Thank you to the Yale Flow Cytometry Facility, the University of Virginia Flow Cytometry Core Facility, the Yale Center for Genomic Analysis, and the University of Virginia Genome Analysis and Technology Core for their effort, expertise, and advice in contributing to the presented experiments. This study was funded by NIH grants to N.W.C. (T32 HL007224, T32 HL007284), S.C. (T32 HL007284), K.W. (R01 HL142650), and K.K.H. (R01 HL146056, R01 DK118728, UH3 EB025765).

The Institutional Animal Care and Use Committees of Yale University and the University of Virginia approved all animal experiments listed in this protocol.
1. Obtain mouse eyes for retinal isolation
<ol>
	<li>Prepare 1x ice-cold PBS and add 500 &#956;L to each well of a 48-well plate.</li>
	<li>Euthanize neonatal mice at postnatal day six (P6) according to approved institutional guidelines. For this experiment, litters of approximately 4-8 neonatal mice are euthanized at P6&#160;via isoflurane inhalation for at least three minutes after the respiratory arrest, followed by decapitation.</li>
	<li>Remove the eyes from each of the mice. Cut away the skin and membrane over the eye by cutting perpendicular to the eyelid using dissection scissors. Then, use forceps to press down gently above and below the eye so that the eye moves out of the socket.
	<ol>
		<li>Carefully pinch underneath the eye with the forceps and cut the optic nerve that is keeping the eye attached. Then, place each eye in the 48-well plate in the prepared 1x ice-cold PBS until finished harvesting. 
		NOTE: Use one well per mouse, with both eyes from a single mouse in the same well.</li>
	</ol>
	</li>
</ol>
2. Isolate mouse retinal tissue
<ol>
	<li>Fill a Petri dish, lined with a dissection pad on the bottom, with 500 &#956;L of 1x ice-cold PBS to submerge the eyes and place it under a dissection microscope set to 4.0x magnification.
	<ol>
		<li>Suspend eyes in the dissection pad using a transfer pipette with a wide tip so as not to damage the eyes. 
		NOTE: Ensure the eyes are completely covered with PBS.</li>
	</ol>
	</li>
	<li>Using two fine dissection forceps, hold the optic nerve with one of the forceps for stabilization, and with the second forceps pierce a hole through the anterior chamber where the cornea and sclera connect (Figure 1B). Tear the hole in a circle about 75% of the way around the cornea.
	<ol>
		<li>While still holding the optic nerve with one of the forceps, use the second forceps to gently tear the sclera off of the retinal tissue.</li>
		<li>As above, use the second forceps to gently tear off the vitreous body of the retinal tissue.</li>
		<li>Again, using the second forceps, gently remove the lens and hyaloid plexus vessels that did not come off when the vitreous body was removed. To do this, reach into the retina with open forceps until almost touching the retina, close the forceps to grab the lens and hyaloid plexus vessels, and pull the forceps out from the retina. This can be repeated until all vessels are removed. 
		NOTE: The hyaloid plexus resembles a clear, web-like structure.</li>
	</ol>
	</li>
	<li>Fill 2 mL microcentrifuge tubes with 500 &#956;L of 1x ice-cold PBS and place the retinas in the tubes. Isolate all retinas from the eyes and place them into ice-cold PBS before moving on. 
	NOTE: Use one tube per mouse, with two retinas from the same mouse sharing a tube. If retinal tissue is torn, transfer it in multiple pieces. The total time of retinal tissue dissection for a litter of mice should take 15-60 min, starting with euthanasia and ending with final retinal tissue isolation.</li>
</ol>
<img alt="Figure 1" class="xfigimg" src="/files/ftp_upload/63133/63133fig01.jpg" /> 
Figure 1: Overview of the isolation protocol. (A) Schematic of the isolation timeline with an estimated time for each step: Isolation of Retinal Tissue, Digest, Antibody Staining, FACS, and Cell Viability Window. (B) Step-by-step guide for isolation of retinal tissue from the eye, with numbered dissection steps: 1) pierce cornea, 2) tear cornea, 3) tear sclera, 4) remove sclera from the retina, 5) further remove sclera and connecting tissue from the retina, 6) remove the vitreous body and vitreous vessels from the retina. (C) Representative images of retinal tissue during various digestion steps: Pre-digest, Post-digest, Pellet (black arrows highlight retinal tissue or cell pellet). Republished with permission from Chavkin et al. published in S. Karger AG, Basel17. <a href="https://www.jove.com/files/ftp_upload/63133/63133fig01large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
3. Digest retinal tissue into a single cell suspension
<ol>
	<li>Prepare 500 &#956;L digestion solution for every two retinas isolated. Add FBS and Collagenase Type II to DMEM to a final concentration of 10% FBS and 1 mg/mL Collagenase Type II. Mix and warm the solution to 37 &#176;C using a water bath.</li>
	<li>Remove excess PBS from the 2 mL microcentrifuge tubes by carefully pipetting. Leave enough PBS to completely cover the retinal tissue, about 100 &#956;L in each tube.</li>
	<li>Add 500 &#956;L of the digestion solution to each tube with retinal tissue (Figure 1C).
	<ol>
		<li>Use a P1000 pipettor and pipette tip to pipette up and down the retinal tissue in the digestion solution five times.</li>
	</ol>
	</li>
	<li>Incubate the digestion mixture in a 37 &#176;C water bath for 20 min.
	<ol>
		<li>Use a P1000 pipettor and pipette tip to pipette the digestion mixture up and down every 5 min. After incubation, the retinal tissue has dissolved into a single cell suspension, so the digestion mixture should be cloudy (Figure 1C).</li>
	</ol>
	</li>
</ol>
4. Count cells
<ol>
	<li>Set a tabletop centrifuge at 4 &#176;C and place the digestion mixture tubes inside. Pellet the digestion mixture by centrifugation at 375 x g for 5 min.</li>
	<li>Carefully remove the supernatant digestion solution by pipetting. Do not disturb the cell pellet (Figure 1C). Re-suspend the pellet in 500 &#956;L of ice-cold 1x PBS by gently mixing up and down with the pipette.</li>
	<li>Count the cells with a hemocytometer under a microscope. 
	NOTE: Cell counts are approximately 1 x 106 cells per two retinas.</li>
	<li>Ensure the cells are properly resuspended by gentle mixing, and then aliquot 20 &#956;L of cell suspension into three tubes for control staining (tube 1: IgG control, tube 2: CD31 control, and tube 3: CD45 control), as described and used previously17,18.</li>
	<li>Set a tabletop centrifuge at 4 &#176;C and place tubes containing cells inside. Pellet the cells by centrifugation at 375 x g for 5 min.</li>
</ol>
5. Immunostain the cells with antibodies
<ol>
	<li>Prepare 100 &#956;L of staining buffer per two retinas stained plus four control tubes. Add FBS, HEPES, and D-Glucose to HBSS buffer to a final concentration of 10% FBS, 10 mM HEPES, and 1 mg/mL D-Glucose.</li>
	<li>Obtain fluorescently conjugated antibodies against CD31 and CD45. Add the antibodies at a 1:100 dilution into the staining buffer (tube 1: IgG antibody only, tube 2: CD31 antibody only, and tube 3: CD45 antibody only). Add 1 &#956;L of antibody per 100 &#956;L of the staining buffer for a final antibody concentration of 2 &#956;g/mL.</li>
	<li>Carefully remove the PBS from the washed cell pellet by pipetting.</li>
	<li>Resuspend the pellet in 100 &#956;L of antibody staining solution per 0.5 x 106 cells.
	<ol>
		<li>Incubate the single-cell suspension with the antibody staining solution for 30 min on ice in dark. Tap the tubes every 10 min to gently mix the cells.</li>
	</ol>
	</li>
</ol>
6. Prepare for fluorescence-activated cell sorting
<ol>
	<li>Set a tabletop centrifuge at 4 &#176;C and place the tubes containing cells inside. Pellet cells by centrifugation at 375 x g for 5 min.
	<ol>
		<li>Remove the supernatant and resuspend these cells in 500 &#956;L of 1x PBS to wash.</li>
	</ol>
	</li>
	<li>Set a tabletop centrifuge at 4 &#176;C and place the tubes containing cells inside. Pellet cells by centrifugation at 375 x g for 5 min</li>
	<li>Prepare 1.5 mL of FACS Buffer (1% FBS in 1x PBS).
	<ol>
		<li>Remove the supernatant and resuspend the cell pellet in 300 &#956;L of FACS Buffer by gently mixing with a pipettor.</li>
	</ol>
	</li>
	<li>Add propidium iodide (PI) to the sample tubes containing the FACS buffer to a final concentration of 0.5 &#956;g/mL. PI is used as a viability marker.</li>
	<li>Transfer and combine the cell suspensions into 5 mL test tubes through a cell strainer snap cap. The cell strainer snap cap should contain a 35 &#956;m filter, and the cell suspensions can be pipetted directly onto the filter.
	<ol>
		<li>Keep the FACS tubes on ice in the dark and transfer them to the cell sorter.</li>
	</ol>
	</li>
</ol>
7. Set up the FACS instrument
<ol>
	<li>Install a 100 &#181;m nozzle into a FACS instrument. 
	NOTE: This size nozzle minimizes collection volume and maximizes isolated cell density.</li>
	<li>Prepare 250 &#956;L of 1x PBS into a 1.5 mL microcentrifuge tube as a collection tube to be installed into the FACS instrument.</li>
</ol>
8. Isolate viable endothelial cells via FACS
<ol>
	<li>Turn on the FACS instrument and the computer. Click on the FACS software icon to open the FACS software on the computer to run and operate the FACS instrument. Perform routine quality control tests.</li>
	<li>Load the control-stained samples into the FACS instrument to adjust the axes. Start with IgG antibody only cells to generate and adjust FSC and SSC, then CD31-antibody only to generate and adjust CD31, and then CD45-antibody only to generate and adjust CD45. Record data from control samples.</li>
	<li>Load stained sample cells into the FACS instrument and run the sample.</li>
	<li>Gate the cells based on forward-scatter and side-scatter (FSC-A and SSC-A, respectively) parameters (Figure 2A). 
	NOTE: The FSC-A and SSC-A parameters are used to select cells based on size, density, granularity, surface properties, and refractive index.</li>
	<li>Gate cells by FSC-A and FSC-H to identify cell doublets and only collect single cells (Figure 2A). 
	NOTE: The FSC-A and FSC-H parameters are used to select single cells based on the principle that during forward scattering, cell doublets will be droplets containing a greater area-to-height ratio.</li>
	<li>Gate cells by PI and SSC-A to identify viable cells (Figure 2A). 
	NOTE: Viable cells will be PI-negative.</li>
	<li>Make a CD31+/CD45- gate with controls and gate cells by CD31 and CD45 (Figure 2A,B).
	<ol>
		<li>Insert a collection tube with 250 &#956;L of FACS buffer.</li>
		<li>Start sorting cells that are CD31-positive/CD45-negative into the installed collection tube.</li>
		<li>Keep the collection tubes on ice for further analysis. Samples can be processed for next-generation sequencing applications at this step1.</li>
	</ol>
	</li>
</ol>
9. Perform viability assay
<ol>
	<li>Mix 10 &#956;L of cells with 10 &#956;L of 0.4% trypan blue solution to assess cell viability.</li>
	<li>Count viable cells by pipetting the stained mixture onto a hemocytometer slide. Place the slide under a microscope for accurate viability counts. Count blue cells as non-viable and count clear cells as viable.
	<ol>
		<li>Divide the viable cell count by the total cell count to calculate percent viability.</li>
	</ol>
	</li>
</ol>
10. Perform gene expression assay
<ol>
	<li>Obtain 10,000-20,000 cells per sample and perform RNA isolation to analyze murine retinal endothelial cell gene expression. RNA isolation is performed using a commercially available kit that uses ethanol-based RNA precipitation, and then centrifugation and membrane columns to wash and elute purified RNA from cell lysate. Samples can be processed for some next-generation sequencing applications at this step1.</li>
	<li>Convert the RNA to cDNA using reverse transcriptase enzyme and supporting reagents19.</li>
	<li>Quantify using a DNA binding dye and a quantitative PCR (qPCR) machine20. Load cDNA samples in a 384-well qPCR plate with primers to amplify genes of interest. Reaction volume should total to 10 &#181;L, including DNA binding dye, which will be used to quantify gene amplification.
	<ol>
		<li>Use CD31, VE-Cadherin, CD45, and &#946;-actin forward and reverse primers to measure gene expression.</li>
	</ol>
	</li>
	<li>Use the sample for next-generation sequencing applications1.</li>
</ol>

<ol><li>Slatko, B. E., Gardner, A. F., Ausubel, F. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Overview+of+next-generation+sequencing+technologies%5BTitle%5D)+AND+%22Current+Protocols+in+Molecular+Biology%22%5BJournal%5D)">Overview of next-generation sequencing technologies.</a> Current Protocols in Molecular Biology. 122 (1), 59(2018).</li>
<li>Chavkin, N. W., Hirschi, K. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Single+cell+analysis+in+vascular+biology%5BTitle%5D)+AND+%22Frontiers+in+Cardiovascular+Medicine%22%5BJournal%5D)">Single cell analysis in vascular biology.</a> Frontiers in Cardiovascular Medicine. 7, 42(2020).</li>
<li>Ma, F., Hernandez, G. E., Romay, M., Iruela-Arispe, M. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Single-cell+RNA+sequencing+to+study+vascular+diversity+and+function%5BTitle%5D)+AND+%22Current+Opinion+in+Hematology%22%5BJournal%5D)">Single-cell RNA sequencing to study vascular diversity and function.</a> Current Opinion in Hematology. 28 (3), 221-229 (2021).</li>
<li>Potter, A. S., Potter, S. S., S, <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Dissociation+of+tissues+for+single-cell+analysis%5BTitle%5D)+AND+%22Methods+in+Molecular+Biology%22%5BJournal%5D)">Dissociation of tissues for single-cell analysis.</a> Methods in Molecular Biology. 1926, 55-62 (2019).</li>
<li>Braga, F. A. V., Miragaia, R. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Tissue+handling+and+dissociation+for+single-cell+RNA-seq%5BTitle%5D)+AND+%22Single+Cell+Methods%3A+Methods+in+Molecular+Biology%22%5BJournal%5D)">Tissue handling and dissociation for single-cell RNA-seq.</a> Single Cell Methods: Methods in Molecular Biology. 1979, 9-21 (2019).</li>
<li>Brink, S. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Single-cell+sequencing+reveals+dissociatin-induced+gene+expression+in+tissue+subpopulations%5BTitle%5D)+AND+%22Nature+Methods%22%5BJournal%5D)">Single-cell sequencing reveals dissociatin-induced gene expression in tissue subpopulations.</a> Nature Methods. 14 (10), 935-936 (2017).</li>
<li>Skulska, K., Wegrzyn, A. S., Chelmonska-Soyta, A., Chodaczek, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Impact+of+tissue+enzymatic+digestion+on+analysis+of+immune+cells+in+mouse+reproductive+mucosa+with+a+focus+on+gammadelta+T+cells%5BTitle%5D)+AND+%22Journal+of+Immunological+Methods%22%5BJournal%5D)">Impact of tissue enzymatic digestion on analysis of immune cells in mouse reproductive mucosa with a focus on gammadelta T cells.</a> Journal of Immunological Methods. 474, 112665(2019).</li>
<li>Connolly, S., Hores, T., Smith, L., D'Amore, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Characterization+of+vascular+development+in+the+mouse+retina%5BTitle%5D)+AND+%22Microvascular+Research%22%5BJournal%5D)">Characterization of vascular development in the mouse retina.</a> Microvascular Research. 36 (3), 275-290 (1988).</li>
<li>Crist, A., Young, C., Meadows, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Characterization+of+arteriovenous+identity+in+the+developing+neonate+mouse+retina%5BTitle%5D)+AND+%22Gene+Expression+Patterns%3A+GEP%22%5BJournal%5D)">Characterization of arteriovenous identity in the developing neonate mouse retina.</a> Gene Expression Patterns: GEP. 23-24, 22-31 (2017).</li>
<li>dela Paz, N. G., D'Amore, P. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Arterial+versus+venous+endothelial+cells%5BTitle%5D)+AND+%22Cell+and+Tissue+Research%22%5BJournal%5D)">Arterial versus venous endothelial cells.</a> Cell and Tissue Research. 335 (1), 5-16 (2009).</li>
<li>Fang, J. S., Hirschi, K. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Molecular+regulation+of+arteriovenous+endothelial+cell+specification%5BTitle%5D)+AND+%22F1000Res%22%5BJournal%5D)">Molecular regulation of arteriovenous endothelial cell specification.</a> F1000Res. 8, (2019).</li>
<li>Smith, L. E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Oxygen-induced+retinopathy+in+the+mouse%5BTitle%5D)+AND+%22Investigative+Ophthalmology+and+Visual+Science%22%5BJournal%5D)">Oxygen-induced retinopathy in the mouse.</a> Investigative Ophthalmology and Visual Science. 35 (1), 101-111 (1994).</li>
<li>Pitulescu, M. E., Schmidt, I., Benedito, R., Adams, R. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Inducible+gene+targeting+in+the+neonatal+vasculature+and+analysis+of+retinal+angiogenesis+in+mice%5BTitle%5D)+AND+%22Nature+Protocols%22%5BJournal%5D)">Inducible gene targeting in the neonatal vasculature and analysis of retinal angiogenesis in mice.</a> Nature Protocols. 5 (9), 1518-1534 (2010).</li>
<li>Ruiz, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((A+mouse+model+of+hereditary+hemorrhagic+telangiectasia+generated+by+transmammary-delivered+immunoblocking+of+BMP9+and+BMP10%5BTitle%5D)+AND+%22Scientific+Reports%22%5BJournal%5D)">A mouse model of hereditary hemorrhagic telangiectasia generated by transmammary-delivered immunoblocking of BMP9 and BMP10.</a> Scientific Reports. 6, 37366(2016).</li>
<li>Fang, J. S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Shear-induced+Notch-Cx37-p27+axis+arrests+endothelial+cell+cycle+to+enable+arterial+specification%5BTitle%5D)+AND+%22Nature+Communication%22%5BJournal%5D)">Shear-induced Notch-Cx37-p27 axis arrests endothelial cell cycle to enable arterial specification.</a> Nature Communication. 8 (1), 2149(2017).</li>
<li>Ola, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((SMAD4+prevents+flow+induced+arterial-venous+malformations+by+inhibiting+Casein+Kinase+2%5BTitle%5D)+AND+%22Circulation%22%5BJournal%5D)">SMAD4 prevents flow induced arterial-venous malformations by inhibiting Casein Kinase 2.</a> Circulation. 138 (21), 2379-2394 (2018).</li>
<li>Chavkin, N. W., Walsh, K., Hirschi, K. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Isolation+of+highly+purified+and+viable+retinal+endothelial+cells%5BTitle%5D)+AND+%22Journal+of+Vascular+Research%22%5BJournal%5D)">Isolation of highly purified and viable retinal endothelial cells.</a> Journal of Vascular Research. 58 (1), 49-57 (2020).</li>
<li>Hulspas, R., O'Gorman, M. R. G., Wood, B. L., Gratama, J. W., Sutherland, D. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Considerations+for+the+control+of+background+fluorescence+in+clinical+flow+cytometry%5BTitle%5D)+AND+%22Cytometry+PartB%3A+Clinical+Cytometry%22%5BJournal%5D)">Considerations for the control of background fluorescence in clinical flow cytometry.</a> Cytometry PartB: Clinical Cytometry. 76 (6), 355-364 (2009).</li>
<li>Bachman, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Reverse-transcription+PCR+%28RT-PCR%29%5BTitle%5D)+AND+%22Methods+in+Enzymology%22%5BJournal%5D)">Reverse-transcription PCR (RT-PCR).</a> Methods in Enzymology. 530, 67-74 (2013).</li>
<li>Green, M. R., Sambrook, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Quantification+of+RNA+by+real-time+Reverse+Transcription-Polymerase+Chain+Reaction+%28RT-PCR%29%5BTitle%5D)+AND+%22Cold+Spring+Harbour+Protocols%22%5BJournal%5D)">Quantification of RNA by real-time Reverse Transcription-Polymerase Chain Reaction (RT-PCR).</a> Cold Spring Harbour Protocols. 2018 (10), (2018).</li>
<li>Liu, L., Shi, G. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((CD31%3A+beyond+a+marker+for+endothelial+cells%5BTitle%5D)+AND+%22Cardiovascular+Research%22%5BJournal%5D)">CD31: beyond a marker for endothelial cells.</a> Cardiovascular Research. 94 (1), 3-5 (2012).</li>
<li>Zarkada, G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Specialized+endothelial+tip+cells+guide+neuroretina+vascularization+and+blood-retina-barrier+formation%5BTitle%5D)+AND+%22Developmental+Cell%22%5BJournal%5D)">Specialized endothelial tip cells guide neuroretina vascularization and blood-retina-barrier formation.</a> Developmental Cell. 56 (15), 2237-2251 (2021).</li>
<li>Su, X., Sorenson, C. M., Sheibani, N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Isolation+and+characterization+of+murine+retinal+endothelial+cells%5BTitle%5D)+AND+%22Molecular+Vision%22%5BJournal%5D)">Isolation and characterization of murine retinal endothelial cells.</a> Molecular Vision. 9, 171-178 (2003).</li>
<li>Benedito, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((The+notch+ligands+Dll4+and+Jagged1+have+opposing+effects+on+angiogenesis%5BTitle%5D)+AND+%22Cell%22%5BJournal%5D)">The notch ligands Dll4 and Jagged1 have opposing effects on angiogenesis.</a> Cell. 137 (6), 1124-1135 (2009).</li>
<li>Daneman, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Wnt%2Fbeta-catenin+signaling+is+required+for+CNS%2C+but+not+non-CNS%2C+angiogenesis%5BTitle%5D)+AND+%22Proceedings+of+the+National+Academy+of+Sciences+of+the+United+States+of+America%22%5BJournal%5D)">Wnt/beta-catenin signaling is required for CNS, but not non-CNS, angiogenesis.</a> Proceedings of the National Academy of Sciences of the United States of America. 106 (2), 641-646 (2009).</li>
<li>Okabe, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Neurons+limit+angiogenesis+by+titrating+VEGF+in+retina%5BTitle%5D)+AND+%22Cell%22%5BJournal%5D)">Neurons limit angiogenesis by titrating VEGF in retina.</a> Cell. 159 (3), 584-596 (2014).</li>
<li>Crist, A. M., Lee, A. R., Patel, N. R., Westhoff, D. E., Meadows, S. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Vascular+deficiency+of+Smad4+causes+arteriovenous+malformations%3A+a+mouse+model+of+Hereditary+Hemorrhagic+Telangiectasia%5BTitle%5D)+AND+%22Angiogenesis%22%5BJournal%5D)">Vascular deficiency of Smad4 causes arteriovenous malformations: a mouse model of Hereditary Hemorrhagic Telangiectasia.</a> Angiogenesis. 21 (2), 363-380 (2018).</li>
<li>Kim, Y. H., Choe, S. W., Chae, M. Y., Hong, S., Oh, S. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((SMAD4+deficiency+leads+to+development+of+arteriovenous+malformations+in+neonatal+and+adult+mice%5BTitle%5D)+AND+%22Journal+of+the+American+Heart+Association%22%5BJournal%5D)">SMAD4 deficiency leads to development of arteriovenous malformations in neonatal and adult mice.</a> Journal of the American Heart Association. 7 (21), 009514(2018).</li>
<li>Ma, W., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Absence+of+TGFbeta+signaling+in+retinal+microglia+induces+retinal+degeneration+and+exacerbates+choroidal+neovascularization%5BTitle%5D)+AND+%22eLife%22%5BJournal%5D)">Absence of TGFbeta signaling in retinal microglia induces retinal degeneration and exacerbates choroidal neovascularization.</a> eLife. 8, 42049(2019).</li>
<li>Luo, W., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Arterialization+requires+the+timely+suppression+of+cell+growth%5BTitle%5D)+AND+%22Nature%22%5BJournal%5D)">Arterialization requires the timely suppression of cell growth.</a> Nature. 589 (7842), 437-441 (2021).</li>
<li>Lawson, N. D., Vogel, A. M., Weinstein, B. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((sonic+hedgehog+and+vascular+endothelial+growth+factor+act+upstream+of+the+Notch+pathway+during+arterial+endothelial+differentiation%5BTitle%5D)+AND+%22Developmental+Cell%22%5BJournal%5D)">sonic hedgehog and vascular endothelial growth factor act upstream of the Notch pathway during arterial endothelial differentiation.</a> Developmental Cell. 3 (1), 127-136 (2002).</li>
<li>Larrivee, B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((ALK1+signaling+inhibits+angiogenesis+by+cooperating+with+the+Notch+pathway%5BTitle%5D)+AND+%22Developmental+Cell%22%5BJournal%5D)">ALK1 signaling inhibits angiogenesis by cooperating with the Notch pathway.</a> Developmental Cell. 22 (3), 489-500 (2012).</li>
<li>Wythe, J. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((ETS+factors+regulate+Vegf-dependent+arterial+specification%5BTitle%5D)+AND+%22Developmental+Cell%22%5BJournal%5D)">ETS factors regulate Vegf-dependent arterial specification.</a> Developmental Cell. 26 (1), 45-58 (2013).</li>
<li>Davis, D. M., Purvis, J. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Computational+analysis+of+signaling+patterns+in+single+cells%5BTitle%5D)+AND+%22Seminars+in+Cell+and+Developmental+Biology%22%5BJournal%5D)">Computational analysis of signaling patterns in single cells.</a> Seminars in Cell and Developmental Biology. 0, 35-43 (2015).</li>
<li>Gaudet, S., Miller-Jensen, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Redefining+signaling+pathways+with+an+expanding+single-cell+toolbox%5BTitle%5D)+AND+%22Trends+in+Biotechnology%22%5BJournal%5D)">Redefining signaling pathways with an expanding single-cell toolbox.</a> Trends in Biotechnology. 34 (6), 458-469 (2016).</li>
<li>Aibar, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((SCENIC%3A+single-cell+regulatory+network+inference+and+clustering%5BTitle%5D)+AND+%22Nature+Methods%22%5BJournal%5D)">SCENIC: single-cell regulatory network inference and clustering.</a> Nature Methods. 14 (11), 1083-1086 (2017).</li>
<li>Trapnell, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((The+dynamics+and+regulators+of+cell+fate+decisions+are+revealed+by+pseudotemporal+ordering+of+single+cells%5BTitle%5D)+AND+%22Nature+Biotechnology%22%5BJournal%5D)">The dynamics and regulators of cell fate decisions are revealed by pseudotemporal ordering of single cells.</a> Nature Biotechnology. 32 (4), 381-386 (2014).</li>
</ol>

The authors have no relevant disclosures.

This protocol describes a method for the isolation of endothelial cells from postnatal murine retinal tissue that has been optimized for high cell number, purity, and viability. Cell purity is obtained by FACS isolation of endothelial cell populations from the digested single-cell suspension by CD31+/CD45- immunostaining. Quality of isolation is quantified in assays for viability by Trypan blue staining and gene expression by qPCR for CD31, CD45, and VE-Cadherin (although VE-Cadherin was not used for immunostaining). The...

The high-throughput capacity of sequencing nucleic acids via next-generation sequencing approaches has greatly advanced researchers&#39; knowledge of molecular and cellular biology. These advanced techniques include whole transcriptome RNA sequencing, DNA sequencing of targeted regions to identify Single Nucleotide Polymorphisms (SNPs), DNA sequencing of bound transcription factors in Chromatin Immunoprecipitation (ChIP) sequencing, or open chromatin regions in Assay for Transposase-Accessible Chromatin (ATAC) sequencing, and single-cell RNA sequencing1. In vascular biology, these advances have allowed researchers to elucidate complicated mechanisms of development and disease, along with distinguishing gene expression patterns along a continuum of varying phenotypes2,3. Future experiments can further define complex mechanisms by combining the next-generation sequencing with evaluated models of vascular development, but the methods for sample preparation need to be compatible with the advanced sequencing techniques.
The quality, accuracy, and reproducibility of next-generation sequencing approaches depend on the method of sample preparation. When isolating a subset of cells or generating single-cell suspensions from tissues, optimal digestion and purification methods are essential for maximizing cell number, viability, and purity of the cell population4,5. This requires a balance in the digestion method: strong digestion is necessary to release cells from the tissue and obtain enough cells for downstream approaches, but cell viability will be negatively affected if the digestion is too strong6,7. Additionally, purity of the cell population is necessary for robust results and accurate analysis of data, which can be accomplished through FACS. This highlights the importance of optimizing cell isolation methods to apply next-generation sequencing to established models of vascular development.
A well-characterized model for investigating vascular development is the murine retinal vascular development model. Murine retinal vasculature develops postnatally in a two-dimensional superficial plexus, with initial angiogenic sprouting from the optic nerve visible at postnatal day (P)3, angiogenic front with stalk- and tip-cells and initial vessel maturation visible at P6, and maturation of the vascular plexus visible after P98,9. During the remodeling of the initial vascular plexus, endothelial cells undergo specification toward arterial, capillary, and venous phenotypes in different vessels to generate a circulatory network10,11. Therefore, this method allows researchers to visualize angiogenic vascular plexus formation and endothelial arterial-venous specification and maturation at various time points during development9. Additionally, this model provides a method for investigating the effects of transgenic manipulation on angiogenesis and vascular plexus development, which has been applied for the investigation of vascular development, arterial-venous malformations, and oxygen-induced neovascularization12,13,14,15,16. In order to combine next-generation sequencing approaches with the murine retinal vascular development model, an optimized protocol for the isolation of endothelial cells from retinal tissue is necessary.
This protocol describes an optimized method for digesting retinal tissue from mice at P6 to maximize cell yield, purity, and viability. Retinal tissue is isolated from P6 mice, digested for 20 min, immunostained for CD31 and CD45, and purified through FACS to isolate a single cell suspension of endothelial cells in about 2.5 h (Figure 1A). These endothelial cells were found to maintain high viability for 60 min post-isolation17, allowing library preparations for next-generation sequencing methods. Additionally, representative results are provided for FACS gating and quality control results from two separate next-generation sequencing methods using this isolation protocol: whole transcriptome RNA sequencing and single-cell RNA sequencing. This method allows for next-generation sequencing approaches to be used in conjunction with the retinal vascularization model to elucidate novel mechanisms of vascular development.

<table><tbody><tr><td>2 mL Eppendorf&amp;nbsp;safe-lock tubes</td><td>USA Scientific</td><td>&lt;em&gt;4036-3352&lt;/em&gt;</td><td></td></tr><tr><td>5 ml Falcon Test Tubes with Cell Strainer Snap Cap</td><td>Corning</td><td>352235</td><td></td></tr><tr><td>60 mm Non TC-treated Culture Dish</td><td>Corning</td><td>430589</td><td></td></tr><tr><td>APC Rat Anti-Mouse CD31</td><td>BD Biosciences</td><td>551262</td><td></td></tr><tr><td>APC Rat IgG2a &amp;kappa; Isotype Control</td><td>BD Biosciences</td><td>&lt;em&gt;553932&lt;/em&gt;</td><td></td></tr><tr><td>BD FACSChorus Software</td><td>BD Biosciences</td><td>FACSCHORUS</td><td></td></tr><tr><td>BD FACSMelody Cell Sorter</td><td>BD Biosciences</td><td>FACSMELODY</td><td></td></tr><tr><td>Collagenase Type II</td><td>Sigma-Aldrich</td><td>234115</td><td></td></tr><tr><td>Costar 48-well Clear TC-treated Multiple Well Plates, Individually Wrapped, Sterile</td><td>Corning</td><td>3548</td><td></td></tr><tr><td>D-Glucose</td><td>Gibco</td><td>A2494001</td><td></td></tr><tr><td>Disposable Graduated Transfer Pipettes</td><td>Fisher Scientific</td><td>12-711-9AM</td><td></td></tr><tr><td>Dissecting Pan Wax</td><td>Carolina</td><td>629100</td><td></td></tr><tr><td>Dissection scissors</td><td>Fine Science Tools</td><td>14085-08</td><td></td></tr><tr><td>Dissection Stereo Microscope M165 FC</td><td>Leica</td><td>M165FC</td><td></td></tr><tr><td>Dulbecco&#039;s Modified Eagle Medium (DMEM)</td><td>Gibco</td><td>11965-052</td><td></td></tr><tr><td>Dulbecco&amp;rsquo;s Phosphate Buffered Saline (PBS)</td><td>Gibco</td><td>14190144</td><td></td></tr><tr><td>Eppendorf&amp;nbsp;Flex-Tubes Microcentrifuge Tubes 1.5 mL</td><td>Sigma-Aldrich</td><td>22364120</td><td></td></tr><tr><td>Fetal Bovine Serum (FBS)</td><td>Gemini Bio</td><td>100-106</td><td></td></tr><tr><td>Fine dissection forceps</td><td>Fine Science Tools</td><td>11250-00</td><td></td></tr><tr><td>Hank&#039;s Buffered Salt Solution (HBSS)</td><td>Gibco</td><td>14175095</td><td></td></tr><tr><td>HEPES (1M)</td><td>Gibco</td><td>15630130</td><td></td></tr><tr><td>iScript cDNA Synthesis Kit</td><td>Bio-Rad</td><td>1708890</td><td></td></tr><tr><td>Isoflurane, USP</td><td>Covetrus</td><td>11695067772</td><td></td></tr><tr><td>Isotemp General Purpose Deluxe Water Bath</td><td>Fisher Scientific</td><td>FSGPD20</td><td></td></tr><tr><td>Primer: ActB_Forward: 5&amp;rsquo;- agagggaaatcgtgcgtgac -3&amp;rsquo;</td><td>Integrated DNA Technologies</td><td>N/A</td><td></td></tr><tr><td>Primer: ActB_Reverse: 5&amp;rsquo;- caatagtgatgacctggccgt -3&amp;rsquo;</td><td>Integrated DNA Technologies</td><td>N/A</td><td></td></tr><tr><td>Primer: CD31_Forward: 5&amp;rsquo;- gagcccaatcacgtttcagttt -3&amp;rsquo;</td><td>Integrated DNA Technologies</td><td>N/A</td><td></td></tr><tr><td>Primer: CD31_Reverse: 5&amp;rsquo;- tccttcctgcttcttgctagct -3&amp;rsquo;</td><td>Integrated DNA Technologies</td><td>N/A</td><td></td></tr><tr><td>Primer: CD45_Forward: 5&amp;rsquo;- gggttgttctgtgccttgtt -3&amp;rsquo;</td><td>Integrated DNA Technologies</td><td>N/A</td><td></td></tr><tr><td>Primer: CD45_Reverse: 5&amp;rsquo;- ctggacggacacagttagca -3&amp;rsquo;</td><td>Integrated DNA Technologies</td><td>N/A</td><td></td></tr><tr><td>Primer: VE-Cadherin_Forward: 5&amp;rsquo;- tcctctgcatcctcactatcaca -3&amp;rsquo;</td><td>Integrated DNA Technologies</td><td>N/A</td><td></td></tr><tr><td>Primer: VE-Cadherin_Reverse: 5&amp;rsquo;- gtaagtgaccaactgctcgtgaat -3&amp;rsquo;</td><td>Integrated DNA Technologies</td><td>N/A</td><td></td></tr><tr><td>Propidium iodide</td><td>Sigma-Aldrich</td><td>P4864</td><td></td></tr><tr><td>RNeasy Plus Mini Kit</td><td>Qiagen</td><td>74134</td><td></td></tr><tr><td>Sorvall Legend Micro 21R Centrifuge, Refrigerated</td><td>ThermoFisher</td><td>75002477</td><td></td></tr><tr><td>SYBR-Green iTaq Universal SYBR Green Supermix</td><td>Bio-Rad</td><td>172-5120</td><td></td></tr><tr><td>Trypan Blue Solution</td><td>ThermoFisher</td><td>15250061</td><td></td></tr><tr><td>V450 Rat Anti-Mouse CD45</td><td>BD Biosciences</td><td>560501</td><td></td></tr><tr><td>V450 Rat IgG2b, &amp;kappa; Isotype Control</td><td>BD Biosciences</td><td>560457</td><td></td></tr></tbody></table>

isolation of murine retinal endothelial cells for next-generation sequencing

Recent improvements in next-generation sequencing have advanced researchers&#39; knowledge of molecular and cellular biology, with several studies revealing novel paradigms in vascular biology. Applying these methods to models of vascular development requires the optimization of cell isolation techniques from embryonic and postnatal tissues. Cell yield, viability, and purity all need to be maximal to obtain accurate and reproducible results from next-generation sequencing approaches. The neonatal mouse retinal vascularization model is used by researchers to study mechanisms of vascular development. Researchers have used this model to investigate mechanisms of angiogenesis and arterial-venous fate specification during blood vessel formation and maturation. Applying next-generation sequencing techniques to study the retinal vascular development model requires optimization of a method for the isolation of retinal endothelial cells that maximizes cell yield, viability, and purity. This protocol describes a method for murine retinal tissue isolation, digestion, and purification using fluorescence-activated cell sorting (FACS). The results indicate that the FACS-purified CD31+/CD45- endothelial cell population is highly enriched for endothelial cell gene expression and exhibits no change in viability for 60 min post-FACS. Included are representative results of next-generation sequencing approaches on endothelial cells isolated using this method, including bulk RNA sequencing and single-cell RNA sequencing, demonstrating that this method for retinal endothelial cell isolation is compatible with next-generation sequencing applications. This method of retinal endothelial cell isolation will allow for advanced sequencing techniques to reveal novel mechanisms of vascular development.

Digestion of retinal tissue and immunostaining for CD31 and CD45 results in an identifiable population of CD31+/CD45- endothelial cells after gating for cells, single cells, and viability (Figure 2A). CD45 immunostaining is required to eliminate CD31+/CD45+ cells, which include platelets and some leukocytes21. Controls should be performed for each experiment to show antibody specificity and guide gating strategy (Figure 2B). This percenta...

Watch this Scientific Journal Video about Isolation of Murine Retinal Endothelial Cells for Next-Generation Sequencing at JoVE.com

Isolation of Murine Retinal Endothelial Cells for Next-Generation Sequencing

This protocol describes a method for the isolation of murine postnatal retinal endothelial cells optimized for cell yield, purity, and viability. These cells are suitable for next-generation sequencing approaches.

Recent improvements in next-generation sequencing have advanced researchers&#39; knowledge of molecular and cellular biology, with several studies ...

isolation-murine-retinal-endothelial-cells-for-next-generation

Research

JoVE Journal

Developmental Biology

3.0K Views.  University of Virginia School of Medicine. Deze methode van retinale endotheelcelisolatie zal geavanceerde sequencingtechnieken mogelijk maken om nieuwe mechanismen van vasculaire ontwikkeling te onthullen. Het beschreven protocol is geoptimaliseerd voor hoge mate van levensvatbaarheid en zuiverheid, die essentieel zijn voor sequencingtoepassingen van de volgende generatie. De procedure wordt gedemonstreerd door Shelby Cain, een afgestudeerde student van het Hershey Laboratory.Begin met het verwijderen van ogen van de geëuthan...

Video: Isolation of Murine Retinal Endothelial Cells for Next-Generation Sequencing

Isolation of Murine Embryonic Hemogenic Endothelial Cells

The specification of hemogenic endothelial cells from embryonic vascular endothelium occurs during brief developmental periods within distinct tissues, and is necessary for the emergence of definitive HSPC from the murine extra embryonic yolk sac, placenta, umbilical vessels, and the embryonic aorta-gonad-mesonephros (AGM) region. The transient nature and small size of this cell population renders its reproducible isolation for careful quantification and experimental applications technically difficult. We have established a fluorescence-activated cell sorting (FACS)-based protocol for simultaneous isolation of hemogenic endothelial cells and HSPC during their peak generation times in the yolk sac and AGM. We demonstrate methods for dissection of yolk sac and AGM tissues from mouse embryos, and we present optimized tissue digestion and antibody conjugation conditions for maximal cell survival prior to identification and retrieval via FACS. Representative FACS analysis plots are shown that identify the hemogenic endothelial cell and HSPC phenotypes, and describe a methylcellulose-based assay for evaluating their blood forming potential on a clonal level.

Hematopoietic stem and progenitor cells (HSPC) derive from specialized (hemogenic) endothelial cells during development, yet little is known about the process by which some endothelial cells specify to become blood forming. We demonstrate a flow-cytometry based method allowing simultaneous isolation of hemogenic endothelial cells and HSPC from murine embryonic tissues.

The specification of hemogenic endothelial cells from embryonic vascular endothelium occurs during brief developmental periods within distinct tissues, ...

Isolation of Primary Murine Retinal Ganglion Cells (RGCs) by Flow Cytometry

Neurodegenerative diseases often have a devastating impact on those affected. Retinal ganglion cell (RGC) loss is implicated in an array of diseases, including diabetic retinopathy and glaucoma, in addition to normal aging. Despite their importance, RGCs have been extremely difficult to study until now due in part to the fact that they comprise only a small percentage of the wide variety of cells in the retina. In addition, current isolation methods use intracellular markers to identify RGCs, which produce non-viable cells. These techniques also involve lengthy isolation protocols, so there is a lack of practical, standardized, and dependable methods to obtain and isolate RGCs. This work describes an efficient, comprehensive, and reliable method to isolate primary RGCs from mice retinae using a protocol based on both positive and negative selection criteria. The presented methods allow for the future study of RGCs, with the goal of better understanding the major decline in visual acuity that results from the loss of functional RGCs in neurodegenerative diseases.

Isolation of Primary Murine Retinal Ganglion Cells RGCs by Flow Cytometry

Millions of people suffer from retinal degenerative diseases that result in irreversible blindness. A common element of many of these diseases is the loss of retinal ganglion cells (RGCs). This detailed protocol describes the isolation of primary murine RGCs by positive and negative selection with flow cytometry.

Neurodegenerative diseases often have a devastating impact on those affected. Retinal ganglion cell (RGC) loss is implicated in an array of diseases, ...

Bioengineering

Isolation of Retinal Stem Cells from the Mouse Eye

The adult mouse retinal stem cell (RSC) is a rare quiescent cell found within the ciliary epithelium (CE) of the mammalian eye1,2,3. The CE is made up of non-pigmented inner and pigmented outer cell layers, and the clonal RSC colonies that arise from a single pigmented cell from the CE are made up of both pigmented and non-pigmented cells which can be differentiated to form all the cell types of the neural retina and the RPE. There is some controversy about whether all the cells within the spheres all contain at least some pigment4; however the cells are still capable of forming the different cell types found within the neural retina1-3. In some species, such as amphibians and fish, their eyes are capable of regeneration after injury5, however; the mammalian eye shows no such regenerative properties. We seek to identify the stem cell in vivo and to understand the mechanisms that keep the mammalian retinal stem cells quiescent6-8, even after injury as well as using them as a potential source of cells to help repair physical or genetic models of eye injury through transplantation9-12. Here we describe how to isolate the ciliary epithelial cells from the mouse eye and grow them in culture in order to form the clonal retinal stem cell spheres. Since there are no known markers of the stem cell in vivo, these spheres are the only known way to prospectively identify the stem cell population within the ciliary epithelium of the eye.

In this video, we will demonstrate how to isolate retinal stem cells from the ciliary epithelium of the mouse eye and grow them in culture to form clonal retinal spheres. The spheres that are isolated possess the cardinal properties of stem cells: self-renewal and multipotentiality.

The adult mouse retinal stem cell (RSC) is a rare quiescent cell found within the ciliary epithelium (CE) of the mammalian eye1,2,3. The CE is made up of ...

Biology

Single-cell RNA-Seq of Defined Subsets of Retinal Ganglion Cells

The discovery of cell type-specific markers can provide insight into cellular function and the origins of cellular heterogeneity. With a recent push for the improved understanding of neuronal diversity, it is important to identify genes whose expression defines various subpopulations of cells. The retina serves as an excellent model for the study of central nervous system diversity, as it is composed of multiple major cell types. The study of each major class of cells has yielded genetic markers that facilitate the identification of these populations. However, multiple subtypes of cells exist within each of these major retinal cell classes, and few of these subtypes have known genetic markers, although many have been characterized by morphology or function. A knowledge of genetic markers for individual retinal subtypes would allow for the study and mapping of brain targets related to specific visual functions and may also lend insight into the gene networks that maintain cellular diversity. Current avenues used to identify the genetic markers of subtypes possess drawbacks, such as the classification of cell types following sequencing. This presents a challenge for data analysis and requires rigorous validation methods to ensure that clusters contain cells of the same function. We propose a technique for identifying the morphology and functionality of a cell prior to isolation and sequencing, which will allow for the easier identification of subtype-specific markers. This technique may be extended to non-neuronal cell types, as well as to rare populations of cells with minor variations. This protocol yields excellent-quality data, as many of the libraries have provided read depths greater than 20 million reads for single cells. This methodology overcomes many of the hurdles presented by Single-cell RNA-Seq and may be suitable for researchers aiming to profile cell types in a straightforward and highly efficient manner.

Here, we present a combinatorial approach for classifying neuronal cell types prior to isolation and for the subsequent characterization of single-cell transcriptomes. This protocol optimizes the preparation of samples for successful RNA Sequencing (RNA-Seq) and describes a methodology designed specifically for the enhanced understanding of cellular diversity.

The discovery of cell type-specific markers can provide insight into cellular function and the origins of cellular heterogeneity. With a recent push for ...

Neuroscience

Isolation of Murine Valve Endothelial Cells

Normal valve structures consist of stratified layers of specialized extracellular matrix (ECM) interspersed with valve interstitial cells (VICs) and surrounded by a monolayer of valve endothelial cells (VECs). VECs play essential roles in establishing the valve structures during embryonic development, and are important for maintaining life-long valve integrity and function. In contrast to a continuous endothelium over the surface of healthy valve leaflets, VEC disruption is commonly observed in malfunctioning valves and is associated with pathological processes that promote valve disease and dysfunction. Despite the clinical relevance, focused studies determining the contribution of VECs to development and disease processes are limited. The isolation of VECs from animal models would allow for cell-specific experimentation. VECs have been isolated from large animal adult models but due to their small population size, fragileness, and lack of specific markers, no reports of VEC isolations in embryos or adult small animal models have been reported. Here we describe a novel method that allows for the direct isolation of VECs from mice at embryonic and adult stages. Utilizing the Tie2-GFP reporter model that labels all endothelial cells with Green Fluorescent Protein (GFP), we have been successful in isolating GFP-positive (and negative) cells from the semilunar and atrioventricular valve regions using fluorescence activated cell sorting (FACS). Isolated GFP-positive VECs are enriched for endothelial markers, including CD31 and von Willebrand Factor (vWF), and retain endothelial cell expression when cultured; while, GFP-negative cells exhibit molecular profiles and cell shapes consistent with VIC phenotypes. The ability to isolate embryonic and adult murine VECs allows for previously unattainable molecular and functional studies to be carried out on a specific valve cell population, which will greatly improve our understanding of valve development and disease mechanisms.

The ability to isolate heart valve endothelial cells (VECs) is critical for understanding mechanisms of valve development, maintenance, and disease. Here we describe the isolation of VECs from embryonic and adult Tie2-GFP mice using FACS that will allow for studies determining the contribution of VECs in developmental and disease processes.

Normal valve structures consist of stratified layers of specialized extracellular matrix (ECM) interspersed with valve interstitial cells (VICs) and ...

Two Peeling Methods for the Isolation of Photoreceptor Cell Compartments in the Mouse Retina for Protein Analysis

Rod photoreceptors are highly polarized sensory neurons with distinct compartments. Mouse rods are long (~80 &#181;m) and thin (~2 &#181;m) and are laterally packed in the outermost layer of the retina, the photoreceptor layer, resulting in alignment of analogous subcellular compartments. Traditionally, tangential sectioning of the frozen flat-mounted retina has been used to study the movement and localization of proteins within different rod compartments. However, the high curvature of the rod-dominant mouse retina makes tangential sectioning challenging. Motivated by the study of protein transport between compartments, we developed two peeling methods that reliably isolate the rod outer segment (ROS) and other subcellular compartments for western blots. Our relatively quick and simple techniques deliver enriched and subcellular-specific fractions to quantitatively measure the distribution and redistribution of important photoreceptor proteins in normal rods. Moreover, these isolation techniques can also be easily adapted to isolate and quantitatively investigate the protein composition of other cellular layers within both healthy and degenerating retinae.

This protocol presents two techniques to isolate the subcellular compartments of murine rod photoreceptors for protein analysis. The first method utilizes live retinae and cellulose filter paper to separate rod outer segments, while the second employs lyophilized retinae and adhesive tape to peel away rod inner and outer segment layers.

Rod photoreceptors are highly polarized sensory neurons with distinct compartments. Mouse rods are long (~80 &#181;m) and thin (~2 &#181;m) and are ...

Characterization and Morphological Dynamics of Cultured Primary Murine RPE

A Simplified Method for Isolation and Culture of Retinal Pigment Epithelial Cells from Adult Mice

Retinal pigment epithelial cells (RPE) are critical for the proper function of the retina. RPE dysfunction is involved in the pathogenesis of important retinal diseases, such as age-related macular degeneration, retinitis pigmentosa, and diabetic retinopathy. We present a streamlined approach for the isolation of RPE from murine adult eyes. In contrast to previously reported methods, this approach enables the isolation and culture of highly pure RPE from adult mice. This simple and fast method does not require extensive technical skill and is achievable with basic scientific tools and reagents. Primary RPE are isolated from C57BL/6 background mice aged 3- to 14-weeks by enucleation of the eye followed by the removal of the anterior segment. Enzymatic trypsinization and centrifugation are used to dissociate and isolate the RPE from the eyecup. In conclusion, this approach offers a quick and effective protocol for the utilization of RPE in the study of retinal function and disease.

Author Spotlight: Efficient Isolation of Primary Retinal Pigment Epithelial Cells from Adult Mice for Retinopathy Research

Retinal pigment epithelium (RPE) acts as a crucial barrier between the choroid and retina, promoting the health and function of retinal cell types, such as photoreceptors. Herein, we describe a simple and effective protocol for isolating and culturing adult murine RPE.

Retinal pigment epithelial cells (RPE) are critical for the proper function of the retina. RPE dysfunction is involved in the pathogenesis of important ...

Isolation of Endothelial Cells from the Lumen of Mouse Carotid Arteries for Single-Cell Multi-Omics Experiments

Atherosclerosis is an inflammatory disease of the arterial regions exposed to disturbed blood flow (d-flow). D-flow regulates the expression of genes in the endothelium at the transcriptomic and epigenomic levels, resulting in proatherogenic responses. Recently, single-cell RNA sequencing (scRNAseq) and single-cell Assay for Transposase Accessible Chromatin sequencing (scATACseq) studies were performed to determine the transcriptomic and chromatin accessibility changes at a single-cell resolution using the mouse partial carotid ligation (PCL) model. As endothelial cells (ECs) represent a minor fraction of the total cell populations in the artery wall, a luminal digestion method was used to obtain EC-enriched single-cell preparations. For this study, mice were subjected to PCL surgery to induce d-flow in the left carotid artery (LCA) while using the right carotid artery (RCA) as a control. The carotid arteries were dissected out two days or two weeks post PCL surgery. The lumen of each carotid was subjected to collagenase digestion, and endothelial-enriched single cells or single nuclei were obtained. These single-cell and single-nuclei preparations were subsequently barcoded using a 10x Genomics microfluidic setup. The barcoded single-cells and single-nuclei were then utilized for RNA preparation, library generation, and sequencing on a high-throughput DNA sequencer. Post bioinformatics processing, the scRNAseq and scATACseq datasets identified various cell types from the luminal digestion, primarily consisting of ECs. Smooth muscle cells, fibroblasts, and immune cells were also present. This EC-enrichment method aided in understanding the effect of blood flow on the endothelium, which could have been difficult with the total artery digestion method. The EC-enriched single-cell preparation method can be used to perform single-cell omics studies in EC-knockouts and transgenic mice where the effect of blood flow on these genes has not been studied. Importantly, this technique can be adapted to isolate EC-enriched single cells from human artery explants to perform similar mechanistic studies.

We present a method for isolating endothelial cells and nuclei from the lumen of mouse carotid arteries exposed to stable or disturbed flow conditions to perform single-cell omics experiments.

Atherosclerosis is an inflammatory disease of the arterial regions exposed to disturbed blood flow (d-flow). D-flow regulates the expression of genes in ...

Isolation of Primary Mouse Retinal Pigmented Epithelium Cells

The retinal pigmented epithelium (RPE) layer lies immediately behind the photoreceptors and harbors a complex metabolic system that plays several critical roles in maintaining the photoreceptors' function. Thus, the RPE structure and function are essential to sustain normal vision. This manuscript presents an established protocol for primary mouse RPE cell isolation. RPE isolation is a great tool to investigate the molecular mechanisms underlying RPE pathology in the different mouse models of ocular disorders. Furthermore, RPE isolation can help in comparing primary mouse RPE cells isolated from wild-type and genetically modified mice, as well as testing drugs that can accelerate the development of therapy for visual disorders. The manuscript presents a step-by-step RPE isolation protocol; the entire procedure, from enucleation to seeding, takes approximately 4 hours. The media shouldn't be changed for 5-7 days after seeding, to allow the growth of the isolated cells without disturbance. This process is followed by the characterization of morphology, pigmentation, and specific markers in the cells via immunofluorescence. Cells can be passaged a maximum of three or four times.

This manuscript describes a simplified protocol for the isolation of retinal pigmented epithelium (RPE) cells from mouse eyes in a stepwise manner. The protocol includes the enucleation and dissection of mouse eyes, followed by the isolation, seeding, and culturing of RPE cells.

The retinal pigmented epithelium (RPE) layer lies immediately behind the photoreceptors and harbors a complex metabolic system that plays several critical ...

Isolating Endothelial Cells from Murine Dermal Lymphatic Capillaries

Murine Dermal Lymphatic Endothelial Cell Isolation

The lymphatic system participates in the regulation of immune surveillance, lipid absorption, and tissue fluid balance. The isolation of murine lymphatic endothelial cells is an important process for lymphatic research, as it allows the performance of in vitro and biochemical experiments on the isolated cells. Moreover, the development of Cre-lox technology has enabled the tissue-specific deficiency of genes that cannot be globally targeted, leading to the precise determination of their role in the studied tissues. The dissection of the role of certain genes in lymphatic physiology and pathophysiology requires the use of lymphatic-specific promoters, and thus, the experimental verification of the expression levels of the targeted genes.
Methods for efficient isolation of lymphatic endothelial cells from wild-type or transgenic mice enable the use of ex vivo and in vitro assays to study the mechanisms regulating the lymphatic functions and the identification of the expression levels of the studied proteins. We have developed, standardized and present a protocol for the efficient isolation of murine dermal lymphatic endothelial cells (DLECs) via magnetic bead purification based on LYVE-1 expression. The protocol outlined aims to equip researchers with a tool to further understand and elucidate important players of lymphatic endothelial cell functions, especially in facilities where fluorescence-activated cell sorting equipment is not available.

Author Spotlight: Magnetic Bead-Based Isolation of Murine Dermal Lymphatic Endothelial Cells

This paper describes a method for magnetic bead-based isolation of murine endothelial cells from dermal lymphatic capillaries. The isolated lymphatic endothelial cells can be used for downstream in vitro experiments and protein expression analysis.

The lymphatic system participates in the regulation of immune surveillance, lipid absorption, and tissue fluid balance. The isolation of murine lymphatic ...

Isolation of Murine Retinal Endothelial Cells for Next-Generation Sequencing

Samenvatting

Meer video's verkennen