Name: repression of multiple myeloma cell growth in vivo by single-wall carbon nanotube (swcnt)-delivered malat1 antisense oligos
Uploaded: 2018-12-13T13:00:00
Description: Watch this Scientific Journal Video about Repression of Multiple Myeloma Cell Growth In Vivo by Single-wall Carbon Nanotube SWCNT-delivered MALAT1 Antisense Oligos at JoVE.com

The authors thank the Lerner Research Institute proteomic, genomic, and imaging cores for their assistance and support. Funding: This work was financially supported by NIH/NCI grant R00 CA172292 (to J.J.Z.) and start-up funds (to J.J.Z.) and the Clinical and Translational Science Collaborative (CTSC) of Case Western Reserve University Core Utilization Pilot Grant (to J.J.Z.). This work utilized the Leica SP8 confocal microscope that was purchased with funding from National Institutes of Health SIG grant 1S10OD019972-01.

All experiments involving animals were pre-approved by the Cleveland Clinic IACUC (Institutional Animal Care and Use Committee).
1. Synthesis of Functionalized SWCNTs
<ol>
	<li>Mix 1 mg of SWCNTs, 5 mg of DSPE-PEG2000-Amine, and 5 mL of sterilized nuclease-free water in a glass scintillation vial (20 mL). Shake it well to dissolve all reagents completely.</li>
	<li>Sonicate the vial in a water bath sonicator at a power level of 40 W for 1 h at room temperature (RT, 20 min x 3, change the wat...

<ol>
	<li>Jiang, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=RNase+non-sensitive+and+endocytosis+independent+siRNA+delivery+system:+delivery+of+siRNA+into+tumor+cells+and+high+efficiency+induction+of+apoptosis.">RNase non-sensitive and endocytosis independent siRNA delivery system: delivery of siRNA into tumor cells and high efficiency induction of apoptosis.</a> Nanoscale. 5 (16), 7256-7264 (2013).</li><li>Murakami, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Water-dispersed+single-wall+carbon+nanohorns+as+drug+carriers+for+local+cancer+chemotherapy.">Water-dispersed single-wall carbon nanohorns as drug carriers for local cancer chemotherapy.</a> Nanomedicine (Lond). 3 (4), 453-463 (2008).</li><li>Kam, N. W., Dai, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Carbon+nanotubes+as+intracellular+protein+transporters:+generality+and+biological+functionality.">Carbon nanotubes as intracellular protein transporters: generality and biological functionality.</a> Journal of the American Chemical Society. 127 (16), 6021-6026 (2005).</li><li>Kam, N. W., Liu, Z., Dai, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Functionalization+of+carbon+nanotubes+via.+cleavable+disulfide+bonds+for+efficient+intracellular+delivery+of+siRNA+and+potent+gene+silencing.">Functionalization of carbon nanotubes via. cleavable disulfide bonds for efficient intracellular delivery of siRNA and potent gene silencing.</a> Journal of the American Chemical Society. 127 (36), 12492-12493 (2005).</li><li>Kam, N. W., Liu, Z., Dai, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Carbon+nanotubes+as+intracellular+transporters+for+proteins+and+DNA:+an+investigation+of+the+uptake+mechanism+and+pathway.">Carbon nanotubes as intracellular transporters for proteins and DNA: an investigation of the uptake mechanism and pathway.</a> Angewandte Chemie International Edition in English. 45 (4), 577-581 (2006).</li><li>Ntziachristos, P., Abdel-Wahab, O., Aifantis, I. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Emerging+concepts+of+epigenetic+dysregulation+in+hematological+malignancies.">Emerging concepts of epigenetic dysregulation in hematological malignancies.</a> Nature Immunology. 17 (9), 1016-1024 (2016).</li><li>Evans, J. R., Feng, F. Y., Chinnaiyan, A. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+bright+side+of+dark+matter:+lncRNAs+in+cancer.">The bright side of dark matter: lncRNAs in cancer.</a> Journal of Clinical Investigation. 126 (8), 2775-2782 (2016).</li><li>Ronchetti, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Distinct+lncRNA+transcriptional+fingerprints+characterize+progressive+stages+of+multiple+myeloma.">Distinct lncRNA transcriptional fingerprints characterize progressive stages of multiple myeloma.</a> Oncotarget. 7 (12), 14814-14830 (2016).</li><li>Wong, K. Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Epigenetic+silencing+of+a+long+non-coding+RNA+KIAA0495+in+multiple+myeloma.">Epigenetic silencing of a long non-coding RNA KIAA0495 in multiple myeloma.</a> Molecular Cancer. 14, 175 (2015).</li><li>Schmidt, L. H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+long+noncoding+MALAT-1+RNA+indicates+a+poor+prognosis+in+non-small+cell+lung+cancer+and+induces+migration+and+tumor+growth.">The long noncoding MALAT-1 RNA indicates a poor prognosis in non-small cell lung cancer and induces migration and tumor growth.</a> Journal of Thoracic Oncology. 6 (12), 1984-1992 (2011).</li><li>Ji, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=MALAT-1,+a+novel+noncoding+RNA,+and+thymosin+beta4+predict+metastasis+and+survival+in+early-stage+non-small+cell+lung+cancer.">MALAT-1, a novel noncoding RNA, and thymosin beta4 predict metastasis and survival in early-stage non-small cell lung cancer.</a> Oncogene. 22 (39), 8031-8041 (2003).</li><li>Luo, J. H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transcriptomic+and+genomic+analysis+of+human+hepatocellular+carcinomas+and+hepatoblastomas.">Transcriptomic and genomic analysis of human hepatocellular carcinomas and hepatoblastomas.</a> Hepatology. 44 (4), 1012-1024 (2006).</li><li>Guffanti, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+transcriptional+sketch+of+a+primary+human+breast+cancer+by+454+deep+sequencing.">A transcriptional sketch of a primary human breast cancer by 454 deep sequencing.</a> BMC Genomics. 10, 163 (2009).</li><li>Cho, S. F., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=MALAT1+long+non-coding+RNA+is+overexpressed+in+multiple+myeloma+and+may+serve+as+a+marker+to+predict+disease+progression.">MALAT1 long non-coding RNA is overexpressed in multiple myeloma and may serve as a marker to predict disease progression.</a> BMC Cancer. 14, 809 (2014).</li><li>Handa, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Long+non-coding+RNA+MALAT1+is+an+inducible+stress+response+gene+associated+with+extramedullary+spread+and+poor+prognosis+of+multiple+myeloma.">Long non-coding RNA MALAT1 is an inducible stress response gene associated with extramedullary spread and poor prognosis of multiple myeloma.</a> British Journal of Haematology. 179 (3), 449-460 (2017).</li><li>Hu, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Targeting+the+MALAT1/PARP1/LIG3+complex+induces+DNA+damage+and+apoptosis+in+multiple+myeloma.">Targeting the MALAT1/PARP1/LIG3 complex induces DNA damage and apoptosis in multiple myeloma.</a> Leukemia. , (2018).</li><li>Lennox, K. A., Behlke, M. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cellular+localization+of+long+non-coding+RNAs+affects+silencing+by+RNAi+more+than+by+antisense+oligonucleotides.">Cellular localization of long non-coding RNAs affects silencing by RNAi more than by antisense oligonucleotides.</a> Nucleic Acids Research. 44 (2), 863-877 (2016).</li><li>Kam, N. W., O'Connell, M., Wisdom, J. A., Dai, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Carbon+nanotubes+as+multifunctional+biological+transporters+and+near-infrared+agents+for+selective+cancer+cell+destruction.">Carbon nanotubes as multifunctional biological transporters and near-infrared agents for selective cancer cell destruction.</a> Proceedings of the National Academy of Sciences of the United States of America. 102 (33), 11600-11605 (2005).</li><li>Zeineldin, R., Al-Haik, M., Hudson, L. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Role+of+polyethylene+glycol+integrity+in+specific+receptor+targeting+of+carbon+nanotubes+to+cancer+cells.">Role of polyethylene glycol integrity in specific receptor targeting of carbon nanotubes to cancer cells.</a> Nano Letters. 9 (2), 751-757 (2009).</li><li>Amodio, N., D'Aquila, P., Passarino, G., Tassone, P., Bellizzi, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Epigenetic+modifications+in+multiple+myeloma:+recent+advances+on+the+role+of+DNA+and+histone+methylation.">Epigenetic modifications in multiple myeloma: recent advances on the role of DNA and histone methylation.</a> Expert Opinion on Therapeutic Targets. 21 (1), 91-101 (2017).</li><li>Ahmad, N., Haider, S., Jagannathan, S., Anaissie, E., Driscoll, J. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=MicroRNA+theragnostics+for+the+clinical+management+of+multiple+myeloma.">MicroRNA theragnostics for the clinical management of multiple myeloma.</a> Leukemia. 28 (4), 732-738 (2014).</li><li>Amodio, N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Drugging+the+lncRNA+MALAT1+via.+LNA+gapmeR+ASO+inhibits+gene+expression+of+proteasome+subunits+and+triggers+anti-multiple+myeloma+activity.">Drugging the lncRNA MALAT1 via. LNA gapmeR ASO inhibits gene expression of proteasome subunits and triggers anti-multiple myeloma activity.</a> Leukemia. , (2018).</li><li>Highleyman, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=FDA+approves+fomivirsen,+famciclovir,+and+Thalidomide.+Food+and+Drug+Administration.">FDA approves fomivirsen, famciclovir, and Thalidomide. Food and Drug Administration.</a> BETA. 5, (1998).</li><li>Smith, R. J., Hiatt, W. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Two+new+drugs+for+homozygous+familial+hypercholesterolemia:+managing+benefits+and+risks+in+a+rare+disorder.">Two new drugs for homozygous familial hypercholesterolemia: managing benefits and risks in a rare disorder.</a> JAMA Internal Medicine. 173 (16), 1491-1492 (2013).</li><li>Aartsma-Rus, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=FDA+Approval+of+Nusinersen+for+Spinal+Muscular+Atrophy+Makes+2016+the+Year+of+Splice+Modulating+Oligonucleotides.">FDA Approval of Nusinersen for Spinal Muscular Atrophy Makes 2016 the Year of Splice Modulating Oligonucleotides.</a> Nucleic Acid Therapeutics. 27 (2), 67-69 (2017).</li><li>Nelson, S. F., Miceli, M. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=FDA+Approval+of+Eteplirsen+for+Muscular+Dystrophy.">FDA Approval of Eteplirsen for Muscular Dystrophy.</a> The Journal of the American Medical Association. 317 (14), 1480 (2017).</li><li>Liu, Z., Sun, X., Nakayama-Ratchford, N., Dai, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Supramolecular+chemistry+on+water-soluble+carbon+nanotubes+for+drug+loading+and+delivery.">Supramolecular chemistry on water-soluble carbon nanotubes for drug loading and delivery.</a> American Chemical Society Nano. 1 (1), 50-56 (2007).</li><li>Ali-Boucetta, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Multiwalled+carbon+nanotube-doxorubicin+supramolecular+complexes+for+cancer+therapeutics.">Multiwalled carbon nanotube-doxorubicin supramolecular complexes for cancer therapeutics.</a> Chemical communications (Cambridge). (4), 459-461 (2008).</li><li>Bianco, A., Kostarelos, K., Partidos, C. D., Prato, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Biomedical+applications+of+functionalised+carbon+nanotubes.">Biomedical applications of functionalised carbon nanotubes.</a> Chemical communications. (5), 571-577 (2005).</li><li>Hadidi, N., Kobarfard, F., Nafissi-Varcheh, N., Aboofazeli, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Optimization+of+single-walled+carbon+nanotube+solubility+by+noncovalent+PEGylation+using+experimental+design+methods.">Optimization of single-walled carbon nanotube solubility by noncovalent PEGylation using experimental design methods.</a> International Journal of Nanomedicine. 6, 737-746 (2011).</li><li>Padilla-Parra, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Quantitative+imaging+of+endosome+acidification+and+single+retrovirus+fusion+with+distinct+pools+of+early+endosomes.">Quantitative imaging of endosome acidification and single retrovirus fusion with distinct pools of early endosomes.</a> Proceedings of the National Academy of Sciences of the United States of America. 109 (43), 17627-17632 (2012).</li><li>Wu, H., Zhu, L., Torchilin, V. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=pH-sensitive+poly(histidine)-PEG/DSPE-PEG+co-polymer+micelles+for+cytosolic+drug+delivery.">pH-sensitive poly(histidine)-PEG/DSPE-PEG co-polymer micelles for cytosolic drug delivery.</a> Biomaterials. 34 (4), 1213-1222 (2013).</li><li>Oishi, M., Nagatsugi, F., Sasaki, S., Nagasaki, Y., Kataoka, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Smart+polyion+complex+micelles+for+targeted+intracellular+delivery+of+PEGylated+antisense+oligonucleotides+containing+acid-labile+linkages.">Smart polyion complex micelles for targeted intracellular delivery of PEGylated antisense oligonucleotides containing acid-labile linkages.</a> Chembiochem. 6 (4), 718-725 (2005).</li><li>Dong, H., Ding, L., Yan, F., Ji, H., Ju, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+use+of+polyethylenimine-grafted+graphene+nanoribbon+for+cellular+delivery+of+locked+nucleic+acid+modified+molecular+beacon+for+recognition+of+microRNA.">The use of polyethylenimine-grafted graphene nanoribbon for cellular delivery of locked nucleic acid modified molecular beacon for recognition of microRNA.</a> Biomaterials. 32 (15), 3875-3882 (2011).</li><li>Arunachalam, B., Phan, U. T., Geuze, H. J., Cresswell, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Enzymatic+reduction+of+disulfide+bonds+in+lysosomes:+characterization+of+a+gamma-interferon-inducible+lysosomal+thiol+reductase+(GILT).">Enzymatic reduction of disulfide bonds in lysosomes: characterization of a gamma-interferon-inducible lysosomal thiol reductase (GILT).</a> Proceedings of the National Academy of Sciences of the United States of America. 97 (2), 745-750 (2000).</li><li>Lelimousin, M., Sansom, M. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Membrane+perturbation+by+carbon+nanotube+insertion:+pathways+to+internalization.">Membrane perturbation by carbon nanotube insertion: pathways to internalization.</a> Small. 9 (21), 3639-3646 (2013).</li><li>Thomas, M., Enciso, M., Hilder, T. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Insertion+mechanism+and+stability+of+boron+nitride+nanotubes+in+lipid+bilayers.">Insertion mechanism and stability of boron nitride nanotubes in lipid bilayers.</a> J Phys Chem B. 119 (15), 4929-4936 (2015).</li><li>Jin, H., Heller, D. A., Strano, M. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Single-particle+tracking+of+endocytosis+and+exocytosis+of+single-walled+carbon+nanotubes+in+NIH-3T3+cells.">Single-particle tracking of endocytosis and exocytosis of single-walled carbon nanotubes in NIH-3T3 cells.</a> Nano Letters. 8 (6), 1577-1585 (2008).</li><li>Jin, H., Heller, D. A., Sharma, R., Strano, M. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Size-dependent+cellular+uptake+and+expulsion+of+single-walled+carbon+nanotubes:+single+particle+tracking+and+a+generic+uptake+model+for+nanoparticles.">Size-dependent cellular uptake and expulsion of single-walled carbon nanotubes: single particle tracking and a generic uptake model for nanoparticles.</a> American Chemical Society Nano. 3 (1), 149-158 (2009).</li><li>Ruggiero, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Paradoxical+glomerular+filtration+of+carbon+nanotubes.">Paradoxical glomerular filtration of carbon nanotubes.</a> Proceedings of the National Academy of Sciences of the United States of America. 107 (27), 12369-12374 (2010).</li></ol>

Evidence has shown that lncRNAs take part in the regulation of numerous physiological and pathophysiological procedures in cancers, including MM7,8,9; they have the potential to be targeted for cancer treatment, which can be realized by antisense oligonucleotides20,21,22. The U.S. Food and Drug Administration (FDA) has approved several ...

The SWCNT is a novel nanomaterial that can deliver various types of drugs, such as proteins, small molecules, and nucleic acids, stably and efficiently with ideal tolerability and minimum toxicity in vitro1 and in vivo2. A functionalized SWCNT has great biocompatibility and water solubility, can be used as a shuttle for smaller molecules, and can carry them to penetrate the cell membrane3,4,5.
lncRNAs are a cluster of RNA (&#62;200 nt) that are transcribed from the genome to mRNA but cannot be translated to proteins. Increasing evidence has shown that lncRNAs participate in the regulation of gene expression6 and are involved in the initiation and progression of most types of cancer, including MM7,8,9. MALAT1 is a nuclear-enriched noncoding transcript 2 (NEAT2) and a highly conserved lncRNA10. MALAT1 is initially recognized in metastatic non-small-cell lung cancer (NSCLC)11, but has been overexpressed in numerous tumors5,12,13; it is one of the most highly expressed lncRNAs and is correlated with a poor prognosis in MM8,14. The expression level of MALAT1 is significantly higher in fatal course extramedullary MM patients compared to those only diagnosed as MM15.
In a previous study, we have confirmed that anti-MALAT1 oligos robustly lead to DNA damage and apoptosis in MM16 by using gapmer DNA antisense oligonucleotides targeting MALAT1 (anti-MALAT1) in MM cells. The gapmer DNA is composed of antisense DNA and linked by 2&#39;-OMe-RNAs, which could prompt MALAT1 cleavage by RNase H activity once bound17. The in vivo delivery efficiency of antisense oligos still limits its clinical usage.
To test the delivery effect of SWCNT for anti-MALAT1 gapmer oligos, the anti-MALAT1 gapmer DNA is conjugated to DSPE-PEG2000-amine functionalized SWCNT. The SWCNT-anti-MALAT1 is then injected intravenously into an MM disseminated mouse model; a striking inhibition is observed after four treatments.

<table border="0" cellpadding="0" cellspacing="0" style="width:1168px;" width="1167">
	<colgroup>
		<col />
		<col />
		<col />
		<col />
	</colgroup>
	<tbody>
		<tr height="40">
			<td height="40" style="height:40px;width:324px;">SWCNTs</td>
			<td style="width:199px;">Millipore-Sigma</td>
			<td style="width:209px;">704113</td>
			<td style="width:436px;"></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">DSPE-PEG2000-Amine</td>
			<td>Avanti Polar Lipids</td>
			<td>880128</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">bath sonicator</td>
			<td>VWR</td>
			<td>97043-992</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">4 mL centrifugal filter</td>
			<td>Millipore-Sigma</td>
			<td>Z740208-8EA</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">UV/VIS spectrometer</td>
			<td>Thermo Fisher Scientific</td>
			<td>accuSkan GO UV/Vis Microplate Spectrophotometer</td>
			<td>extinction coefficient of 0.0465 L/mg/cm at 808 nm</td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">Sulfo-LC-SPDP</td>
			<td>ProteoChem</td>
			<td>c1118</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">DTT solution</td>
			<td>Millipore-Sigma</td>
			<td>43815</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">NAP-5 column</td>
			<td>GE Healthcare</td>
			<td>17-0853-01</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">in vivo imaging system</td>
			<td>PerkinElmer</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">NOD.CB17-Prkdcscid/J mice</td>
			<td>Charles River lab</td>
			<td>250</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">Flow cytometer</td>
			<td>Becton Dickinso</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">Lipofectamine</td>
			<td>Invitrogen</td>
			<td>11668019</td>
			<td>Lipofectamine2000</td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">Fetal bovine serum (FBS)</td>
			<td>Invitrogen</td>
			<td>10437-028</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">RMPI-1640 medium</td>
			<td>Invitrogen</td>
			<td>11875-093</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">MALAT1-QF:</td>
			<td>synthesized by IDT Company</td>
			<td style="width:209px;"></td>
			<td>5&#8217;- GTTCTGATCCCGCTGCTATT - 3&#8217;</td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">MALAT1-QR:</td>
			<td>synthesized by IDT Company</td>
			<td style="width:209px;"></td>
			<td>5&#8217;- TCCTCAACACTCAGCCTTTATC - 3&#8217;</td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">GAPDH-QF:</td>
			<td>synthesized by IDT Company</td>
			<td style="width:209px;"></td>
			<td>5&#8217;- CAAGAGCACAAGAGGAAGAGAG - 3&#8217;</td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">GAPDH-QR:</td>
			<td>synthesized by IDT Company</td>
			<td style="width:209px;"></td>
			<td>5&#8217;- CTACATGGCAACTGTGAGGAG - 3&#8217;</td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">Quantitative PCR using SYBR Green PCR master mix</td>
			<td>Thermo Fisher Scientific</td>
			<td>A25780</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">RevertAid first-stand cDNA synthesis kit</td>
			<td>Thermo Fisher Scientific</td>
			<td>K1621</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">anti-MALAT1</td>
			<td>synthesized by IDT Company</td>
			<td></td>
			<td>5&#8217;-mC*mG*mA*mA*mA*C*A*T*T 
			*G*G*C*A*C*A*mC*mA*mG*mC*mA-3&#8217;</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Cell Viability Assay Kit</td>
			<td>Promega Corporation</td>
			<td>G7570</td>
			<td>CellTiter-GloLuminescent Cell Viability Assay Kit</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">accuSkan GO UV/Vis Microplate Spectrophotometer</td>
			<td>Thermo Fisher Scientific</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">centrifugal filter</td>
			<td>Millipore-Sigma</td>
			<td>UFC910008</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">SPSS software</td>
			<td>IBM</td>
			<td>version 24.0</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">D-Luciferin</td>
			<td>Millipore-Sigma</td>
			<td>L9504</td>
			<td></td>
		</tr>
	</tbody>
</table>

repression of multiple myeloma cell growth in vivo by single-wall carbon nanotube (swcnt)-delivered malat1 antisense oligos

The single-wall carbon nanotube (SWCNT) is a new type of nanoparticle, which has been used to deliver multiple kinds of drugs into cells, such as proteins, oligonucleotides, and synthetic small-molecule drugs. The SWCNT has customizable dimensions, a large superficial area, and can flexibly bind with drugs through different modifications on its surface; therefore, it is an ideal system to transport drugs into cells. Long noncoding RNAs (lncRNAs) are a cluster of noncoding RNA longer than 200 nt, which cannot be translated to protein but play an important role in biological and pathophysiological processes. Metastasis-associated lung adenocarcinoma transcript 1 (MALAT1) is a highly conserved lncRNA. It was demonstrated that higher MALAT1 levels are related to the poor prognosis of various cancers, including multiple myeloma (MM). We have revealed that MALAT1 regulates DNA repair and cell death in MM; thus, MALAT1 can be considered as a therapeutic target for MM. However, the efficient delivery of the antisense oligo to inhibit/knockdown MALAT1 in vivo is still a problem. In this study, we modify the SWCNT with PEG-2000 and conjugate an anti-MALAT1 oligo to it, test the delivery of this compound in vitro, inject it intravenously into a disseminated MM mouse model, and observe a significant inhibition of MM progression, which indicates that SWCNT is an ideal delivery shuttle for anti-MALAT1 gapmer DNA.

To demonstrate the inhibition effect of anti-MALAT1 gapmer DNA in MM, we knocked down the expression of MALAT1 and used it in H929 and MM.1S cells. Forty-eight hours later, cells were collected for the analysis of knock-down efficiency and the apoptosis status in cells transfected with anti-MALAT1 gapmer or control DNA. qRT-PCR results showed that anti-MALAT1 gapmer DNA knocked down the MALAT1 expression in H929 and MM.1S cells efficiently (Figure 2A<...

Watch this Scientific Journal Video about Repression of Multiple Myeloma Cell Growth In Vivo by Single-wall Carbon Nanotube SWCNT-delivered MALAT1 Antisense Oligos at JoVE.com

Repression of Multiple Myeloma Cell Growth In Vivo by Single-wall Carbon Nanotube SWCNT-delivered MALAT1 Antisense Oligos

This manuscript describes the synthesis of a single-wall carbon nanotube (SWCNT)-conjugated MALAT1 antisense gapmer DNA oligonucleotide (SWCNT-anti-MALAT1), which demonstrates the reliable delivery of the SWCNT and the potent therapeutic effect of anti-MALAT1 in vitro and in vivo. Methods used for synthesis, modification, conjugation, and injection of SWCNT-anti-MALAT1 are described.

Repression of Multiple Myeloma Cell Growth In Vivo by Single-wall Carbon Nanotube (SWCNT)-delivered MALAT1 Antisense Oligos

The single-wall carbon nanotube (SWCNT) is a new type of nanoparticle, which has been used to deliver multiple kinds of drugs into cells, such as ...

The method we are using here can help to package oligonucleotide with single-wall carbon nanotube, which is a new type of nanoparticle for drug delivery. The main advantage of this technique is more efficient delivery of oligonucleotide drugs into cells in vivo. The implications of this technique extend to research multiple myeloma, because it's introduced nanoparticle to improve the delivery of oligonucleotide drugs.Through this method can provide insight into treatment for multiple myeloma. It can also be applied to other diseases and conjugated with other cargo, such as proteins and small molecules. First, mix one milligram of single-wall carbon nanotubes, five milligrams of DSPE-PEG 2000 amine, and five milliliters of sterilized nuclease-free water in a 20-milliliter glass scintillation vial.Sonicate the vial in a waterbath sonicator at a power level of 90 watts for one hour at room temperature. Following sonication, centrifuge the vial at 24, 000 times g for six hours. Then collect the supernatant solution.Add one milliliter of the single-wall carbon nanotube solution to a 100-kilodalton molecular weight cutoff centrifugal filter device followed by four milliliters of sterilized nuclease-free water. Centrifuge for 10 minutes at 4, 000 times g at room temperature to remove the excess amine. Add 0.5 milligrams of Sulfo-LC-SPDP to 450 microliters of the amine-functionalized single-wall carbon nanotube.Then add 50 microliters of 10x PBS, and incubate for two hours at room temperature. Next, add the reaction mixture to a 100-kilodalton molecular weight cutoff centrifugal filter device, followed by four milliliters of nuclease-free water. Centrifuge the sample for 10 minutes at 4, 000 times g at room temperature to remove the excess Sulfo-LC-SPDP.Collect the Sulfo-LC-SPDP-treated amine single-wall carbon nanotube solution left in the filter, and dilute it with 500 microliters of previously-prepared anti-MALAT1-Cy3 solution. Then incubate the sample at four degrees Celsius overnight. To achieve the best results of comparison, randomly arrange 14 mice into trial or control groups with seven in each group, and with the same male-to-female ratio in each group.Next, clean the operation bench and sterilize it with 70%ethyl alcohol. Use a heating lamp to warm one of the mice to help the tail vein to appear. Restrain the mouse properly with a tail injection restrainer.Inject MM.1S-luc/mCherry cells in 50 microliters of PBS through the tail vein. Press the injection site with an alcohol swab for 30 seconds. Then mark the injected mouse and return it to a clean cage.On day seven, after the MM1S cell injection, inject 50 microliters of PBS containing single-wall carbon nanotube anti-MALAT1 into the tail vein of the mouse. Then press the injection site with an alcohol swab for 30 seconds. Observe the local bleeding on the tail and the general behavior of the mouse for one minute, and then return it to a clean cage.Observe all injected mice again before returning the cage to the rack to make sure that the injections are tolerated well. Weigh each mouse before dissection. Collect peripheral blood from the heart for a complete blood count assay performed by a blood cell counter machine.Next, collect the tissues of the bone marrow, spleen, lymph node, kidney, and the tissue with visible metastasis. Extract RNA and protein from the bone marrow samples. Fix all remaining tissues in formalin.After 24 hours of fixation, immerse the bone samples in a 0.5-molar EDTA solution for five days for decalcification. Then immerse all samples in 75%ethyl alcohol for long-term storage. QRT PCR results showed that anti-MALAT1 gapmeR DNA knocked down the MALAT1 expression and induced apoptosis significantly in H929 and MM.1S cells.Single-wall carbon nanotube anti-MALAT1-Cy3 was delivered into the nucleus of MM cells, and significantly suppressed the endogenous MALAT1 level in both H929 and MM.1S cells. The viability of BMEC-1 cell has no significant difference after treatment of single-wall carbon nanotube anti-MALAT1-Cy3 or control at different dosages and timepoints. This indicates that the toxicity of single-wall carbon nanotube anti-MALAT1-Cy3 has a limited and acceptable toxicity to normal cells at high dosage.A human MM-disseminated mouse model was established to evaluate the treatment effects of single-wall carbon nanotube anti-MALAT1 in vivo. The luciferon signals of mice in the single-wall carbon nanotube anti-MALAT1 treatment group were remarkably lower compared to the control after 21 days of treatment. From these results, it was concluded that the single-wall carbon nanotube anti-MALAT1 treatment via intravenous injection could deliver the anti-MALAT1 oligos to tumor cells effectively.No significant side effects of the treatment were observed, indicating that single-wall carbon nanotube anti-MALAT1 injection is a safe treatment for mice. While attempting this procedure, it is important to remember that the cell molecule composition will influence the delivery, efficiency, and therapeutic effect of the oligonucleotide drugs. Following this procedure, other methods like conjugation of proteins or small molecules can be performed in order to answer additional questions.Like using single-wall carbon nanotubes to deliver other drugs.

repression-multiple-myeloma-cell-growth-vivo-single-wall-carbon

Research

JoVE Journal

Cancer Research

In Vivo EPR Assessment of pH, pO2, Redox Status, and Concentrations of Phosphate and Glutathione in the Tumor Microenvironment

This protocol demonstrates the capability of low-field electron paramagnetic resonance (EPR)-based techniques in combination with functional paramagnetic probes to provide quantitative information on the chemical tumor microenvironment (TME), including pO2, pH, redox status, concentrations of interstitial inorganic phosphate (Pi), and intracellular glutathione (GSH). In particular, an application of a recently developed soluble multifunctional trityl probe provides unsurpassed opportunity for in vivo concurrent measurements of pH, pO2 and Pi in Extracellular space (HOPE probe). The measurements of three parameters using a single probe allow for their correlation analyses independent of probe distribution and time of the measurements.

In Vivo EPR Assessment of pH, pO2, Redox Status, and Concentrations of Phosphate and Glutathione in the Tumor Microenvironment

Low-field (L-band, 1.2 GHz) electron paramagnetic resonance using soluble nitroxyl and trityl probes is demonstrated for assessment of physiologically important parameters in the tumor microenvironment in mouse models of breast cancer.

This protocol demonstrates the capability of low-field electron paramagnetic resonance (EPR)-based techniques in combination with functional paramagnetic ...

Multimodal Bioluminescent and Positronic-emission Tomography/Computational Tomography Imaging of Multiple Myeloma Bone Marrow Xenografts in NOG Mice

Multiple myeloma (MM) tumors engraft in the bone marrow (BM) and their survival and progression are dependent upon complex molecular and cellular interactions that exist within this microenvironment. Yet the BM microenvironment cannot be easily replicated in vitro, which potentially limits the physiologic relevance of many in vitro and ex vivo experimental models. These issues can be overcome by utilizing a xenograft model in which luciferase (LUC)-transfected 8226 MM cells will specifically engraft in the mouse skeleton. When these mice are given the appropriate substrate, D-luciferin, the effects of therapy on tumor growth and survival can be analyzed by measuring changes in the bioluminescent images (BLI) produced by the tumors in vivo. This BLI data combined with positronic-emission tomography/computational tomography (PET/CT) analysis using the metabolic marker 2-deoxy-2-(18F)fluoro-D-glucose (18F-FDG) is used to monitor changes in tumor metabolism over time. These imaging platforms allow for multiple noninvasive measurements within the tumor/BM microenvironment.

Here we use bioluminescent, X-ray, and positron-emission tomography/computed tomography imaging to study how inhibiting mTOR activity impacts bone marrow-engrafted myeloma tumors in a xenograft model. This allows for physiologically relevant, non-invasive, and multimodal analyses of the anti-myeloma effect of therapies targeting bone marrow-engrafted myeloma tumors in vivo.

Multiple myeloma (MM) tumors engraft in the bone marrow (BM) and their survival and progression are dependent upon complex molecular and cellular ...

Neutrophil Extracellular Traps Generated by Low Density Neutrophils Obtained from Peritoneal Lavage Fluid Mediate Tumor Cell Growth and Attachment

Activated neutrophils release neutrophil extracellular traps (NETs), which can capture and destroy microbes. Recent studies suggest that NETs are involved in various disease processes, such as autoimmune disease, thrombosis, and tumor metastases. Here, we show a detailed in vitro technique to detect NET activity during the trapping of free tumor cells, which grow after attachment to NETs. First, we collected low density neutrophils (LDN) from postoperative peritoneal lavage fluid from patients who underwent laparotomies. Short-term culturing of LDN resulted in massive NET formation that was visualized with green fluorescent nuclear and chromosome counterstain. After co-incubation of human gastric cancer cell lines MKN45, OCUM-1, and NUGC-4 with the NETs, many tumor cells were trapped by the NETs. Subsequently, the attachment was completely abrogated by the degradation of NETs with DNase I. Time-lapse video revealed that tumor cells trapped by the NETs did not die but instead grew vigorously in a continuous culture. These methods may be applied to the detection of adhesive interactions between NETs and various types of cells and materials.

Here, we present a method in which human low-density neutrophils (LDN), recovered from postoperative peritoneal lavage fluid, produce massive neutrophil extracellular traps (NETs) and efficiently trap free tumor cells that subsequently grow.

Activated neutrophils release neutrophil extracellular traps (NETs), which can capture and destroy microbes. Recent studies suggest that NETs are involved ...

Evaluation of Biomarkers in Glioma by Immunohistochemistry on Paraffin-Embedded 3D Glioma Neurosphere Cultures

Analysis of protein expression in glioma is relevant for several aspects in the study of its pathology. Numerous proteins have been described as biomarkers with applications in diagnosis, prognosis, classification, state of tumor progression, and cell differentiation state. These analyses of biomarkers are also useful to characterize tumor neurospheres (NS) generated from glioma patients and glioma models. Tumor NS provide a valuable in vitro model to assess different features of the tumor from which they are derived and can more accurately mirror glioma biology. Here we describe a detailed method to analyze biomarkers in tumor NS using immunohistochemistry (IHC) on paraffin-embedded tumor NS.

Neurospheres grown as 3D cultures constitute a powerful tool to study glioma biology. Here we present a protocol to perform immunohistochemistry while maintaining the 3D structure of glioma neurospheres through paraffin embedding. This method enables the characterization of glioma neurosphere properties such as stemness and neural differentiation.

Analysis of protein expression in glioma is relevant for several aspects in the study of its pathology. Numerous proteins have been described as ...

In Vivo Inhibition of MicroRNA to Decrease Tumor Growth in Mice

MicroRNAs (miRNAs) are important regulators of gene expression through their ability to destabilize mRNA and inhibit translation of target mRNAs. An ever-increasing number of studies have identified miRNAs as potential biomarkers for cancer diagnosis and prognosis, and also as therapeutic targets, adding an extra dimension to cancer evaluation and treatment. In the context of thyroid cancer, tumorigenesis results not only from mutations in important genes, but also from the overexpression of many miRNAs. Accordingly, the role of miRNAs in the control of thyroid gene expression is evolving as an important mechanism in cancer. Herein, we present a protocol to examine the effects of miRNA-inhibitor delivery as a therapeutic modality in thyroid cancer using human tumor xenograft and orthotopic mouse models. After engineering stable thyroid tumoral cells expressing GFP and luciferase, cells are injected into nude mice to develop tumors, which can be followed by bioluminescence. The in vivo inhibition of a miRNA can reduce tumor growth and upregulate miRNA gene targets. This method can be used to assess the importance of a determined miRNA in vivo, in addition to identifying new therapeutic targets.

This protocol describes xenograft and orthotopic mouse models of human thyroid tumorigenesis as a platform to test microRNA-based inhibitor treatments. This approach is ideal to study the function of non-coding RNAs and their potential as new therapeutic targets.

MicroRNAs (miRNAs) are important regulators of gene expression through their ability to destabilize mRNA and inhibit translation of target mRNAs. An ...

A Mouse Model to Investigate the Role of Cancer-Associated Fibroblasts in Tumor Growth

Cancer-associated fibroblasts (CAFs) can play an important role in tumor growth by creating a tumor-promoting microenvironment. Models to study the role of CAFs in the tumor microenvironment can be helpful for understanding the functional importance of fibroblasts, fibroblasts from different tissues, and specific genetic factors in fibroblasts. Mouse models are essential for understanding the contributors to tumor growth and progression in an in vivo context. Here, a protocol in which cancer cells are mixed with fibroblasts and introduced into mice to develop tumors is provided. Tumor sizes over time and final tumor weights are determined and compared among groups. The protocol described can provide more insight into the functional role of CAFs in tumor growth and progression.

A protocol to co-inject cancer cells and fibroblasts and monitor tumor growth over time is provided. This protocol can be used to understand the molecular basis for the role of fibroblasts as regulators of tumor growth.

Cancer-associated fibroblasts (CAFs) can play an important role in tumor growth by creating a tumor-promoting microenvironment. Models to study the role ...

An Ex Vivo Brain Slice Model to Study and Target Breast Cancer Brain Metastatic Tumor Growth

Brain metastasis is a serious consequence of breast cancer for women as these tumors are difficult to treat and are associated with poor clinical outcomes. Preclinical mouse models of breast cancer brain metastatic (BCBM) growth are useful but are expensive, and it is difficult to track live cells and tumor cell invasion within the brain parenchyma. Presented here is a protocol for ex vivo brain slice cultures from xenografted mice containing intracranially injected breast cancer brain-seeking clonal sublines. MDA-MB-231BR luciferase tagged cells were injected intracranially into the brains of Nu/Nu female mice, and following tumor formation, the brains were isolated, sliced, and cultured ex vivo. The tumor slices were imaged to identify tumor cells expressing luciferase and monitor their proliferation and invasion in the brain parenchyma for up to 10 days. Further, the protocol describes the use of time-lapse microscopy to image the growth and invasive behavior of the tumor cells following treatment with ionizing radiation or chemotherapy. The response of tumor cells to treatments can be visualized by live-imaging microscopy, measuring bioluminescence intensity, and performing histology on the brain slice containing BCBM cells. Thus, this ex vivo slice model may be a useful platform for rapid testing of novel therapeutic agents alone or in combination with radiation to identify drugs personalized to target an individual patient&#39;s breast cancer brain metastatic growth within the brain microenvironment.

An Ex Vivo Brain Slice Model to Study and Target Breast Cancer Brain Metastatic Tumor Growth

We introduce a protocol for measuring real-time drug and radiation response of breast cancer brain metastatic cells in an organotypic brain slice model. The methods provide a quantitative assay to investigate the therapeutic effects of various treatments on brain metastases from breast cancer in an ex vivo manner within the brain microenvironment interface.

Brain metastasis is a serious consequence of breast cancer for women as these tumors are difficult to treat and are associated with poor clinical ...

Defining Gene Functions in Tumorigenesis by Ex vivo Ablation of Floxed Alleles in Malignant Peripheral Nerve Sheath Tumor Cells

The development of new drugs that precisely target key proteins in human cancers is fundamentally altering cancer therapeutics. However, before these drugs can be used, their target proteins must be validated as therapeutic targets in specific cancer types. This validation is often performed by knocking out the gene encoding the candidate therapeutic target in a genetically engineered mouse (GEM) model of cancer and determining what effect this has on tumor growth. Unfortunately, technical issues such as embryonic lethality in conventional knockouts and mosaicism in conditional knockouts often limit this approach. To overcome these limitations, an approach to ablating a floxed embryonic lethal gene of interest in short-term cultures of malignant peripheral nerve sheath tumors (MPNSTs) generated in a GEM model was developed.
This paper describes how to establish a mouse model with the appropriate genotype, derive short-term tumor cultures from these animals, and then ablate the floxed embryonic lethal gene using an adenoviral vector that expresses Cre recombinase and enhanced green fluorescent protein (eGFP). Purification of cells transduced with adenovirus using fluorescence-activated cell sorting (FACS) and the quantification of the effects that gene ablation exerts on cellular proliferation, viability, the transcriptome, and orthotopic allograft growth is then detailed. These methodologies provide an effective and generalizable approach to identifying and validating therapeutic targets in vitro and in vivo. These approaches also provide a renewable source of low-passage tumor-derived cells with reduced in vitro growth artifacts. This allows the biological role of the targeted gene to be studied in diverse biologic processes such as migration, invasion, metastasis, and intercellular communication mediated by the secretome.

Defining Gene Functions in Tumorigenesis by Ex vivo Ablation of Floxed Alleles in Malignant Peripheral Nerve Sheath Tumor Cells

Here, we present a protocol for performing gene knockouts that are embryonic lethal in vivo in genetically engineered mouse model-derived tumors and then assessing the effect that the knockout has on tumor growth, proliferation, survival, migration, invasion, and the transcriptome in vitro and in vivo.

The development of new drugs that precisely target key proteins in human cancers is fundamentally altering cancer therapeutics. However, before these ...

In Vivo Immunogenicity Screening of Tumor-Derived Extracellular Vesicles by Flow Cytometry of Splenic T Cells

Immunogenic cell death of tumors, caused by chemotherapy or irradiation, can trigger tumor-specific T cell responses by releasing danger-associated molecular patterns and inducing the production of type I interferon. Immunotherapies, including checkpoint inhibition, primarily rely on preexisting tumor-specific T cells to unfold a therapeutic effect. Thus, synergistic therapeutic approaches that exploit immunogenic cell death as an intrinsic anti-cancer vaccine may improve their responsiveness. However, the spectrum of immunogenic factors released by cells under therapy-induced stress remains incompletely characterized, especially regarding extracellular vesicles (EVs). EVs, nano-scale membranous particles emitted from virtually all cells, are considered to facilitate intercellular communication and, in cancer, have been shown to mediate cross-priming against tumor antigens. To assess the immunogenic effect of EVs derived from tumors under various conditions, adaptable, scalable, and valid methods are sought-for. Therefore, herein a relatively easy and robust approach is presented to assess EVs' in vivo immunogenicity. The protocol is based on flow cytometry analysis of splenic T cells after in vivo immunization of mice with EVs, isolated by precipitation-based assays from tumor cell cultures under therapy or steady-state conditions. For example, this work shows that oxaliplatin exposure of B16-OVA murine melanoma cells resulted in the release of immunogenic EVs that can mediate the activation of tumor-reactive cytotoxic T cells. Hence, screening of EVs via in vivo immunization and flow cytometry identifies conditions under which immunogenic EVs can emerge. Identifying conditions of immunogenic EV release provides an essential prerequisite to testing EVs' therapeutic efficacy against cancer and exploring the underlying molecular mechanisms to ultimately unveil new insights into EVs' role in cancer immunology.

In Vivo Immunogenicity Screening of Tumor-Derived Extracellular Vesicles by Flow Cytometry of Splenic T Cells

This manuscript describes how to assess in vivo immunogenicity of tumor cell-derived extracellular vesicles (EVs) using flow cytometry. EVs derived from tumors undergoing treatment-induced immunogenic cell death seem particularly relevant in tumor immunosurveillance. This protocol exemplifies the assessment of oxaliplatin-induced immunostimulatory tumor EVs but can be adapted to various settings.

Immunogenic cell death of tumors, caused by chemotherapy or irradiation, can trigger tumor-specific T cell responses by releasing danger-associated ...

Simultaneous Imaging and Flow-Cytometry-based Detection of Multiple Fluorescent Senescence Markers in Therapy-Induced Senescent Cancer Cells

Chemotherapeutic drugs can induce irreparable DNA damage in cancer cells, leading to apoptosis or premature senescence. Unlike apoptotic cell death, senescence is a fundamentally different machinery restraining&#160;propagation of cancer cells. Decades of scientific studies have revealed the complex pathological effects of senescent cancer cells in tumors and microenvironments that modulate cancer cells and stromal cells. New evidence suggests that senescence is a potent prognostic factor during cancer treatment, and therefore rapid and accurate detection of senescent cells in cancer samples is essential. This paper presents a method to visualize and detect therapy-induced senescence (TIS) in cancer cells. Diffuse large B-cell lymphoma (DLBCL) cell lines were treated with mafosfamide (MAF) or daunorubicin (DN) and examined for the senescence marker, senescence-associated &#946;-galactosidase (SA-&#946;-gal), the DNA synthesis marker 5-ethynyl-2&#8242;-deoxyuridine (EdU), and the DNA damage marker gamma-H2AX (&#947;H2AX). Flow cytometer imaging can help generate high-resolution single-cell images in a short period of time to simultaneously visualize and quantify the three markers in cancer cells.

Here we present a flow cytometry-based method for visualization and quantification of multiple senescence-associated markers in single cells.

Chemotherapeutic drugs can induce irreparable DNA damage in cancer cells, leading to apoptosis or premature senescence. Unlike apoptotic cell death, ...