This work was supported by AMED under Grant Number JP22gm6110025 (to Y.N.) and by the JSPS KAKENHI Grant Number 22H02762 (to Y.N.).

NOTE: See the Table of Materials for details related to all materials, reagents, and equipment used in this protocol.
1. Probe synthesis
<ol>
	<li>RNA extraction
	<ol>
		<li>Place three live Cladonema medusae that are cultured in artificial seawater (ASW) in a 1.5 mL tube using a 3.1 mL transfer pipette with the tip cut off, and remove as much ASW as possible. 
		NOTE: ASW is prepared by dissolving a mixture of mineral salts in tap water with chlorine neutralizer; the final specific gravity (S.G.) is 1.018 or the parts per thousand (ppt) is ~27.</li>
		<li>Freeze the 1.5 mL tubes in liquid nitrogen to inhibit RNase activity. Add 30 &#181;L of lysis buffer from the total RNA isolation kit in which 2-mercaptoethanol (1 &#181;L/100 &#181;L of lysis buffer) has been added and homogenize the samples in the lysis buffer using a homogenizer. 
		NOTE: To avoid overflow of the buffer and sample from the tubes, homogenization with a small amount of lysis buffer is recommended.</li>
		<li>Add 570 &#181;L of lysis buffer and extract the total RNA following the protocol of the total RNA isolation kit (Figure 1).</li>
		<li>Measure the concentration of the extracted RNA using a spectrophotometer and store at &#8722;80 &#176;C until use.</li>
	</ol>
	</li>
	<li>cDNA synthesis
	<ol>
		<li>Using a kit, synthesize cDNA using the total RNA extracted from the medusae as a template (Figure 1 and Table 1).</li>
		<li>Incubate at 65 &#176;C for 5 min.</li>
		<li>Cool rapidly on ice.</li>
		<li>Perform cDNA synthesis with the mixture from step 1.2.1 (Table 1). Mix thoroughly by pipetting and incubate at 42 &#176;C for 60 min.</li>
		<li>Incubate at 95 &#176;C for 5 min.</li>
		<li>Cool rapidly on ice.</li>
		<li>Measure the concentration of the synthesized cDNA using a spectrophotometer and store at or below &#8722;20 &#176;C until use.</li>
	</ol>
	</li>
	<li>PCR product synthesis
	<ol>
		<li>To create a PCR template, design the specific primer using Primer-BLAST. Source the reference sequence from NCBI data or RNA-seq data. 
		NOTE: See the Table of Materials for the primers used in this protocol.</li>
		<li>To amplify the target sequence, perform TA cloning, which does not require the use of restriction enzymes. To obtain a PCR product in which an adenine is added at the 3&#39; end, use the following settings: 98 &#176;C for 2 min; 35 cycles of 98 &#176;C for 10 s, 55-60 &#176;C for 30 s, 72 &#176;C for 1 min. Use Taq DNA polymerase for the reactions (Table 1). 
		NOTE: To determine the PCR conditions, follow the protocol that accompanies the DNA polymerase to be used, which generally provides a recommended annealing temperature and extension time.</li>
		<li>Run the PCR product through a 1% agarose gel and cut out the band of interest. Extract the PCR products from the cut gels using a gel extraction kit.</li>
	</ol>
	</li>
	<li>Ligation
	<ol>
		<li>Ligate the PCR product to the vector with 3&#39; thymine overhangs by mixing the reagents (Table 1) and incubating at 37 &#176;C for 30 min (Figure 1). 
		NOTE: The molecular ratio of vector:PCR should be 1:&#62;3. The pTA2 vector size is approximately 3 kb. If the PCR product (insert) is A (kb) and B (ng/&#181;L), the volume of the insert (X in Table 1) to be taken can be calculated by ([50 ng of vector &#215; A kb of insert])/(3 kb vector &#215; [1/3]) = 50&#183;A ng of insert. If the concentration of insert is B ng/&#181;L, then volume taken is 50&#183;A/B &#181;L of insert.</li>
	</ol>
	</li>
	<li>Transformation and plating
	<ol>
		<li>For transformation, thaw the competent cells on ice and dispense them into 20 &#181;L aliquots each. Add 1 &#181;L of the plasmids containing the PCR product (less than 5% of competent cell volume) and vortex for 1 s. Incubate on ice for 5 min, and then incubate at 42 &#176;C for 45 s, and vortex for 1 s.</li>
		<li>Add 180 &#181;L of Super Optimal broth with Catabolite repression (SOC) medium (a nutritionally rich bacterial culture medium) to the competent cells and incubate at 37 &#176;C for 30 min. After 30 min, spread the competent cells onto an agar plate containing ampicillin, 5-bromo-4-chloro-3-indolyl-beta-D-galacto-pyranoside (X-gal), and isopropyl-&#946;-d-1-thiogalactopyranoside (IPTG), and incubate at 37 &#176;C for 12-16 h (Figure 1). 
		NOTE: X-gal and IPTG are used for selecting blue and white colonies.</li>
	</ol>
	</li>
	<li>Liquid culture
	<ol>
		<li>Pick a white colony out of the white and blue colonies on the plate. Add it to 3-5 mL of LB medium with ampicillin and incubate on a shaker for 12-16 h at 37 &#176;C (Figure 1).</li>
	</ol>
	</li>
	<li>Miniprep
	<ol>
		<li>Extract the plasmid from the LB medium using a plasmid miniprep (Figure 1).</li>
		<li>Quantify the plasmid concentration using a spectrophotometer.</li>
	</ol>
	</li>
	<li>Read the sequence.
	<ol>
		<li>To read the DNA sequence of the plasmid, send the plasmid for Sanger sequencing and then use software to align it with the genome/transcriptome sequence to confirm whether the target sequence is properly synthesized and assess in which direction the target sequence is inserted into the plasmid (5&#39; to 3&#39; or 3&#39; to 5&#39;). 
		NOTE: If the target sequence is inserted into the plasmid in the 5&#39; to 3&#39; direction from the RNA polymerase binding site near the 3&#39; end, an antisense probe can be generated by in vitro transcription. If the target sequence is inserted in the reverse 3&#39; to 5&#39; direction, a sense probe (negative control) can be generated. If using vectors such as pTA2, two transcription binding sites can be used depending on the purpose.</li>
	</ol>
	</li>
	<li>In vitro transcription
	<ol>
		<li>Prepare the DNA template from the created plasmid by performing PCR using primers outside the RNA polymerase binding site (e.g., T7/T3 binding sites) in the plasmid (Figure 1). 
		NOTE: Universal primers such as the M13-20 forward primer and the M13 reverse primer can be used to prepare a DNA template that includes RNA polymerase binding sites.</li>
		<li>Purify the template after PCR amplification using a gel/PCR extraction kit.</li>
		<li>Mix the reagents shown below, and perform the transcription reaction at 37 &#176;C for 3 h (Figure 1 and Table 1).</li>
		<li>Add 1.5 &#181;L of DNase and incubate at 37 &#176;C for 30 min.</li>
		<li>Add 10 &#181;L of RNase-free water and purify the probe from the transcription reaction solution using a clean-up column.</li>
		<li>Check the size of the synthesized RNA by loading 1 &#181;L onto a 1% agarose gel and determine the concentration using a spectrophotometer. 
		NOTE: Synthesized RNA probes should have a concentration of at least 100 ng/&#181;L.</li>
		<li>Add 30 &#181;L of formamide for storage at or below &#8722;20 &#176;C.</li>
	</ol>
	</li>
</ol>
2. EdU incorporation and fixation
<ol>
	<li>Place Cladonema medusae (5-10 animals per tube) into 1.5 mL tubes using a 3.5 mL transfer pipette and add ASW up to a total volume of 500 &#181;L. Add 7.5 &#181;L of 10 mM EdU stock solution and incubate the samples for 1 h at 22 &#176;C (Figure 2). The EdU final concentration is 150 &#181;M. 
	NOTE: Use 5-7-day-old medusae to monitor third branch formation (Figure 3A). The day that the medusae detach from the polyp is counted as day 1, and on day 5, medusae typically start to exhibit a third branch on their main tentacles.</li>
	<li>After 1 h, remove as much ASW containing EdU as possible.</li>
	<li>To anesthetize the medusae, add 7% MgCl2 in H2O and incubate for 5 min.</li>
	<li>Remove the 7% MgCl2 in H2O and fix the medusae overnight (O.N.) at 4 &#176;C with 4% paraformaldehyde (PFA) in ASW (Figure 2). 
	NOTE: When performing FISH without EdU incorporation, samples can be fixed similarly to those treated with EdU following anesthetization (steps 2.3-2.4).</li>
</ol>
3. Fluorescent&#160;&#160;in situ hybridization
<ol>
	<li>Proteinase treatment and post fixation
	<ol>
		<li>Remove the PFA and wash the samples with PBS containing 0.1% Tween-20 (PBST) for 3 x 10 min. Use 300-500 &#181;L of PBST per wash. 
		NOTE: From this step to the end of hybridization, the experiment should be performed in an RNase-free environment, wearing gloves and a mask. The 1x PBS in this step must be made with DEPC-treated water. After hybridization, 1x PBS made with water without DEPC treatment can be used. Some ISH and FISH protocols dehydrate samples using methanol steps, which makes it possible to save the fixed samples at &#8722;20 &#176;C until use. To avoid superfluous work, the dehydration process is omitted from this protocol, particularly since the samples can be kept in PBST for up to a few days.</li>
		<li>After fixation, place the sample in 1.5 mL tubes on a shaker, except for the anti-DIG-POD antibody O.N. incubation step (step 3.4.2). After washing, add 10 mg/mL Proteinase K stock solution in PBST and incubate the medusae with Proteinase K (final concentration: 10 &#181;g/mL) at 37 &#176;C for 10 min.</li>
		<li>Remove the Proteinase K solution and wash the samples for 2 x 1 min with PBST.</li>
		<li>To postfix the medusae, add 4% PFA in 1x PBS and incubate at 37 &#176;C for 15 min.</li>
		<li>Remove the PFA solution and wash the samples for 2 x 10 min with PBST. 
		NOTE: If the target gene is highly expressed with low background signal, steps 3.1.2-3.1.5 can be skipped.</li>
	</ol>
	</li>
	<li>Hybridization
	<ol>
		<li>Remove the PBST and add Hybridization Buffer (HB Buffer, Table 1). Incubate the samples in HB Buffer for 15 min at room temperature (RT). Use 300-400 &#181;L of HB Buffer, which provides enough volume for successful hybridization. 
		NOTE: HB Buffer, Wash Buffer 1, and Wash Buffer 2 are prepared with 20x SSC stock. HB Buffer is stored at or below &#8722;20 &#176;C and must be brought to RT before use.</li>
		<li>Remove the HB Buffer and add new HB Buffer. Prehybridize at 55 &#176;C for at least 2 h in a hybridization incubator.</li>
		<li>Remove the HB Buffer and incubate with HB Buffer containing the probes that were stored in step 1.9.7 (final probe concentration: 0.5-1 ng/&#181;L in HB Buffer). Hybridize at 55 &#176;C for 18-24 h (Figure 2) in a hybridization incubator. 
		NOTE: FISH signal intensity and specificity can vary due to target gene expression, as well as probe length and specificity. To increase the intensity, parameters such as hybridization duration (18-72 h) and temperature (50-65 &#176;C) can be adjusted, and different probes can be tested. To avoid non-specific signals, Proteinase K treatment (concentration and duration) can be modified19.</li>
	</ol>
	</li>
	<li>Probe removal
	<ol>
		<li>Remove the HB Buffer containing probes, and then add Wash Buffer 1 (Table 1). Wash the samples with Wash Buffer 1 for 2 x 15 min at 55 &#176;C. Use 300-400 &#181;L of wash buffer. 
		&#8203;NOTE: HB Buffer containing probes can be used repeatedly, up to about ten times. Instead of discarding, store the used HB Buffer containing probes at or below &#8722;20 &#176;C. Preheat Wash Buffer 1, Wash Buffer 2, 2x SSC, and PBST at 55 &#176;C before use.</li>
		<li>Remove Wash Buffer 1, and then add Wash Buffer 2 (Table 1). Wash the samples with Wash Buffer 2 for 2 x 15 min at 55 &#176;C.</li>
		<li>Remove Wash Buffer 2, and then add 2x SSC. Wash the samples with 2x SSC for 2 x 15 min at 55 &#176;C.</li>
		<li>Remove 2x SSC, and then add preheated PBST. Wash the samples for 1 x 15 min with PBST at RT.</li>
	</ol>
	</li>
	<li>Anti-DIG antibody incubation
	<ol>
		<li>Remove PBST, and then add 1% blocking buffer. Incubate the samples for at least 1 h at RT while shaking slowly on a rocker. 
		NOTE: Prepare 1% blocking buffer freshly by diluting 5% blocking buffer stock (Table 1). Check the samples before the next antibody reaction because the sample tends to stick to the back of the lid or the wall as a result of shaking.</li>
		<li>After blocking, remove the 1% blocking buffer, add anti-DIG-POD solution (1:500, in 1% blocking buffer), and incubate the samples O.N. at 4 &#176;C (Figure 2). 
		NOTE: Be careful to keep the incubation time within 12-16 h to prevent the detection of non-specific signals.</li>
	</ol>
	</li>
	<li>Detection of DIG-labeled probe
	<ol>
		<li>Remove the anti-DIG-POD solution, and then add Tris-NaCl-Tween Buffer (TNT, Table 1). Wash the samples with TNT for 3 x 10 min at RT. 
		NOTE: The use of the tyramide signal amplification (TSA) technique provides a better resolution image against horseradish peroxidase-labeled reagents (e.g., anti-DIG-POD).</li>
		<li>Dilute fluorescent dye-conjugated tyramide (Cy5-tyramide) stock solution (1:50) in the amplification diluent buffer to make the active Cy5-tyramide solution (Figure 2).</li>
		<li>Remove as much TNT as possible, and then add the active Cy5-tyramide solution. Incubate the samples for 10 min in the dark.</li>
		<li>Wash the samples with PBST for 3 x 10 min in the dark.</li>
	</ol>
	</li>
	<li>Detection of EdU 
	NOTE: The EdU kit detects incorporated EdU as fluorescent signals (Figure 2).
	<ol>
		<li>To prepare the EdU detection cocktail, mix the components as shown in Table 1. Use 100 &#181;L of EdU detection cocktail for each sample. 
		NOTE: Prepare 1x Reaction Buffer additive by diluting 10x Reaction Buffer additive with ultrapure water.</li>
		<li>Remove PBST, and then add the EdU detection cocktail. Incubate in the dark for 30 min.</li>
		<li>Wash with PBST for 3 x 10 min in the dark.</li>
	</ol>
	</li>
	<li>DNA staining
	<ol>
		<li>Dilute Hoechst 33342 (1:500) in PBST to prepare the Hoechst solution. Remove the PBST, and then add the Hoechst solution. Incubate the samples for 30 min in the dark (Figure 2).</li>
		<li>Wash the samples with PBST for 3-4 x 10 min in the dark.</li>
	</ol>
	</li>
	<li>Mounting
	<ol>
		<li>Make a bank on the glass slide to prevent the sample from being crushed. Apply vinyl tape to the glass slide and hollow out the center.</li>
		<li>Transfer the medusae to the bank on the slide glass using a 3.1 mL transfer pipette with the tip cut off. 
		NOTE: Be careful not to let the tentacles overlap.</li>
		<li>Remove any PBST with a P200 pipette, and then slowly add 70% glycerol as the mounting medium (Figure 2). 
		NOTE: Instead of 70% glycerol, anti-fading mounting medium can be used to prevent the fluorescence from fading.</li>
		<li>Gently place a coverslip on the medusae with forceps, and seal the side of the coverslip with clear nail polish.</li>
		<li>Keep the slides at 4 &#176;C in the dark if not immediately performing microscopy observation.</li>
	</ol>
	</li>
	<li>Imaging
	<ol>
		<li>Use a laser scanning confocal microscope to acquire images. For single-cell resolution, use a 40x oil lens or a lens for higher magnification.</li>
		<li>After image acquisition, open the images using ImageJ/FIJI software and count cells that are positive for EdU+ and/or Nanos1+&#160;by the multipoint tool20.</li>
	</ol>
	</li>
</ol>

<ol><li>Leclère, L., Röttinger, E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Diversity+of+cnidarian+muscles%3A+Function%2C+anatomy%2C+development+and+regeneration%5BTitle%5D)+AND+%22Frontiers+in+Cell+and+Developmental+Biology%22%5BJournal%5D)">Diversity of cnidarian muscles: Function, anatomy, development and regeneration.</a> Frontiers in Cell and Developmental Biology. 4, 157(2017).</li>
<li>Bosch, T. C. G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Back+to+the+basics%3A+Cnidarians+start+to+fire%5BTitle%5D)+AND+%22Trends+in+Neurosciences%22%5BJournal%5D)">Back to the basics: Cnidarians start to fire.</a> Trends in Neurosciences. 40 (2), 92-105 (2017).</li>
<li>Gold, D. A., Jacobs, D. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Stem+cell+dynamics+in+Cnidaria%3A+Are+there+unifying+principles%5BTitle%5D)+AND+%22Development+Genes+and+Evolution%22%5BJournal%5D)">Stem cell dynamics in Cnidaria: Are there unifying principles.</a> Development Genes and Evolution. 223 (1-2), 53-66 (2013).</li>
<li>Technau, U., Steele, R. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Evolutionary+crossroads+in+developmental+biology%3A+Cnidaria%5BTitle%5D)+AND+%22Development%22%5BJournal%5D)">Evolutionary crossroads in developmental biology: Cnidaria.</a> Development. 138 (8), 1447-1458 (2011).</li>
<li>Leclère, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Maternally+localized+germ+plasm+mRNAs+and+germ+cell%2Fstem+cell+formation+in+the+cnidarian+Clytia%5BTitle%5D)+AND+%22Developmental+Biology%22%5BJournal%5D)">Maternally localized germ plasm mRNAs and germ cell/stem cell formation in the cnidarian Clytia.</a> Developmental Biology. 364 (2), 236-248 (2012).</li>
<li>Bradshaw, B., Thompson, K., Frank, U. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Distinct+mechanisms+underlie+oral+vs+aboral+regeneration+in+the+cnidarian+Hydractinia+echinata%5BTitle%5D)+AND+%22eLife%22%5BJournal%5D)">Distinct mechanisms underlie oral vs aboral regeneration in the cnidarian Hydractinia echinata.</a> eLife. 4, 05506(2015).</li>
<li>Sinigaglia, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Pattern+regulation+in+a+regenerating+jellyfish%5BTitle%5D)+AND+%22eLife%22%5BJournal%5D)">Pattern regulation in a regenerating jellyfish.</a> eLife. 9, 54868(2020).</li>
<li>David, C. N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Interstitial+stem+cells+in+Hydra%3A+Multipotency+and+decision-making%5BTitle%5D)+AND+%22The+International+Journal+of+Developmental+Biology%22%5BJournal%5D)">Interstitial stem cells in Hydra: Multipotency and decision-making.</a> The International Journal of Developmental Biology. 56 (6-7-8), 489-497 (2012).</li>
<li>Röttinger, E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Nematostella+vectensis%2C+an+emerging+model+for+deciphering+the+molecular+and+cellular+mechanisms+underlying+whole-body+regeneration%5BTitle%5D)+AND+%22Cells%22%5BJournal%5D)">Nematostella vectensis, an emerging model for deciphering the molecular and cellular mechanisms underlying whole-body regeneration.</a> Cells. 10 (10), 2692(2021).</li>
<li>Houliston, E., Momose, T., Manuel, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Clytia+hemisphaerica%3A+A+jellyfish+cousin+joins+the+laboratory%5BTitle%5D)+AND+%22Trends+in+Genetics%22%5BJournal%5D)">Clytia hemisphaerica: A jellyfish cousin joins the laboratory.</a> Trends in Genetics. 26 (4), 159-167 (2010).</li>
<li>Peron, S., Houliston, E., Leclère, L. The Marine Jellyfish Model, Clytia hemisphaerica. <a target="_blank" href="http://scholar.google.com/scholar?hl=en&safe=off&q=author%3aPeron%2C+S+%22Handbook+of+Marine+Model+Organisms+in+Experimental+Biology%22">Handbook of Marine Model Organisms in Experimental Biology</a>. Boutet, A., Shierwater, B. , CRC Press. Boca. Raton, FL. 129-147 (2021).</li>
<li>Denker, E., Manuel, M., Leclère, L., Le Guyader, H., Rabet, N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Ordered+progression+of+nematogenesis+from+stem+cells+through+differentiation+stages+in+the+tentacle+bulb+of+Clytia+hemisphaerica+%28Hydrozoa%2C+Cnidaria%29%5BTitle%5D)+AND+%22Developmental+Biology%22%5BJournal%5D)">Ordered progression of nematogenesis from stem cells through differentiation stages in the tentacle bulb of Clytia hemisphaerica (Hydrozoa, Cnidaria).</a> Developmental Biology. 315 (1), 99-113 (2008).</li>
<li>Fujita, S., Kuranaga, E., Nakajima, Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Regeneration+potential+of+jellyfish%3A+Cellular+mechanisms+and+molecular+insights%5BTitle%5D)+AND+%22Genes%22%5BJournal%5D)">Regeneration potential of jellyfish: Cellular mechanisms and molecular insights.</a> Genes. 12 (5), 758(2021).</li>
<li>Suga, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Flexibly+deployed+Pax+genes+in+eye+development+at+the+early+evolution+of+animals+demonstrated+by+studies+on+a+hydrozoan+jellyfish%5BTitle%5D)+AND+%22Proceedings+of+the+National+Academy+of+Sciences%22%5BJournal%5D)">Flexibly deployed Pax genes in eye development at the early evolution of animals demonstrated by studies on a hydrozoan jellyfish.</a> Proceedings of the National Academy of Sciences. 107 (32), 14263-14268 (2010).</li>
<li>Fujiki, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Branching+pattern+and+morphogenesis+of+medusa+tentacles+in+the+jellyfish+Cladonema+pacificum+%28Hydrozoa%2C+Cnidaria%29%5BTitle%5D)+AND+%22Zoological+Letters%22%5BJournal%5D)">Branching pattern and morphogenesis of medusa tentacles in the jellyfish Cladonema pacificum (Hydrozoa, Cnidaria).</a> Zoological Letters. 5 (12), 13(2019).</li>
<li>Fujita, S., Kuranaga, E., Nakajima, Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Cell+proliferation+controls+body+size+growth%2C+tentacle+morphogenesis%2C+and+regeneration+in+hydrozoan+jellyfish+Cladonema+pacificum%5BTitle%5D)+AND+%22PeerJ%22%5BJournal%5D)">Cell proliferation controls body size growth, tentacle morphogenesis, and regeneration in hydrozoan jellyfish Cladonema pacificum.</a> PeerJ. 7, 7579(2019).</li>
<li>Hou, S., Zhu, J., Shibata, S., Nakamoto, A., Kumano, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Repetitive+accumulation+of+interstitial+cells+generates+the+branched+structure+of+Cladonema+medusa+tentacles%5BTitle%5D)+AND+%22Development%22%5BJournal%5D)">Repetitive accumulation of interstitial cells generates the branched structure of Cladonema medusa tentacles.</a> Development. 148 (23), (2021).</li>
<li>Salic, A., Mitchison, T. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((A+chemical+method+for+fast+and+sensitive+detection+of+DNA+synthesis+in+vivo%5BTitle%5D)+AND+%22Proceedings+of+the+National+Academy+of+Sciences+of+the+United+States+of+America%22%5BJournal%5D)">A chemical method for fast and sensitive detection of DNA synthesis in vivo.</a> Proceedings of the National Academy of Sciences of the United States of America. 105 (7), 2415-2420 (2008).</li>
<li>Angerer, L. M., Angerer, R. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Detection+of+poly+A+%2B+RNA+in+sea+urchin+eggs+and+embryos+by+quantitative+in+situ+hybridization%5BTitle%5D)+AND+%22Nucleic+Acids+Research%22%5BJournal%5D)">Detection of poly A + RNA in sea urchin eggs and embryos by quantitative in situ hybridization.</a> Nucleic Acids Research. 9 (12), 2819-2840 (1981).</li>
<li>Rakotomamonjy, J., Guemez-Gamboa, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Purkinje+cell+survival+in+organotypic+cerebellar+slice+cultures%5BTitle%5D)+AND+%22Journal+of+Visualized+Experiments%22%5BJournal%5D)">Purkinje cell survival in organotypic cerebellar slice cultures.</a> Journal of Visualized Experiments. (154), e60353(2019).</li>
<li>Tanaka, E. M., Reddien, P. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((The+cellular+basis+for+animal+regeneration%5BTitle%5D)+AND+%22Developmental+Cell%22%5BJournal%5D)">The cellular basis for animal regeneration.</a> Developmental Cell. 21 (1), 172-185 (2011).</li>
<li>Penzo-Méndez, A. I., Stanger, B. Z. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Organ-size+regulation+in+mammals%5BTitle%5D)+AND+%22Cold+Spring+Harbor+Perspectives+in+Biology%22%5BJournal%5D)">Organ-size regulation in mammals.</a> Cold Spring Harbor Perspectives in Biology. 7 (9), 019240(2015).</li>
<li>Sinigaglia, C., Thiel, D., Hejnol, A., Houliston, E., Leclère, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((A+safer%2C+urea-based+in+situ+hybridization+method+improves+detection+of+gene+expression+in+diverse+animal+species%5BTitle%5D)+AND+%22Developmental+Biology%22%5BJournal%5D)">A safer, urea-based in situ hybridization method improves detection of gene expression in diverse animal species.</a> Developmental Biology. 434 (1), 15-23 (2018).</li>
<li>King, R. S., Newmark, P. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((In+situ+hybridization+protocol+for+enhanced+detection+of+gene+expression+in+the+planarian+Schmidtea+mediterranea%5BTitle%5D)+AND+%22BMC+Developmental+Biology%22%5BJournal%5D)">In situ hybridization protocol for enhanced detection of gene expression in the planarian Schmidtea mediterranea.</a> BMC Developmental Biology. 13 (1), 8(2013).</li>
<li>Flici, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((An+evolutionarily+conserved+SoxB-Hdac2+crosstalk+regulates+neurogenesis+in+a+cnidarian%5BTitle%5D)+AND+%22Cell+Reports%22%5BJournal%5D)">An evolutionarily conserved SoxB-Hdac2 crosstalk regulates neurogenesis in a cnidarian.</a> Cell Reports. 18 (6), 1395-1409 (2017).</li>
<li>He, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((An+axial+Hox+code+controls+tissue+segmentation+and+body+patterning+in+Nematostella+vectensis%5BTitle%5D)+AND+%22Science%22%5BJournal%5D)">An axial Hox code controls tissue segmentation and body patterning in Nematostella vectensis.</a> Science. 361 (6409), 1377-1380 (2018).</li>
<li>Govindasamy, N., Murthy, S., Ghanekar, Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Slow-cycling+stem+cells+in+hydra+contribute+to+head+regeneration%5BTitle%5D)+AND+%22Biology+Open%22%5BJournal%5D)">Slow-cycling stem cells in hydra contribute to head regeneration.</a> Biology Open. 3 (12), 1236-1244 (2014).</li>
<li>Passamaneck, Y. J., Martindale, M. Q. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Cell+proliferation+is+necessary+for+the+regeneration+of+oral+structures+in+the+anthozoan+cnidarian+Nematostella+vectensis%5BTitle%5D)+AND+%22BMC+Developmental+Biology%22%5BJournal%5D)">Cell proliferation is necessary for the regeneration of oral structures in the anthozoan cnidarian Nematostella vectensis.</a> BMC Developmental Biology. 12 (1), 34(2012).</li>
<li>Gold, D. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Structural+and+developmental+disparity+in+the+tentacles+of+the+moon+jellyfish+Aurelia+sp.1%5BTitle%5D)+AND+%22PLoS+One%22%5BJournal%5D)">Structural and developmental disparity in the tentacles of the moon jellyfish Aurelia sp.1.</a> PLoS One. 10 (8), 0134741(2015).</li>
<li>Gold, D. A., Nakanishi, N., Hensley, N. M., Hartenstein, V., Jacobs, D. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Cell+tracking+supports+secondary+gastrulation+in+the+moon+jellyfish+Aurelia%5BTitle%5D)+AND+%22Development+Genes+and+Evolution%22%5BJournal%5D)">Cell tracking supports secondary gastrulation in the moon jellyfish Aurelia.</a> Development Genes and Evolution. 226 (6), 383-387 (2016).</li>
<li>Cheng, L. -C., Alvarado, A. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Whole-mount+BrdU+staining+with+fluorescence+in+situ+hybridization+in+planarians%5BTitle%5D)+AND+%22Planarian+Regeneration%22%5BJournal%5D)">Whole-mount BrdU staining with fluorescence in situ hybridization in planarians.</a> Planarian Regeneration. 1774, 423-434 (2018).</li>
</ol>

The authors have no conflicts of interest to disclose.

Proliferating cells and stem cells are important cellular sources in various processes such as morphogenesis, growth, and regeneration21,22. This paper describes a method for co-staining the stem cell marker Nanos1 by FISH and EdU labeling in Cladonema medusae. Previous work using EdU or BrdU labeling has suggested that proliferative cells localize to the tentacle bulbs16,17, but their m...

Cnidaria is considered a basally branching metazoan phylum containing animals with nerves and muscles, placing them in a unique position for understanding the evolution of animal development and physiology1,2. Cnidarians are categorized into two main groups: Anthozoa (e.g., sea anemones and corals) possess only planula larvae and sessile polyp stages, while Medusozoa (members of Hydrozoa, Staurozoa, Scyphozoa, and Cubozoa) typically take the form of free-swimming medusae, or jellyfish, as well as planula larvae and polyps. Cnidarians commonly exhibit high regenerative capacity, and their underlying cellular mechanisms, particularly their possession of adult stem cells and proliferative cells, have attracted much attention3,4. Initially identified in Hydra, hydrozoan stem cells are located in the interstitial spaces between ectodermal epithelial cells and are commonly referred to as interstitial cells or i-cells3.
Hydrozoan i-cells share common characteristics that include multipotency, the expression of widely conserved stem cell markers (e.g., Nanos, Piwi, Vasa), and migration potential3,5,6,7,8. As functional stem cells, i-cells are extensively involved in the development, physiology, and environmental responses of hydrozoan animals, which attests to their high regenerative capacity and plasticity3. While stem cells, similar to i-cells, have not been identified outside of hydrozoans, even in the established model species Nematostella, proliferative cells are still involved in the maintenance and regeneration of somatic tissue, as well as the germ line9. As studies in cnidarian development and regeneration have been predominantly conducted on polyp-type animals such as Hydra, Hydractinia, and Nematostella, the cellular dynamics and functions of stem cells in jellyfish species remain largely unaddressed.
The hydrozoan jellyfish Clytia hemisphaerica, a cosmopolitan jellyfish species with different habitats around the world, including the Mediterranean Sea and North America, has been utilized as an experimental model animal in several developmental and evolutionary studies10. With its small size, easy handling, and large eggs, Clytia is suitable for lab maintenance, as well as for the introduction of genetic tools such as the recently established transgenesis and knockout methods11, opening up the opportunity for detailed analysis of the cellular and molecular mechanisms underlying jellyfish biology. In the Clytia medusa tentacle, i-cells are localized in the proximal region, called the bulb, and progenitors such as nematoblasts migrate to the distal tip while differentiating into distinct cell types, including nematocytes12.
During regeneration of the Clytia manubrium, the oral organ of jellyfish, Nanos1+ i-cells that are present in the gonads migrate to the region where the manubrium is lost in response to damage and participate in the regeneration of the manubrium7. These findings support the idea that i-cells in Clytia also behave as functional stem cells that are involved in morphogenesis and regeneration. However, given that the properties of i-cells differ among representative polyp-type animals such as Hydra and Hydractinia3, it is possible that the characteristics and functions of stem cells are diversified among jellyfish species. Furthermore, with the exception of Clytia, experimental techniques have been limited for other jellyfish, and the detailed dynamics of proliferative cells and stem cells are unknown13.
The hydrozoan jellyfish Cladonema pacificum is an emerging model organism that can be kept in a laboratory environment without a water pump or filtration system. The Cladonema medusa has branched tentacles, a common characteristic in the Cladonematidae family, and a photoreceptor organ called the ocellus on the ectodermal layer near the bulb14. The tentacle branching process occurs at a new branching site that appears along the adaxial side of the tentacle. Over time, the tentacles continue to elongate and branch, with the older branches being pushed out toward the tip15. In addition, Cladonema tentacles can regenerate within a few days upon amputation. Recent studies have suggested the role of proliferating cells and stem-like cells in tentacle branching and regeneration in Cladonema16,17. However, while conventional in situ hybridization (ISH) has been utilized to visualize gene expression in Cladonema, due to its low resolution, it is currently difficult to observe stem cell dynamics at the cellular level in detail.
This paper describes a method for visualizing stem-like cells in Cladonema by FISH and co-staining with EdU, a marker of cell proliferation18. We visualize the expression pattern of Nanos1, a stem cell marker5,17, by FISH, which allows for the identification of stem-like cell distribution at the single-cell level. In addition, the co-staining of Nanos1 expression with EdU labeling makes it possible to distinguish actively proliferating stem-like cells. This method for monitoring both stem-like cells and proliferative cells can be applied to a wide range of investigative areas, including tentacle branching, tissue homeostasis, and organ regeneration in Cladonema, and a similar approach can be applied to other jellyfish species.

<table><tbody><tr><td>2-Mercaptoethanol&amp;nbsp;</td><td>Wako</td><td>137-06862</td><td></td></tr><tr><td>3.1 mL transfer pipette</td><td>Thermo Scientific</td><td>233-20S</td><td></td></tr><tr><td>5-Bromo-4-chloro-3-indolyl-&amp;beta;-D-galactopyranoside (X-Gal)</td><td>Wako</td><td>029-15043</td><td></td></tr><tr><td>anti-DIG-POD</td><td>Roche</td><td>11207733910</td><td></td></tr><tr><td>&lt;em&gt;Cladonema pacificum Nanos1&lt;/em&gt; forward primer</td><td></td><td></td><td>5&amp;rsquo;-AAGAGACACAGTCATTATCAAGC&lt;br/&gt; GA-3&amp;rsquo;</td></tr><tr><td>&lt;em&gt;Cladonema pacificum Nanos1&lt;/em&gt; reverse primer</td><td></td><td></td><td>5&amp;rsquo;-CGACGTGTCCAATTTTACGTGCT -3&amp;rsquo;</td></tr><tr><td>&lt;em&gt;Cladonema pacificum Piwi&lt;/em&gt; forward primer</td><td></td><td></td><td>5&amp;rsquo;- AAAAGAGCAGCGGCCAGAAAGA&lt;br/&gt; AGGC -3&amp;rsquo;</td></tr><tr><td>&lt;em&gt;Cladonema pacificum Piwi&lt;/em&gt; reverse primer</td><td></td><td></td><td>5&amp;rsquo;- GCGGGTCGCATACTTGTTGGTA&lt;br/&gt; CTGGC -3&amp;rsquo;</td></tr><tr><td>Click-iT EdU Cell Proliferation Kit for Imaging, Alexa Fluor 488 dye</td><td>Invitrogen&amp;nbsp;</td><td>C10337</td><td>EdU kit</td></tr><tr><td>Coroline off</td><td>GEX Co. ltd</td><td>N/A</td><td>chlorine neutralizer</td></tr><tr><td>DIG Nucleic Acid Detection Kit Blocking Reagent</td><td>Roche</td><td>11175041910</td><td>blocking buffer&amp;nbsp;</td></tr><tr><td>DIG RNA labeling mix&amp;nbsp;</td><td>Roche</td><td>11277073910</td><td></td></tr><tr><td>DTT&amp;nbsp;</td><td>Promega</td><td>P117B</td><td></td></tr><tr><td>&lt;em&gt;ECOS&lt;/em&gt; competent cell DH5&amp;alpha;</td><td>NIPPON GENE</td><td>316-06233</td><td>competent cell</td></tr><tr><td>Fast gene Gel/PCR Extraction kit</td><td>Fast gene</td><td>FG-91302</td><td>gel extraction kit</td></tr><tr><td>Fast gene plasmid mini kit</td><td>Fast gene</td><td>FG-90502</td><td>plasmid miniprep</td></tr><tr><td>Formamide</td><td>Wako&amp;nbsp;</td><td>068-00426</td><td></td></tr><tr><td>Heparin sodium salt from porcine</td><td>SIGMA-ALDRICH&amp;nbsp;</td><td>H3393-10KU</td><td></td></tr><tr><td>Isopropyl-&amp;beta;-D(-)-thiogalactopyranoside (IPTG)</td><td>Wako</td><td>096-05143</td><td></td></tr><tr><td>LB Agar</td><td>Invitrogen</td><td>22700-025</td><td>agar plate</td></tr><tr><td>LB Broth Base</td><td>Invitrogen</td><td>12780-052</td><td>LB medium</td></tr><tr><td>Maleic acid</td><td>Wako</td><td>134-00495</td><td></td></tr><tr><td>mini Quick spin RNA columns</td><td>Roche</td><td>11814427001</td><td>clean-up column</td></tr><tr><td>NaCl</td><td>Wako&amp;nbsp;</td><td>191-01665</td><td></td></tr><tr><td>NanoDrop OneC Microvolume UV-Vis Spectrophotometer with Wi-Fi</td><td>Thermo Scientific</td><td>ND-ONEC-W</td><td>spectrophotometer</td></tr><tr><td>Polyoxyethlene (20) Sorbitan Monolaurate (Tween-20)</td><td>Wako&amp;nbsp;</td><td>166-21115</td><td></td></tr><tr><td>PowerMasher 2</td><td>nippi&amp;nbsp;</td><td>891300</td><td>homogenizer</td></tr><tr><td>Proteinase K</td><td>Nacarai Tesque&amp;nbsp;</td><td>29442-14</td><td></td></tr><tr><td>RNase Inhibitor</td><td>TaKaRa</td><td>2313A</td><td></td></tr><tr><td>RNeasy Mini kit</td><td>Qiagen&amp;nbsp;</td><td>74004</td><td>total RNA isolation kit</td></tr><tr><td>RQ1 RNase-Free Dnase</td><td>Promega</td><td>M6101</td><td></td></tr><tr><td>Saline Sodium Citrate Buffer 20x powder (20x SSC)</td><td>TaKaRa</td><td>T9172</td><td></td></tr><tr><td>SEA LIFE</td><td>Marin Tech</td><td>N/A</td><td>mixture of mineral salts</td></tr><tr><td>T3 RNA polymerase&amp;nbsp;</td><td>Roche</td><td>11031163001</td><td></td></tr><tr><td>T7 RNA polymerase&amp;nbsp;</td><td>Roche</td><td>10881767001</td><td></td></tr><tr><td>TAITEC HB-100</td><td>TAITEC</td><td>0040534-000</td><td>Hybridization incuvator</td></tr><tr><td>TaKaRa Ex Taq&amp;nbsp;</td><td>TaKaRa</td><td>RR001A</td><td>Taq DNA polymerase</td></tr><tr><td>TaKaRa PrimeScript 2 1&lt;sup&gt;st&lt;/sup&gt; strand cDNA Synthesis Kit</td><td>TaKaRa</td><td>6210A</td><td>cDNA synthesis kit</td></tr><tr><td>Target Clone</td><td>TOYOBO&amp;nbsp;</td><td>TAK101</td><td>pTA2 Vector</td></tr><tr><td>tRNA</td><td>Roche</td><td>10109541001</td><td></td></tr><tr><td>TSA Plus Cyanine 5</td><td>AKOYA Biosciences</td><td>NEL745001KT</td><td>tyramide signal amplification (TSA) technique</td></tr><tr><td>Zeiss LSM 880</td><td>ZEISS</td><td>N/A</td><td>laser scanning confocal microscope</td></tr></tbody></table>

fluorescent in situ hybridization and 5-ethynyl-2'-deoxyuridine labeling for stem-like cells in the hydrozoan jellyfish cladonema pacificum

Cnidarians, including sea anemones, corals, and jellyfish, exhibit diverse morphology and lifestyles that are manifested in sessile polyps and free-swimming medusae. As exemplified in established models such as Hydra and Nematostella, stem cells and/or proliferative cells contribute to the development and regeneration of cnidarian polyps. However, the underlying cellular mechanisms in most jellyfish, particularly at the medusa stage, are largely unclear, and, thus, developing a robust method for identifying specific cell types is critical. This paper describes a protocol for visualizing stem-like proliferating cells in the hydrozoan jellyfish Cladonema pacificum. Cladonema medusae possess branched tentacles that continuously grow and maintain regenerative capacity throughout their adult stage, providing a unique platform with which to study the cellular mechanisms orchestrated by proliferating and/or stem-like cells. Whole-mount fluorescent in situ hybridization (FISH) using a stem cell marker allows for the detection of stem-like cells, while pulse labeling with 5-ethynyl-2&#39;-deoxyuridine (EdU), an S phase marker, enables the identification of proliferating cells. Combining both FISH and EdU labeling, we can detect actively proliferating stem-like cells on fixed animals, and this technique can be broadly applied to other animals, including non-model jellyfish species.

Cladonema tentacles have been used as a model to study the cellular processes of morphogenesis and regeneration15,16,17. The tentacle structure is composed of an epithelial tube where stem-like cells, or i-cells, are located in the proximal region, called the tentacle bulb, and new branches are sequentially added to the rear of the distal region of the bulb along the adaxial side (Figure 3A...

Watch this Scientific Journal Video about Fluorescent In Situ Hybridization and 5-Ethynyl-2'-Deoxyuridine Labeling for Stem-Like Cells in the Hydrozoan Jellyfish Cladonema pacificum at JoVE.com

Fluorescent In Situ Hybridization and 5-Ethynyl-2'-Deoxyuridine Labeling for Stem-Like Cells in the Hydrozoan Jellyfish Cladonema pacificum

Here, we describe a protocol for visualizing stem-like proliferating cells in the jellyfish Cladonema. Whole-mount fluorescent in situ hybridization with a stem cell marker allows for the detection of stem-like cells, and 5-ethynyl-2&#39;-deoxyuridine labeling enables the identification of proliferating cells. Together, actively proliferating stem-like cells can be detected.&#160;

Fluorescent In Situ Hybridization and 5-Ethynyl-2'-Deoxyuridine Labeling for Stem-Like Cells in the Hydrozoan Jellyfish Cladonema pacificum

Cnidarians, including sea anemones, corals, and jellyfish, exhibit diverse morphology and lifestyles that are manifested in sessile polyps and ...

fluorescent-situ-hybridization-5-ethynyl-2-deoxyuridine-labeling-for

Research

JoVE Journal

Developmental Biology

3.1K Views.  Tohoku University. Co-kleuring van Nanos1-expressie met EdU-labeling maakt het mogelijk om actief prolifererende stamcellen te onderscheiden. We kunnen de stamachtige celverdeling op het niveau van één cel identificeren in de kwal Cladonema. We kunnen stamachtige cellen en prolifererende cellen visualiseren in hetzelfde kwallenmonster, wat de detectie van prolifererende en niet-prolifererende stamachtige cellen mogelijk maakt, wat leidt tot begrip van stamcelheterogeniteit.Ontwikkelingsbiologie en rege...

Video: Fluorescent In Situ Hybridization and 5-Ethynyl-2'-Deoxyuridine Labeling for Stem-Like Cells in the Hydrozoan Jellyfish Cladonema pacificum

Labeling Stem Cells with Fluorescent Dyes for non-invasive Detection with Optical Imaging

Optical imaging (OI) is an easy, fast and inexpensive tool for in vivo monitoring of new stem cell based therapies. The technique is based on ex vivo labeling of stem cells with a fluorescent dye, subsequent intravenous injection of the labeled cells and visualization of their accumulation in specific target organs or pathologies. The presented technique demonstrates how we label human mesenchymal stem cells (hMSC) by simple incubation with the lipophilic fluorescent dye DiD (C67H103CIN2O3S) and how we label human embryonic stem cells (hESC) with the FDA approved fluorescent dye Indocyanine Green (ICG). The uptake mechanism is via adherence and diffusion of the lypophilic dye across the phospholipid cell membrane bilayer. The labeling efficiency is usually improved if the cells are incubated with the dye in serum-free media as opposed to incubation in serum-containing media. Furthermore, the addition of the transfection agent Protamine Sulfate significantly improves contrast agent uptake.

This video shows techniques for labeling of human embryonic stem cells and mesenchymal stem cells with fluorescent dyes. This technique can be used for an in vivo tracking of transplanted stem cells with optical imaging and for histopathological correlations with fluorescence microscopy.

Optical imaging (OI) is an easy, fast and inexpensive tool for in vivo monitoring of new stem cell based therapies. The technique is based on ex vivo ...

Biology

Isolation of Stem-like Cells from 3-Dimensional Spheroid Cultures

Despite advances in adult stem cell research, identification and isolation of stem cells from tissue specimens remains a major challenge. While resident stem cells are relatively quiescent with niche restraints in adult tissues, they enter the cell cycle in anchor-free three-dimensional (3D) culture and undergo both symmetric and asymmetric cell division, giving rise to both stem and progenitor cells. The latter proliferate rapidly and are the major cell population at various stages of lineage commitment, forming heterogeneous spheroids. Using primary normal human prostate epithelial cells (HPrEC), a spheroid-based, label-retention assay was developed that permits the identification and functional isolation of the spheroid-initiating stem cells at a single cell resolution.
HPrEC or cell lines are two-dimensionally (2D) cultured with BrdU for 10 days to permit its incorporation into the DNA of all dividing cells, including self-renewing stem cells. Wash out commences upon transfer to the 3D culture for 5 days, during which stem cells self-renew through asymmetric division and initiate spheroid formation. While relatively quiescent daughter stem cells retain BrdU-labeled parental DNA, the daughter progenitors rapidly proliferate, losing the BrdU label. BrdU can be substituted with CFSE or Far Red pro-dyes, which permit live stem cell isolation by FACS. Stem cell characteristics are confirmed by in vitro spheroid formation, in vivo tissue regeneration assays, and by documenting their symmetric/asymmetric cell divisions. The isolated label-retaining stem cells can be rigorously interrogated by downstream molecular and biologic studies, including RNA-seq, ChIP-seq, single cell capture, metabolic activity, proteome profiling, immunocytochemistry, organoid formation, and in vivo tissue regeneration. Importantly, this marker-free functional stem cell isolation approach identifies stem-like cells from fresh cancer specimens and cancer cell lines from multiple organs, suggesting wide applicability. It can be used to identify cancer stem-like cell biomarkers, screen pharmaceuticals targeting cancer stem-like cells, and discover novel therapeutic targets in cancers.

Using human primary prostate epithelial cells, we report a novel biomarker-free method of functional characterization of stem-like cells by a spheroid-based label-retention assay. A step-by-step protocol is described for BrdU, CFSE, or Far Red 2D cell labeling; three-dimensional spheroid formation; label-retaining stem-like cell identification by immunocytochemistry; and isolation by FACS.

Despite advances in adult stem cell research, identification and isolation of stem cells from tissue specimens remains a major challenge. While resident ...

Cancer Research

Fluorescence Activated Cell Sorting of Plant Protoplasts

High-resolution, cell type-specific analysis of gene expression greatly enhances understanding of developmental regulation and responses to environmental stimuli in any multicellular organism. In situ hybridization and reporter gene visualization can to a limited extent be used to this end but for high resolution quantitative RT-PCR or high-throughput transcriptome-wide analysis the isolation of RNA from particular cell types is requisite. Cellular dissociation of tissue expressing a fluorescent protein marker in a specific cell type and subsequent Fluorescence Activated Cell Sorting (FACS) makes it possible to collect sufficient amounts of material for RNA extraction, cDNA synthesis/amplification and microarray analysis.
An extensive set of cell type-specific fluorescent reporter lines is available to the plant research community. In this case, two marker lines of the Arabidopsis thaliana root are used: PSCR::GFP (endodermis and quiescent center) and PWOX5::GFP (quiescent center). Large numbers (thousands) of seedlings are grown hydroponically or on agar plates and harvested to obtain enough root material for further analysis. Cellular dissociation of plant material is achieved by enzymatic digestion of the cell wall. This procedure makes use of high osmolarity-induced plasmolysis and commercially available cellulases, pectinases and hemicellulases to release protoplasts into solution.
FACS of GFP-positive cells makes use of the visualization of the green versus the red emission spectra of protoplasts excited by a 488 nm laser. GFP-positive protoplasts can be distinguished by their increased ratio of green to red emission. Protoplasts are typically sorted directly into RNA extraction buffer and stored for further processing at a later time.
This technique is revealed to be straightforward and practicable. Furthermore, it is shown that it can be used without difficulty to isolate sufficient numbers of cells for transcriptome analysis, even for very scarce cell types (e.g. quiescent center cells). Lastly, a growth setup for Arabidopsis seedlings is demonstrated that enables uncomplicated treatment of the plants prior to cell sorting (e.g. for the cell type-specific analysis of biotic or abiotic stress responses). Potential supplementary uses for FACS of plant protoplasts are discussed.

A method for isolating specific cell types from plant material is demonstrated. This technique employs transgenic marker lines expressing fluorescent proteins in particular cell types, cellular dissociation and Fluorescence Activated Cell Sorting. Additionally, a growth setup is established here that facilitates treatment of Arabidopsis thaliana seedlings prior to cell sorting.

High-resolution, cell type-specific analysis of gene expression greatly enhances understanding of developmental regulation and responses to environmental ...

Detection and Quantitation of Label-Retaining Cells in Mouse Incisors using a 3D Reconstruction Approach after Tissue Clearing

The murine incisor is an organ that grows continuously throughout the lifespan of the mouse. The epithelial and mesenchymal stem cells residing in the proximal tissues of incisors give rise to progeny that will differentiate into ameloblasts, odontoblasts, and pulp fibroblasts. These cells are crucial in supporting the sustained turnover of incisor tissues, making the murine incisor an excellent model for studying the homeostasis of adult stem cells. Stem cells are believed to contain long-living quiescent cells that can be labeled by nucleotide analogs such as 5-ethynyl-2&#180;-deoxyuridine (EdU). The cells retain this label over time and are accordingly named&#160;label-retaining cells (LRCs). Approaches for visualizing LRCs in vivo provide a robust tool for monitoring stem cell homeostasis. In this study, we described a method for visualizing and analyzing LRCs. Our innovative approach features LRCs in mouse incisors after tissue clearing and whole-mount EdU staining followed by confocal microscopy and a 3-dimensional (3D) reconstruction with the imaging software. This method enables 3D imaging acquisition and non-biased quantitation compared to traditional LRCs analysis on sectioned slides.

The mouse incisor contains valuable label-retaining cells in its stem cell niche. We have a novel way to unbiasedly detect and quantify the label-retaining cells; our study used EdU labeling and a 3D reconstruction approach after PEGASOS tissue clearing of the mandible.

The murine incisor is an organ that grows continuously throughout the lifespan of the mouse. The epithelial and mesenchymal stem cells residing in the ...

Bromodeoxyuridine (BrdU) Labeling and Subsequent Fluorescence Activated Cell Sorting for Culture-independent Identification of Dissolved Organic Carbon-degrading Bacterioplankton

Microbes are major agents mediating the degradation of numerous dissolved organic carbon (DOC) substrates in aquatic environments. However, identification of bacterial taxa that transform specific pools of DOC in nature poses a technical challenge. 
Here we describe an approach that couples bromodeoxyuridine (BrdU) incorporation, fluorescence activated cell sorting (FACS), and 16S rRNA gene-based molecular analysis that allows culture-independent identification of bacterioplankton capable of degrading a specific DOC compound in aquatic environments. Triplicate bacterioplankton microcosms are set up to receive both BrdU and a model DOC compound (DOC amendments), or only BrdU (no-addition control). BrdU substitutes the positions of thymidine in newly synthesized bacterial DNA and BrdU-labeled DNA can be readily immunodetected 1,2. Through a 24-hr incubation, bacterioplankton that are able to use the added DOC compound are expected to be selectively activated, and therefore have higher levels of BrdU incorporation (HI cells) than non-responsive cells in the DOC amendments and cells in no-addition controls (low BrdU incorporation cells, LI cells). After fluorescence immunodetection, HI cells are distinguished and physically separated from the LI cells by fluorescence activated cell sorting (FACS) 3. Sorted DOC-responsive cells (HI cells) are extracted for DNA and taxonomically identified through subsequent 16S rRNA gene-based analyses including PCR, clone library construction and sequencing.

Bromodeoxyuridine BrdU Labeling and Subsequent Fluorescence Activated Cell Sorting for Culture-independent Identification of Dissolved Organic Carbon-degrading Bacterioplankton

Environmental bacterioplankton are incubated with a model dissolved organic carbon (DOC) compound and a DNA labeling reagent, bromodeoxyuridine (BrdU). Afterward, DOC-degrading cells are separated from the bulk community based on their elevated BrdU incorporation using fluorescence activated cell sorting (FACS). These cells are then identified by subsequent molecular analyses.

Microbes are major agents mediating the degradation of numerous dissolved organic carbon (DOC) substrates in aquatic environments. However, identification ...

In Situ Hybridization for the Precise Localization of Transcripts in Plants

With the advances in genomics research of the past decade, plant biology has seen numerous studies presenting large-scale quantitative analyses of gene expression. Microarray and next generation sequencing approaches are being used to investigate developmental, physiological and stress response processes, dissect epigenetic and small RNA pathways, and build large gene regulatory networks1-3. While these techniques facilitate the simultaneous analysis of large gene sets, they typically provide a very limited spatiotemporal resolution of gene expression changes. This limitation can be partially overcome by using either profiling method in conjunction with lasermicrodissection or fluorescence-activated cell sorting4-7. However, to fully understand the biological role of a gene, knowledge of its spatiotemporal pattern of expression at a cellular resolution is essential. Particularly, when studying development or the effects of environmental stimuli and mutants can the detailed analysis of a gene's expression pattern become essential. For instance, subtle quantitative differences in the expression levels of key regulatory genes can lead to dramatic phenotypes when associated with the loss or gain of expression in specific cell types. 
Several methods are routinely used for the detailed examination of gene expression patterns. One is through analysis of transgenic reporter lines. Such analysis can, however, become time-consuming when analyzing multiple genes or working in plants recalcitrant to transformation. Moreover, an independent validation to ensure that the transgene expression pattern mimics that of the endogenous gene is typically required. Immunohistochemical protein localization or mRNA in situ hybridization present relatively fast alternatives for the direct visualization of gene expression within cells and tissues. The latter has the distinct advantage that it can be readily used on any gene of interest. In situ hybridization allows detection of target mRNAs in cells by hybridization with a labeled anti-sense RNA probe obtained by in vitro transcription of the gene of interest. 
Here we outline a protocol for the in situ localization of gene expression in plants that is highly sensitivity and specific. It is optimized for use with paraformaldehyde fixed, paraffin-embedded sections, which give excellent preservation of histology, and DIG-labeled probes that are visualized by immuno-detection and alkaline-phosphatase colorimetric reaction. This protocol has been successfully applied to a number of tissues from a wide range of plant species, and can be used to analyze expression of mRNAs as well as small RNAs8-14.

In Situ Hybridization for the Precise Localization of Transcripts in Plants

The in situ hybridization protocol described here allows a direct localization of mRNA and small RNA expression at the cellular level with high sensitivity and specificity. The procedure is optimized for paraffin-embedded plant tissue sections, is applicable to a wide range of plants and tissues, and can be completed within ten days.

With the advances in genomics research of the past decade, plant biology has seen numerous studies presenting large-scale quantitative analyses of gene ...

Chromosome Replicating Timing Combined with Fluorescent In situ Hybridization

Mammalian DNA replication initiates at multiple sites along chromosomes at different times during S phase, following a temporal replication program. The specification of replication timing is thought to be a dynamic process regulated by tissue-specific and developmental cues that are responsive to epigenetic modifications. However, the mechanisms regulating where and when DNA replication initiates along chromosomes remains poorly understood. Homologous chromosomes usually replicate synchronously, however there are notable exceptions to this rule. For example, in female mammalian cells one of the two X chromosomes becomes late replicating through a process known as X inactivation1. Along with this delay in replication timing, estimated to be 2-3 hr, the majority of genes become transcriptionally silenced on one X chromosome. In addition, a discrete cis-acting locus, known as the X inactivation center, regulates this X inactivation process, including the induction of delayed replication timing on the entire inactive X chromosome. In addition, certain chromosome rearrangements found in cancer cells and in cells exposed to ionizing radiation display a significant delay in replication timing of &gt;3 hours that affects the entire chromosome2,3. Recent work from our lab indicates that disruption of discrete cis-acting autosomal loci result in an extremely late replicating phenotype that affects the entire chromosome4. Additional 'chromosome engineering' studies indicate that certain chromosome rearrangements affecting many different chromosomes result in this abnormal replication-timing phenotype, suggesting that all mammalian chromosomes contain discrete cis-acting loci that control proper replication timing of individual chromosomes5.
Here, we present a method for the quantitative analysis of chromosome replication timing combined with fluorescent in situ hybridization. This method allows for a direct comparison of replication timing between homologous chromosomes within the same cell, and was adapted from6. In addition, this method allows for the unambiguous identification of chromosomal rearrangements that correlate with changes in replication timing that affect the entire chromosome. This method has advantages over recently developed high throughput micro-array or sequencing protocols that cannot distinguish between homologous alleles present on rearranged and un-rearranged chromosomes. In addition, because the method described here evaluates single cells, it can detect changes in chromosome replication timing on chromosomal rearrangements that are present in only a fraction of the cells in a population.

Chromosome Replicating Timing Combined with Fluorescent In situ Hybridization

A quantitative method for the analysis of chromosome replication timing is described. The method utilizes BrdU incorporation in combination with fluorescent in situ hybridization (FISH) to assess replication timing of mammalian chromosomes. This technique allows for the direct comparison of rearranged and un-rearranged chromosomes within the same cell.

Mammalian DNA replication initiates at multiple sites along chromosomes at different times during S phase, following a temporal replication program. The ...

Classification of Neural Stem Cell Activation State In Vitro Using Autofluorescence

Neural stem cells (NSCs) divide and produce newborn neurons in the adult brain through a process called adult neurogenesis. Adult NSCs are primarily quiescent, a reversible cell state where they have exited the cell cycle (G0) yet remain responsive to the environment. In the first step of adult neurogenesis, quiescent NSCs (qNSCs) receive a signal and activate, exiting quiescence and re-entering the cell cycle. Thus, understanding the regulators of NSC quiescence and quiescence exit is critical for future strategies targeting adult neurogenesis. However, our understanding of NSC quiescence is limited by technical constraints in identifying quiescent NSCs (qNSCs) and activated NSCs (aNSCs). This protocol describes a new approach to identify and enrich qNSCs and aNSCs generated in in vitro cultures by imaging NSC autofluorescence. First, this protocol describes how to use a confocal microscope to identify autofluorescent markers of qNSCs and aNSCs to classify NSC activation state using autofluorescence intensity. Second, this protocol describes how to use a fluorescent activated cell sorter (FACS) to classify NSC activation state and enrich samples for qNSCs or aNSCs using autofluorescence intensity. Third, this protocol describes how to use a multiphoton microscope to perform fluorescence lifetime imaging (FLIM) at single-cell resolution, classify NSC activation state, and track the dynamics of quiescent exit using both autofluorescence intensities&#160;and fluorescence lifetimes. Thus, this protocol provides a live-cell, label-free, single-cell resolution toolkit for studying NSC quiescence and quiescence exit.

Classification of Neural Stem Cell Activation State In Vitro using Autofluorescence

This protocol describes strategies to identify and enrich for cell-state in primary adult mouse neural stem cell cultures by autofluorescence imaging using i) a confocal microscope, ii) a fluorescent activated cell sorter to perform intensity imaging, or iii) a multiphoton microscope to perform fluorescence lifetime imaging.

Neural stem cells (NSCs) divide and produce newborn neurons in the adult brain through a process called adult neurogenesis. Adult NSCs are primarily ...

Neuroscience

Method for Labeling Transcripts in Individual Escherichia coli Cells for Single-molecule Fluorescence In Situ Hybridization Experiments

A method is described for labeling individual messenger RNA (mRNA) transcripts in fixed bacteria for use in single-molecule fluorescence in situ hybridization (smFISH) experiments in E. coli. smFISH allows the measurement of cell-to-cell variability in mRNA copy number of genes of interest, as well as the subcellular location of the transcripts. The main steps involved are fixation of the bacterial cell culture, permeabilization of cell membranes, and hybridization of the target transcripts with sets of commercially available short fluorescently-labeled oligonucleotide probes. smFISH can allow the imaging of the transcripts of multiple genes in the same cell, with limitations imposed by the spectral overlap between different fluorescent markers. Following completion of the protocol illustrated below, cells can be readily imaged using a microscope coupled with a camera suitable for low-intensity fluorescence. These images, together with cell contours obtained from segmentation of phase contrast frames, or from cell membrane staining, allow the calculation of the mRNA copy number distribution of a sample of cells using open-source or custom-written software. The labeling method described here can also be applied to image transcripts with stochastic optical reconstruction microscopy (STORM).

Method for Labeling Transcripts in Individual Escherichia coli Cells for Single-molecule Fluorescence In Situ Hybridization Experiments

This manuscript describes a method for labeling individual messenger RNA (mRNA) transcripts with fluorescently-labeled DNA probes, for use in single-molecule fluorescence in situ hybridization (smFISH) experiments in E. coli. smFISH is a visualization method that allows the simultaneous detection, localization, and quantification of single mRNA molecules in fixed individual cells.

A method is described for labeling individual messenger RNA (mRNA) transcripts in fixed bacteria for use in single-molecule fluorescence in situ ...

Fluorescence-Activated Cell Sorting for the Isolation of Scleractinian Cell Populations

Coral reefs are under threat due to anthropogenic stressors. The biological response of coral to these stressors may occur at a cellular level, but the mechanisms are not well understood. To investigate coral response to stressors, we need tools for analyzing cellular responses. In particular, we need tools that facilitate the application of functional assays to better understand how cell populations are reacting to stress. In the current study, we use fluorescence-activated cell sorting (FACS) to isolate and separate different cell populations in stony corals. This protocol includes: (1) the separation of coral tissues from the skeleton, (2) creation of a single cell suspension, (3) labeling the coral cells using various markers for flow cytometry, and (4) gating and cell sorting strategies. This method will enable researchers to work on corals at the cellular level for analysis, functional assays, and gene expression studies of different cell populations.

Corals create biodiverse ecosystems important for both humans and marine organisms. However, we still do not understand the full potential and function of many coral cells. Here, we present a protocol developed for the isolation, labeling, and separation of stony coral cell populations.

Coral reefs are under threat due to anthropogenic stressors. The biological response of coral to these stressors may occur at a cellular level, but the ...

Fluorescent In Situ Hybridization and 5-Ethynyl-2'-Deoxyuridine Labeling for Stem-Like Cells in the Hydrozoan Jellyfish Cladonema pacificum

Samenvatting

Meer video's verkennen