Paradoxical glomerular filtration of carbon nanotubes.</a> Proceedings of the National Academy of Sciences of the United States of America. 107 (27), 12369-12374 (2010).</li></ol>

The authors have nothing to disclose.

Evidence has shown that lncRNAs take part in the regulation of numerous physiological and pathophysiological procedures in cancers, including MM7,8,9; they have the potential to be targeted for cancer treatment, which can be realized by antisense oligonucleotides20,21,22. The U.S. Food and Drug Administration (FDA) has approved several ...

The SWCNT is a novel nanomaterial that can deliver various types of drugs, such as proteins, small molecules, and nucleic acids, stably and efficiently with ideal tolerability and minimum toxicity in vitro1 and in vivo2. A functionalized SWCNT has great biocompatibility and water solubility, can be used as a shuttle for smaller molecules, and can carry them to penetrate the cell membrane3,4,5.
lncRNAs are a cluster of RNA (&#62;200 nt) that are transcribed from the genome to mRNA but cannot be translated to proteins. Increasing evidence has shown that lncRNAs participate in the regulation of gene expression6 and are involved in the initiation and progression of most types of cancer, including MM7,8,9. MALAT1 is a nuclear-enriched noncoding transcript 2 (NEAT2) and a highly conserved lncRNA10. MALAT1 is initially recognized in metastatic non-small-cell lung cancer (NSCLC)11, but has been overexpressed in numerous tumors5,12,13; it is one of the most highly expressed lncRNAs and is correlated with a poor prognosis in MM8,14. The expression level of MALAT1 is significantly higher in fatal course extramedullary MM patients compared to those only diagnosed as MM15.
In a previous study, we have confirmed that anti-MALAT1 oligos robustly lead to DNA damage and apoptosis in MM16 by using gapmer DNA antisense oligonucleotides targeting MALAT1 (anti-MALAT1) in MM cells. The gapmer DNA is composed of antisense DNA and linked by 2&#39;-OMe-RNAs, which could prompt MALAT1 cleavage by RNase H activity once bound17. The in vivo delivery efficiency of antisense oligos still limits its clinical usage.
To test the delivery effect of SWCNT for anti-MALAT1 gapmer oligos, the anti-MALAT1 gapmer DNA is conjugated to DSPE-PEG2000-amine functionalized SWCNT. The SWCNT-anti-MALAT1 is then injected intravenously into an MM disseminated mouse model; a striking inhibition is observed after four treatments.

<table border="0" cellpadding="0" cellspacing="0" style="width:1168px;" width="1167">
	<colgroup>
		<col />
		<col />
		<col />
		<col />
	</colgroup>
	<tbody>
		<tr height="40">
			<td height="40" style="height:40px;width:324px;">SWCNTs</td>
			<td style="width:199px;">Millipore-Sigma</td>
			<td style="width:209px;">704113</td>
			<td style="width:436px;"></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">DSPE-PEG2000-Amine</td>
			<td>Avanti Polar Lipids</td>
			<td>880128</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">bath sonicator</td>
			<td>VWR</td>
			<td>97043-992</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">4 mL centrifugal filter</td>
			<td>Millipore-Sigma</td>
			<td>Z740208-8EA</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">UV/VIS spectrometer</td>
			<td>Thermo Fisher Scientific</td>
			<td>accuSkan GO UV/Vis Microplate Spectrophotometer</td>
			<td>extinction coefficient of 0.0465 L/mg/cm at 808 nm</td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">Sulfo-LC-SPDP</td>
			<td>ProteoChem</td>
			<td>c1118</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">DTT solution</td>
			<td>Millipore-Sigma</td>
			<td>43815</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">NAP-5 column</td>
			<td>GE Healthcare</td>
			<td>17-0853-01</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">in vivo imaging system</td>
			<td>PerkinElmer</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">NOD.CB17-Prkdcscid/J mice</td>
			<td>Charles River lab</td>
			<td>250</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">Flow cytometer</td>
			<td>Becton Dickinso</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">Lipofectamine</td>
			<td>Invitrogen</td>
			<td>11668019</td>
			<td>Lipofectamine2000</td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">Fetal bovine serum (FBS)</td>
			<td>Invitrogen</td>
			<td>10437-028</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">RMPI-1640 medium</td>
			<td>Invitrogen</td>
			<td>11875-093</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">MALAT1-QF:</td>
			<td>synthesized by IDT Company</td>
			<td style="width:209px;"></td>
			<td>5&#8217;- GTTCTGATCCCGCTGCTATT - 3&#8217;</td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">MALAT1-QR:</td>
			<td>synthesized by IDT Company</td>
			<td style="width:209px;"></td>
			<td>5&#8217;- TCCTCAACACTCAGCCTTTATC - 3&#8217;</td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">GAPDH-QF:</td>
			<td>synthesized by IDT Company</td>
			<td style="width:209px;"></td>
			<td>5&#8217;- CAAGAGCACAAGAGGAAGAGAG - 3&#8217;</td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">GAPDH-QR:</td>
			<td>synthesized by IDT Company</td>
			<td style="width:209px;"></td>
			<td>5&#8217;- CTACATGGCAACTGTGAGGAG - 3&#8217;</td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">Quantitative PCR using SYBR Green PCR master mix</td>
			<td>Thermo Fisher Scientific</td>
			<td>A25780</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">RevertAid first-stand cDNA synthesis kit</td>
			<td>Thermo Fisher Scientific</td>
			<td>K1621</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">anti-MALAT1</td>
			<td>synthesized by IDT Company</td>
			<td></td>
			<td>5&#8217;-mC*mG*mA*mA*mA*C*A*T*T 
			*G*G*C*A*C*A*mC*mA*mG*mC*mA-3&#8217;</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Cell Viability Assay Kit</td>
			<td>Promega Corporation</td>
			<td>G7570</td>
			<td>CellTiter-GloLuminescent Cell Viability Assay Kit</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">accuSkan GO UV/Vis Microplate Spectrophotometer</td>
			<td>Thermo Fisher Scientific</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">centrifugal filter</td>
			<td>Millipore-Sigma</td>
			<td>UFC910008</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">SPSS software</td>
			<td>IBM</td>
			<td>version 24.0</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">D-Luciferin</td>
			<td>Millipore-Sigma</td>
			<td>L9504</td>
			<td></td>
		</tr>
	</tbody>
</table>

repression of multiple myeloma cell growth in vivo by single-wall carbon nanotube (swcnt)-delivered malat1 antisense oligos

The single-wall carbon nanotube (SWCNT) is a new type of nanoparticle, which has been used to deliver multiple kinds of drugs into cells, such as proteins, oligonucleotides, and synthetic small-molecule drugs. The SWCNT has customizable dimensions, a large superficial area, and can flexibly bind with drugs through different modifications on its surface; therefore, it is an ideal system to transport drugs into cells. Long noncoding RNAs (lncRNAs) are a cluster of noncoding RNA longer than 200 nt, which cannot be translated to protein but play an important role in biological and pathophysiological processes. Metastasis-associated lung adenocarcinoma transcript 1 (MALAT1) is a highly conserved lncRNA. It was demonstrated that higher MALAT1 levels are related to the poor prognosis of various cancers, including multiple myeloma (MM). We have revealed that MALAT1 regulates DNA repair and cell death in MM; thus, MALAT1 can be considered as a therapeutic target for MM. However, the efficient delivery of the antisense oligo to inhibit/knockdown MALAT1 in vivo is still a problem. In this study, we modify the SWCNT with PEG-2000 and conjugate an anti-MALAT1 oligo to it, test the delivery of this compound in vitro, inject it intravenously into a disseminated MM mouse model, and observe a significant inhibition of MM progression, which indicates that SWCNT is an ideal delivery shuttle for anti-MALAT1 gapmer DNA.

To demonstrate the inhibition effect of anti-MALAT1 gapmer DNA in MM, we knocked down the expression of MALAT1 and used it in H929 and MM.1S cells. Forty-eight hours later, cells were collected for the analysis of knock-down efficiency and the apoptosis status in cells transfected with anti-MALAT1 gapmer or control DNA. qRT-PCR results showed that anti-MALAT1 gapmer DNA knocked down the MALAT1 expression in H929 and MM.1S cells efficiently (Figure 2A<...

Watch this Scientific Journal Video about Repression of Multiple Myeloma Cell Growth In Vivo by Single-wall Carbon Nanotube SWCNT-delivered MALAT1 Antisense Oligos at JoVE.com

Repression of Multiple Myeloma Cell Growth In Vivo by Single-wall Carbon Nanotube SWCNT-delivered MALAT1 Antisense Oligos

This manuscript describes the synthesis of a single-wall carbon nanotube (SWCNT)-conjugated MALAT1 antisense gapmer DNA oligonucleotide (SWCNT-anti-MALAT1), which demonstrates the reliable delivery of the SWCNT and the potent therapeutic effect of anti-MALAT1 in vitro and in vivo. Methods used for synthesis, modification, conjugation, and injection of SWCNT-anti-MALAT1 are described.

Repression of Multiple Myeloma Cell Growth In Vivo by Single-wall Carbon Nanotube (SWCNT)-delivered MALAT1 Antisense Oligos

The single-wall carbon nanotube (SWCNT) is a new type of nanoparticle, which has been used to deliver multiple kinds of drugs into cells, such as ...

The method we are using here can help to package oligonucleotide with single-wall carbon nanotube, which is a new type of nanoparticle for drug delivery. The main advantage of this technique is more efficient delivery of oligonucleotide drugs into cells in vivo. The implications of this technique extend to research multiple myeloma, because it's introduced nanoparticle to improve the delivery of oligonucleotide drugs.Through this method can provide insight into treatment for multiple myeloma. It can also be applied to other diseases and conjugated with other cargo, such as proteins and small molecules. First, mix one milligram of single-wall carbon nanotubes, five milligrams of DSPE-PEG 2000 amine, and five milliliters of sterilized nuclease-free water in a 20-milliliter glass scintillation vial.Sonicate the vial in a waterbath sonicator at a power level of 90 watts for one hour at room temperature. Following sonication, centrifuge the vial at 24, 000 times g for six hours. Then collect the supernatant solution.Add one milliliter of the single-wall carbon nanotube solution to a 100-kilodalton molecular weight cutoff centrifugal filter device followed by four milliliters of sterilized nuclease-free water. Centrifuge for 10 minutes at 4, 000 times g at room temperature to remove the excess amine. Add 0.5 milligrams of Sulfo-LC-SPDP to 450 microliters of the amine-functionalized single-wall carbon nanotube.Then add 50 microliters of 10x PBS, and incubate for two hours at room temperature. Next, add the reaction mixture to a 100-kilodalton molecular weight cutoff centrifugal filter device, followed by four milliliters of nuclease-free water. Centrifuge the sample for 10 minutes at 4, 000 times g at room temperature to remove the excess Sulfo-LC-SPDP.Collect the Sulfo-LC-SPDP-treated amine single-wall carbon nanotube solution left in the filter, and dilute it with 500 microliters of previously-prepared anti-MALAT1-Cy3 solution. Then incubate the sample at four degrees Celsius overnight. To achieve the best results of comparison, randomly arrange 14 mice into trial or control groups with seven in each group, and with the same male-to-female ratio in each group.Next, clean the operation bench and sterilize it with 70%ethyl alcohol. Use a heating lamp to warm one of the mice to help the tail vein to appear. Restrain the mouse properly with a tail injection restrainer.Inject MM.1S-luc/mCherry cells in 50 microliters of PBS through the tail vein. Press the injection site with an alcohol swab for 30 seconds. Then mark the injected mouse and return it to a clean cage.On day seven, after the MM1S cell injection, inject 50 microliters of PBS containing single-wall carbon nanotube anti-MALAT1 into the tail vein of the mouse. Then press the injection site with an alcohol swab for 30 seconds. Observe the local bleeding on the tail and the general behavior of the mouse for one minute, and then return it to a clean cage.Observe all injected mice again before returning the cage to the rack to make sure that the injections are tolerated well. Weigh each mouse before dissection. Collect peripheral blood from the heart for a complete blood count assay performed by a blood cell counter machine.Next, collect the tissues of the bone marrow, spleen, lymph node, kidney, and the tissue with visible metastasis. Extract RNA and protein from the bone marrow samples. Fix all remaining tissues in formalin.After 24 hours of fixation, immerse the bone samples in a 0.5-molar EDTA solution for five days for decalcification. Then immerse all samples in 75%ethyl alcohol for long-term storage. QRT PCR results showed that anti-MALAT1 gapmeR DNA knocked down the MALAT1 expression and induced apoptosis significantly in H929 and MM.1S cells.Single-wall carbon nanotube anti-MALAT1-Cy3 was delivered into the nucleus of MM cells, and significantly suppressed the endogenous MALAT1 level in both H929 and MM.1S cells. The viability of BMEC-1 cell has no significant difference after treatment of single-wall carbon nanotube anti-MALAT1-Cy3 or control at different dosages and timepoints. This indicates that the toxicity of single-wall carbon nanotube anti-MALAT1-Cy3 has a limited and acceptable toxicity to normal cells at high dosage.A human MM-disseminated mouse model was established to evaluate the treatment effects of single-wall carbon nanotube anti-MALAT1 in vivo. The luciferon signals of mice in the single-wall carbon nanotube anti-MALAT1 treatment group were remarkably lower compared to the control after 21 days of treatment. From these results, it was concluded that the single-wall carbon nanotube anti-MALAT1 treatment via intravenous injection could deliver the anti-MALAT1 oligos to tumor cells effectively.No significant side effects of the treatment were observed, indicating that single-wall carbon nanotube anti-MALAT1 injection is a safe treatment for mice. While attempting this procedure, it is important to remember that the cell molecule composition will influence the delivery, efficiency, and therapeutic effect of the oligonucleotide drugs. Following this procedure, other methods like conjugation of proteins or small molecules can be performed in order to answer additional questions.Like using single-wall carbon nanotubes to deliver other drugs.

repression-multiple-myeloma-cell-growth-vivo-single-wall-carbon

Research

JoVE Journal

Cancer Research

6.3K 조회수.  Cleveland Clinic. 여기서 우리가 사용하는 방법은 약물 전달을 위한 나노입자의 새로운 유형인 단일 벽 탄소 나노튜브로 올리고뉴클레오티드를 포장하는 데 도움이 될 수 있습니다. 이 기술의 주요 장점은 생체 내 세포로 올리고뉴클레오티드 약물을 보다 효율적으로 전달하는 것입니다. 이 기술의 의미는 올리고뉴클레오티드 약물의 전달을 개선하기 위해 나노 입자를 도입했기 때문에 다발?...