The authors thank Dr. Adam J Gehring from Toronto General Hospital Research Institute for providing cDNA for HBs183-91 (s183) (FLLTRILTI)- specific A2-restricted human-murine hybrid TCR genes, and Dr. Pei-Jer Chen from National Taiwan University for providing pAAV/HBV 1.2 construct. This work is supported by the National Institute of Health Grant R01AI121180, R01CA221867 and R21AI109239 to J. S.

All animal experiments are approved by The Texas A&#38;M University Animal Care Committee (IACUC; #2018-0006) and are conducted in compliance with the guidelines of the Association for the Assessment and Accreditation of Laboratory Animal Care. Mice are used during 6&#8211;9 weeks of age.
1. Generation of viral Ag-specific CD8+ T cells from iPSCs (iPSC-CD8+ T cells)
<ol>
	<li>Creation of the retroviral constructs 
	NOTE: TCR &#945; and &#946; genes are linked with 2A self-cleaving sequence. The retroviral vector MSCV-IRES-DsRed (MiDR) is DsRed+ 23.
	<ol>
		<li>Sub-clone HBs183-191 (FLLTRILTI)-specific A2-restricted human-murine hybrid TCR (s183 TCR) genes (V&#945;34 and V&#946;28) into the MiDR to create the s183 MiDR construct (Figure 1A)25.</li>
	</ol>
	 </li>
	<li>Retroviral transduction 
	NOTE: The Platinum-E (Plat-E) cells are used for packaging retroviruses (carrying s183 TCR genes), which will be used for retroviral transduction. The Plat-E cells are an effective retrovirus packaging cells underlying the 293T cells, which were developed by means of unique packaging constructs via the EF1&#945; promoter to express retroviral structure protein, including gag, pol, and ecotropic env.
	<ol>
		<li>On a 100 mm culture dish, seed 3 x 106 Plat-E cells in 8 mL of DMEM culture medium containing 10% fetal calf serum (FCS) in an incubator at 37 &#176;C with 5% CO2,&#160;1 day before transfection.</li>
		<li>On day 0, transfect the s183 MiDR construct into the Plat-E cells using a DNA transfection reagent25.</li>
		<li>On day 1, seed 1 x 106 iPSCs (GFP+) into a gelatin pre-coated culture plate.</li>
		<li>On days 2&#8211;3, collect retroviruses-containing supernatant from Plat-E cell culture to transduce iPSCs with the s183 TCR in the presence of 1,6-dibromohexane solution25.</li>
		<li>On day 4, trypsinize the s183 TCR gene-transduced iPSCs, centrifuge at 400 x g for 5 min and seed 3 &#215; 105 iPSCs in a 100 mm culture dish pre-coated with 3 x 106 irradiated SNL76/7 (irSNL76/7) feeder cells25.</li>
		<li>On day 5 or 6 of confluence, trypsinize the cells, centrifuge at 400 x g for 5 min and process for cell sorting. Gating on live cells, sort GFP and DsRED double-positive cells (the s183 TCR gene-transduced iPSCs) using a high-speed cell sorter. Similar to step 1.2.5, co-culture the sorted cells on irSNL76/7 feeder cells for future use25.</li>
	</ol>
	</li>
	<li>Differentiation of HBV-specific iPSC-CD8+ T cells 
	NOTE: The OP9-DL1/DL4 stromal cells overexpress both Notch ligands DL1 and DL4, and co-culturing iPSCs with the iPSCs can promote Notch signaling-mediated T cell differentiation26.
	<ol>
		<li>Grow s183 TCR gene-transduced iPSCs (s183/iPSCs) in the OP9-DL1-DL4 cell monolayer in &#945;-minimum essential&#160;medium (MEM) media containing 20% fetal bovine serum (FBS)27. Include murine Flt3 ligand (mFlt-3L; final concentration = 5 ng/mL) in the culture.</li>
		<li>On day 0, seed 0.5&#8211;1.0 x 105 S183/iPSCs in a 10 cm culture dish previously grown with OP9-DL1-DL4 cells. Validate that the OP9-DL1-DL4 cells are in a condition of 80%&#8211;90% confluency.</li>
		<li>On day 5, rinse the iPSCs with 10 mL of phosphate-buffered saline (PBS), aspirate off the PBS, add this to 4 mL of 0.25% trypsin, and incubate in a 37 &#176;C incubator for 10 min. Afterward, add a supplementary 8 mL of iPSC media to end trypsin digestion. Accumulate all the digestive solutions containing the cells and centrifuge at 400 x g for 5 min at 15&#8211;30 &#176;C.</li>
		<li>Aspirate the supernatant and resuspend cells in 10 mL of iPSC media. Transfer the cell suspension to a new 10 cm Petri plate and incubate in an incubator for 30 min at 37 &#176;C.</li>
		<li>After 30 min, collect the iPSC media containing the floating cells. Pass the cell suspension through a 70 &#956;m cell strainer and calculate the cell number.</li>
		<li>Seed 5 x 105 cells in the culture dish previously grown OP9-DL1-DL4 cells with a condition of 80%&#8211;90% confluent as described in step 1.3.1. 
		NOTE: For T cell differentiation, each 2&#8211;3 days, the iPSC-derived cells need to re-seed with a fresh layer of the OP9-DL1-DL4 cells.</li>
	</ol>
	</li>
	<li>Evaluation
	<ol>
		<li>Morphological changes of differentiating iPSCs
		<ol>
			<li>Observe cells under a microscope on various days. 
			NOTE: By day 5, colonies have mesoderm-like characteristics, exhibiting a classic spindle-shape morphology resembling human dermal fibroblasts and sustained growth in vitro. By day 8, small round clusters of cells begin to appear.</li>
		</ol>
		</li>
		<li>Analysis of differentiating iPSCs by flow cytometry
		<ol>
			<li>On various days of co-culture, analyze iPSC-derived cells as described previously25 (Figure 1B,C).</li>
		</ol>
		</li>
		<li>Functional analysis of differentiating iPSCs
		<ol>
			<li>On day 28 of co-culture, collect iPSC-CD8+ T cells from cultures through harvesting the floating cells, trypsinize the leftover cells with 0.25% trypsin, re-suspend in 8 mL of iPSC media, centrifuge for 5 min at 400 x g at 15&#8211;30 &#176;C, remove the media, then resuspend the cells in 10 mL of media.</li>
			<li>Keep the re-suspended cells in a fresh 10 cm dish in a 37 &#176;C incubator for 30 min and assemble the floating cells. Then rinse the cells one times with a cold PBS.</li>
			<li>Incubate 3 x 106 T cell-depleted splenocytes (CD4-CD8-) from spleens of H-2 class I knockout, HLA-A2.1-transgenic (HHD) mice with 5 &#181;M s183 peptide (FLLTRILTI) in 200 &#956;L of media at 4 &#176;C for 30 min.</li>
			<li>Produce a mixture of iPSC-CD8+ T cells with splenocytes pulsed with s183 peptide (T cells: splenocytes = 1:4; use 0.75 x 106 T cells). Incubate the mixture of cells at 37 &#176;C in a CO2 incubator for 40 h. During the last 7 h, add 4 &#181;L of diluted brefeldin A into the culture (final concentration of 1,000x, which will be diluted in 1x culture media) to block transport processes during cell activation.</li>
			<li>Stain the cells and perform flow cytometric analysis of intracellular IFN-&#947; as described previously (Figure 2).</li>
		</ol>
		 </li>
	</ol>
	 </li>
</ol>
2. Induction of HBV replication through hydrodynamic delivery of HBV plasmid
NOTE: pAAV/HBV1.2 construct was generated as described previously9. The HBV 1.2 complete DNA is incorporated in the vector pAAV.
<ol>
	<li>Hydrodynamic deliveries of HBV plasmid through the tail vein
	<ol>
		<li>Heat HHD mice using a heat lamp&#160;for 5 min in the cage in order to dilate the tail vein.</li>
		<li>Detain the animal by means of a restrainer, and clean mouse tails with 70% ethanol spray.</li>
		<li>Delivery of plasmid into the liver.&#160;</li>
		<li>Measure the mouse body weight by using a measuring scale.</li>
		<li>Dilute 10 &#956;g of HBV plasmid in the 8% equivalent of body mass PBS (e.g., 1.6 mL for a 20 g mouse). Load diluted plasmid in a 3 mL syringe with a 26 G &#215; 1&#8260;2&#8243; (0.45 &#215; 12 mm) hypodermic needle.</li>
		<li>Locate&#160;one of the two&#160;lateral tail veins&#160;in the middle third of the&#160;tail and position the needle into either lateral vein. Administer the injection containing HBV plasmid through the tail vein within 3 - 5 s.</li>
	</ol>
	</li>
	<li>Quantification of viremia from blood serum of infected mice 
	NOTE: HBV replication occurs from day 3&#8211;35 in the mouse serum. The DNA replication peaks on day 7 and reduces gradually. The HBV DNA is not cleared from the serum until day 35.
	<ol>
		<li>Collection of blood serum from infected mice
		<ol>
			<li>Collect approximately 0.1 mL of blood in a microcentrifuge tube from each mouse on 3, 5, 7, and 10 days post-infection by retro-orbital bleeding in a 1.5 mL microcentrifuge tube, then incubate at room temperature (RT) for 20 min.</li>
			<li>Centrifuge the sample at 6,000 x g for 15 min at 4 &#176;C and collect the serum supernatant after centrifugation.</li>
		</ol>
		</li>
		<li>Purify the DNA from the blood serum using a commercially available DNA extraction kit following the manufacturer&#8217;s recommendations. Briefly, lyse the cells in a silica-based column, perform the washes, and extract DNA by adding 100% ethanol to the elution column and centrifuging at 6000 x g for 1 min. Elute the DNA in 50 &#181;L of RNase-free water.</li>
		<li>Use 100 ng of HBV DNA from the elution for real-time PCR analysis. Use the following primers and probes: forward 5&#39;&#160;TAGGAGGCTGTAGGCATAAATTGG 3&#39;; reverse 5&#39;&#160;GCACAGCTTGGAGGCTTGT 3&#39;; probe 5&#39;&#160;TCACCTCTGCCTAATC 3&#39;.
		<ol>
			<li>Use HBV genome containing plasmid (pAAV/HBV1.2) for standard curve and perform real-time PCR in a total volume of 10&#160;&#956;L (Figure 3).</li>
		</ol>
		</li>
		<li>Set up the PCR reaction in a total volume of 10 &#956;L as shown in Table 1.</li>
		<li>Set up the PCR program in the thermocycler as shown in Table 2. The programmed temperature transition rate is 20 &#176;C/s for denaturation/annealing and 5 &#176;C/s for extension. Measure the fluorescence at the end of the annealing phase for each cycle for real-time PCR monitoring.</li>
	</ol>
	 </li>
</ol>
3. Reduction of HBV replication by ACT of viral Ag-specific iPSC-CD8+ T cells
<ol>
	<li>Adoptive cell transfer (ACT)
	<ol>
		<li>Differentiate s183/iPSCs (1.3.7) upon the OP9-DL1-DL4 stromal cells in the presence of mFlt-3L and mIL-7 for 8 days as described in section 1.3.</li>
		<li>On day 22, collect iPSC-CD8+ T cells from the 10 cm plate with trypsin, then wash and resuspend each 10 cm plate in 10 mL of fresh media. Add the cells to a fresh 10 cm plate and return to the incubator for 30 min as done in section 1.3. After 30 min, collect floating cells.</li>
		<li>Use a 70 &#956;m nylon strainer to pass cells to eliminate cell clusters and count the cell number. Adapt the cells to a concentration of 1.5 x 107 cells/mL in cold PBS solution and use a 70 &#956;m nylon strainer to pass cells to eliminate cell clusters again if needed. Keep cells on ice until the ACT.</li>
		<li>Inject 200 &#956;L cell suspension (3 x 106 cells) into 4&#8211;6 week-old HHD mice through the tail vein.</li>
	</ol>
	</li>
	<li>Induction of HBV replication
	<ol>
		<li>On day 14 after cell transfer, perform the hydrodynamic delivery of HBV plasmid through the tail vein as described in section 2.1.</li>
	</ol>
	</li>
	<li>Virus protein detection from infected liver
	<ol>
		<li>Sacrifice mice on days 3, 5, 7, 14, and 21 post-infection. For euthanasia, in each cage, use 1&#8211;2 L of carbon dioxide (CO2) in the first stage. When the animal develops the&#160;loss of consciousness, gain the CO2 flow rate around 4&#8211;5 L/min. Perform mouse&#160;euthanasia using CO2 inhalation.</li>
		<li>Separate the liver by cutting the surface skin of the peritoneum utilizing scissors and forceps and slightly dragging the liver back to uncover the internal skin lining the peritoneal cavity. Collect and cut liver samples (length x width x height = 0.5 cm&#160;x 0.5&#160;cm&#160;X 0.3&#160;cm) of the infected mice to fit easily into the embedding cassette and block in 10% neutral buffer formalin for 4&#8211;24 h.</li>
		<li>Decalcify the liver samplesusing 2.5 M formic acid; rinse in xylene for 3 min, rinse 2x in 100% ethanol, rinse 2x in 95% ethanol, rinse 2x in deionized (DI) water for 2 min, then decalcify the liver samples in 1 mM ethylenediaminetetraacetic acid (EDTA) correspondingly. Handle at a sub-boiling temperature (90 &#176;C) for 20 min.</li>
		<li>Cool the fixed liver tissues for 30 min. Rinse the tissues with 1x PBS for 4 min and embed the tissues in paraffin. Dehydrate the tissues in a series of increasing&#160;concentrations of ethanol to replace the water, and then immerse in xylene immersion.&#160;Embed the infiltrated tissues into wax blocks. Make evenly vertical and horizontal sectioning for staining. Prepare 4 &#956;m sections with a sliding microtome.</li>
		<li>Pass the sections through the deparaffinization and rehydration using xylene and ethanol, then perform immunofluorescent staining of the sections.</li>
		<li>Stain the sections with 200 &#956;L of HBV surface Ag-specific antibody (1:100 dilution in the blocking solution). Incubate the sections with the antibody for 2 h at RT in a 75%&#8211;100% humidified chamber, and wash 5x in 1x PBS for 5 min.</li>
		<li>Use an anti-fade reagent containing 4&#39;,6-diamidino-2-phenylindole (DAPI) for nuclear staining to counterstain the slides. Add the coverslip with about 300 &#181;L of the diluted DAPI staining solution (300 nM in 1x PBS) and validate the entire coverslip covered. Keep the slides in the dark at 4 &#176;C until inspection under a fluorescent microscope.</li>
	</ol>
	</li>
	<li>Inflammatory cell infiltration in infected mice
	<ol>
		<li>Sacrifice mice as described in step 3.3.1. Collect the liver and make sections as described in step 3.3.4.</li>
		<li>Stain the section with hematoxylin and eosin (H&#38;E) to evaluate infiltration of inflammatory cells into the liver.</li>
		<li>Store slides in the dark at 4 &#176;C until further analysis under a fluorescent microscope.</li>
		<li>Visualize slides under a fluorescence microscope to detect the infiltration of inflammatory cells into the liver (Figure 4).</li>
	</ol>
	</li>
	<li>HBV DNA detection of infected liver
	<ol>
		<li>Isolation of viral DNA.</li>
		<li>Euthanize mice and collect the liver samples according to section 3.3.</li>
		<li>Lyse the liver tissues in Nonindet P-40 (NP-40) lysis buffer (50 mM Tris-HCL, 1 mM EDTA, 1% NP-40) containing a protease inhibitor cocktail.</li>
		<li>Briefly centrifuge at 16,000 x g to remove the nuclei and cell debris.</li>
		<li>Incubate the cytoplasmic lysate with micrococcal nuclease (nuclease S7; 150 units/mL) and CaCl2 (5 mM) at 37 &#176;C for 90 min to degrade the nucleic acid outside nucleocapsids (NCs).</li>
		<li>Inactivate the nuclease S7 by the addition of 10 mM EDTA.</li>
		<li>Precipitate the nucleocapsids with polyethylene glycol (PEG), disrupt by 0.5% sodium dodecyl sulfate (SDS), and digest with 0.6 mg/mL proteinase K (PK) at 37 &#176;C for 1 h.</li>
		<li>Recover the viral nucleic acids by phenol chloroform extraction and ethanol precipitation.</li>
		<li>Resolve the extracted viral DNA on a 1.2% agarose gel and detect by standard Southern blot analysis using a32&#160;P-labeled HBV DNA probe.</li>
	</ol>
	 </li>
</ol>

<ol>
	<li>Scaglione, S. J., Lok, A. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Effectiveness+of+hepatitis+B+treatment+in+clinical+practice.">Effectiveness of hepatitis B treatment in clinical practice.</a> Gastroenterology. 142 (6), 1360-1368 (2012).</li><li>Osiowy, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=From+infancy+and+beyond...+ensuring+a+lifetime+of+hepatitis+B+virus+(HBV)+vaccine-induced+immunity.">From infancy and beyond... ensuring a lifetime of hepatitis B virus (HBV) vaccine-induced immunity.</a> Human Vaccines &amp; Immunotherapeutics. 14 (8), 2093-2097 (2018).</li><li>Gish, R. G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Loss+of+HBsAg+antigen+during+treatment+with+entecavir+or+lamivudine+in+nucleoside-naive+HBeAg-positive+patients+with+chronic+hepatitis+B.">Loss of HBsAg antigen during treatment with entecavir or lamivudine in nucleoside-naive HBeAg-positive patients with chronic hepatitis B.</a> Journal of Viral Hepatitis. 17 (1), 16-22 (2010).</li><li>Kurktschiev, P. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Dysfunctional+CD8++T+cells+in+hepatitis+B+and+C+are+characterized+by+a+lack+of+antigen-specific+T-bet+induction.">Dysfunctional CD8+ T cells in hepatitis B and C are characterized by a lack of antigen-specific T-bet induction.</a> Journal of Experimental Medicine. 211 (10), 2047-2059 (2014).</li><li>Fisicaro, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Antiviral+intrahepatic+T-cell+responses+can+be+restored+by+blocking+programmed+death-1+pathway+in+chronic+hepatitis+B.">Antiviral intrahepatic T-cell responses can be restored by blocking programmed death-1 pathway in chronic hepatitis B.</a> Gastroenterology. 138 (2), 682-693 (2010).</li><li>Schurich, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+third+signal+cytokine+IL-12+rescues+the+anti-viral+function+of+exhausted+HBV-specific+CD8+T+cells.">The third signal cytokine IL-12 rescues the anti-viral function of exhausted HBV-specific CD8 T cells.</a> PLoS Pathogens. 9 (3), 1003208 (2013).</li><li>Gehring, A. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Engineering+virus-specific+T+cells+that+target+HBV+infected+hepatocytes+and+hepatocellular+carcinoma+cell+lines.">Engineering virus-specific T cells that target HBV infected hepatocytes and hepatocellular carcinoma cell lines.</a> Journal of Hepatology. 55 (1), 103-110 (2011).</li><li>Xia, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Interferon-gamma+and+Tumor+Necrosis+Factor-alpha+Produced+by+T+Cells+Reduce+the+HBV+Persistence+Form,+cccDNA,+Without+Cytolysis.">Interferon-gamma and Tumor Necrosis Factor-alpha Produced by T Cells Reduce the HBV Persistence Form, cccDNA, Without Cytolysis.</a> Gastroenterology. 150 (1), 194-205 (2016).</li><li>Huang, L. R., Wu, H. L., Chen, P. J., Chen, D. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+immunocompetent+mouse+model+for+the+tolerance+of+human+chronic+hepatitis+B+virus+infection.">An immunocompetent mouse model for the tolerance of human chronic hepatitis B virus infection.</a> Proceedings of the National Academy of Sciences U.S.A. 103 (47), 17862-17867 (2006).</li><li>Wong, P., Pamer, E. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=CD8+T+cell+responses+to+infectious+pathogens.">CD8 T cell responses to infectious pathogens.</a> Annual Review of Immunology. 21, 29-70 (2003).</li><li>Murray, J. M., Wieland, S. F., Purcell, R. H., Chisari, F. V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Dynamics+of+hepatitis+B+virus+clearance+in+chimpanzees.">Dynamics of hepatitis B virus clearance in chimpanzees.</a> Proceedings of the National Academy of Sciences USA. 102 (49), 17780-17785 (2005).</li><li>Hinrichs, C. S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Adoptively+transferred+effector+cells+derived+from+naive+rather+than+central+memory+CD8++T+cells+mediate+superior+antitumor+immunity.">Adoptively transferred effector cells derived from naive rather than central memory CD8+ T cells mediate superior antitumor immunity.</a> Proceedings of the National Academy of Sciences U.S.A. 106 (41), 17469-17474 (2009).</li><li>Hinrichs, C. S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Human+effector+CD8++T+cells+derived+from+naive+rather+than+memory+subsets+possess+superior+traits+for+adoptive+immunotherapy.">Human effector CD8+ T cells derived from naive rather than memory subsets possess superior traits for adoptive immunotherapy.</a> Blood. 117 (3), 808-814 (2011).</li><li>Kerkar, S. P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genetic+engineering+of+murine+CD8++and+CD4++T+cells+for+preclinical+adoptive+immunotherapy+studies.">Genetic engineering of murine CD8+ and CD4+ T cells for preclinical adoptive immunotherapy studies.</a> Journal of Immunotherapy. 34 (4), 343-352 (2011).</li><li>Kuball, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Facilitating+matched+pairing+and+expression+of+TCR+chains+introduced+into+human+T+cells.">Facilitating matched pairing and expression of TCR chains introduced into human T cells.</a> Blood. 109 (6), 2331-2338 (2007).</li><li>van Loenen, M. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mixed+T+cell+receptor+dimers+harbor+potentially+harmful+neoreactivity.">Mixed T cell receptor dimers harbor potentially harmful neoreactivity.</a> Proceedings of the National Academy of Sciences USA. 107 (24), 10972-10977 (2010).</li><li>Cameron, B. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Identification+of+a+Titin-derived+HLA-A1-presented+peptide+as+a+cross-reactive+target+for+engineered+MAGE+A3-directed+T+cells.">Identification of a Titin-derived HLA-A1-presented peptide as a cross-reactive target for engineered MAGE A3-directed T cells.</a> Science Translational Medicine. 5 (197), (2013).</li><li>Fedorov, V. D., Themeli, M., Sadelain, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=PD-1-+and+CTLA-4-based+inhibitory+chimeric+antigen+receptors+(iCARs)+divert+off-target+immunotherapy+responses.">PD-1- and CTLA-4-based inhibitory chimeric antigen receptors (iCARs) divert off-target immunotherapy responses.</a> Science Translational Medicine. 5 (215), (2013).</li><li>Maus, M. V., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=T+cells+expressing+chimeric+antigen+receptors+can+cause+anaphylaxis+in+humans.">T cells expressing chimeric antigen receptors can cause anaphylaxis in humans.</a> Cancer Immunolology Research. 1 (1), 26-31 (2013).</li><li>Haque, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Programming+of+regulatory+T+cells+from+pluripotent+stem+cells+and+prevention+of+autoimmunity.">Programming of regulatory T cells from pluripotent stem cells and prevention of autoimmunity.</a> Journal of Immunology. 189 (3), 1228-1236 (2012).</li><li>Vizcardo, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Regeneration+of+human+tumor+antigen-specific+T+cells+from+iPSCs+derived+from+mature+CD8(+)+T+cells.">Regeneration of human tumor antigen-specific T cells from iPSCs derived from mature CD8(+) T cells.</a> Cell Stem Cell. 12 (1), 31-36 (2013).</li><li>Nishimura, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Generation+of+rejuvenated+antigen-specific+T+cells+by+reprogramming+to+pluripotency+and+redifferentiation.">Generation of rejuvenated antigen-specific T cells by reprogramming to pluripotency and redifferentiation.</a> Cell Stem Cell. 12 (1), 114-126 (2013).</li><li>Lei, F., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=In+vivo+programming+of+tumor+antigen-specific+T+lymphocytes+from+pluripotent+stem+cells+to+promote+cancer+immunosurveillance.">In vivo programming of tumor antigen-specific T lymphocytes from pluripotent stem cells to promote cancer immunosurveillance.</a> Cancer Research. 71 (14), 4742-4747 (2011).</li><li>Kim, J. B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Oct4-induced+pluripotency+in+adult+neural+stem+cells.">Oct4-induced pluripotency in adult neural stem cells.</a> Cell. 136 (3), 411-419 (2009).</li><li>Lei, F., Haque, R., Xiong, X., Song, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Directed+differentiation+of+induced+pluripotent+stem+cells+towards+T+lymphocytes.">Directed differentiation of induced pluripotent stem cells towards T lymphocytes.</a> Journal of Visualized Experiments. (63), e3986 (2012).</li><li>Lei, F., Haque, M., Sandhu, P., Ravi, S., Ni, Y., Zheng, S., Fang, D., Jia, H., Yang, J. M., Song, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Development+and+characterization+of+naive+single-type+tumor+antigen-specific+CD8++T+lymphocytes+from+murine+pluripotent+stem+cells.">Development and characterization of naive single-type tumor antigen-specific CD8+ T lymphocytes from murine pluripotent stem cells.</a> OncoImmunology. 6, (2017).</li><li>Haque, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Melanoma+Immunotherapy+in+Mice+Using+Genetically+Engineered+Pluripotent+Stem+Cells.">Melanoma Immunotherapy in Mice Using Genetically Engineered Pluripotent Stem Cells.</a> Cell Transplantation. 25 (5), 811-827 (2016).</li><li>Tan, A. T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Use+of+Expression+Profiles+of+HBV+DNA+Integrated+Into+Genomes+of+Hepatocellular+Carcinoma+Cells+to+Select+T+Cells+for+Immunotherapy.">Use of Expression Profiles of HBV DNA Integrated Into Genomes of Hepatocellular Carcinoma Cells to Select T Cells for Immunotherapy.</a> Gastroenterology. , (2019).</li><li>Wu, L. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Ly6C(+)+Monocytes+and+Kupffer+Cells+Orchestrate+Liver+Immune+Responses+Against+Hepatitis+B+Virus+in+Mice.">Ly6C(+) Monocytes and Kupffer Cells Orchestrate Liver Immune Responses Against Hepatitis B Virus in Mice.</a> Hepatology. , (2019).</li><li>Haque, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Stem+cell-derived+tissue-associated+regulatory+T+cells+suppress+the+activity+of+pathogenic+cells+in+autoimmune+diabetes.">Stem cell-derived tissue-associated regulatory T cells suppress the activity of pathogenic cells in autoimmune diabetes.</a> Journal of Clinical Investigation Insights. , (2019).</li><li>Chisari, F. V., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Structural+and+pathological+effects+of+synthesis+of+hepatitis+B+virus+large+envelope+polypeptide+in+transgenic+mice.">Structural and pathological effects of synthesis of hepatitis B virus large envelope polypeptide in transgenic mice.</a> Proceedings of the National Academy of Sciences USA. 84 (19), 6909-6913 (1987).</li><li>Wirth, S., Guidotti, L. G., Ando, K., Schlicht, H. J., Chisari, F. V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Breaking+tolerance+leads+to+autoantibody+production+but+not+autoimmune+liver+disease+in+hepatitis+B+virus+envelope+transgenic+mice.">Breaking tolerance leads to autoantibody production but not autoimmune liver disease in hepatitis B virus envelope transgenic mice.</a> Journal of Immunology. 154 (5), 2504-2515 (1995).</li></ol>

The authors have nothing to disclose.

This protocol presents a method to generate the viral Ag-specific iPSC-CTLs for use as ACT to suppress HBV replication in a murine model. In chronic HBV infection, the viral genome forms a stable mini chromosome, the covalently closed circular DNA (cccDNA) that can persist throughout the lifespan of the hepatocyte. Targeting the clearance of the viral mini chromosome may result in a cure of chronic HBV infection. Current antiviral therapy targets the virus reverse transcriptase but rarely establishes immunological contro...

Following acute infection, the adaptive immune system (i.e., humoral and cellular immunity) controls the bulk of acute HBV-related hepatitis. Still, a number of people in the HBV-endemic regions cannot eliminate the viruses and subsequently convert as chronic individuals. More than 25% of chronic patients (&#62;250 million people) worldwide develop progressive liver disease, resulting in liver cirrhosis and/or hepatocellular carcinoma (HCC)1. As a result, eradication of insistently infected cells remains a general healthiness problem, even though there is an available vaccine2 and numerous antiviral medicines are under development. Standard treatment for HBV infection includes IFN-&#945;, nucleoside, and nucleotide analogues. These agents have direct antiviral activity and immune modulatory capacities. Nevertheless, seroconversion of HBe antigen (Ag)+ carriers with anti-HBe antibody (Ab) and loss of serum HBV deoxyribonucleic acid&#160;(DNA) appear individually in approximately 20% of treated patients, and whole immunological control of the virus verified by the deprivation of the HBsAg is no more than 5%3. Moreover, the response to treatment is often not durable. Prophylactic vaccination with recombinant HBs Ag is highly effective in preventing infection, but therapeutic HBs Ag vaccination is not effective. Clearly, T cell-mediated immune responses play a critical role in controlling HBV infection and liver impairment; however, in chronic hepatitis patients, HBV-reactive T cells are often deleted, dysfunctional, or convert exhausted4,5,6. Consequently, in individuals with persistent HBV infection, no attempts to reinstate HBV-specific immunity (i.e., T cell-based immunity) by means of anti-viral remedy, immuno-modulatory cytokines, or curative immunization have achieved success.
Adoptive cell transfer (ACT) of HBV Ag-specific T cells is an efficient treatment directed to eventually eradicate remaining hepatocytes wih HBV7,8. ACT of HBV-specific CTLs into HBV-infected mice has been shown to cause transient, mild hepatitis, and a dramatic drop in HBV ribonucleic acid (RNA) transcripts in hepatocytes. In these studies, CTLs did not inhibit transcription of HBV genes but enhanced the degradation of HBV transcripts9. HBV-specific CTLs are important to prevent viral infection and mediate the clearance of HBV10,11. For ACT-based remedies, in vitro expansion of HBV-specific T cells with a high reactivity for in vivo resettlement has been suggested to be an ideal method12,13,14; nevertheless, the present approaches are restricted regarding their abilities to generate, separate, and grow appropriate quantities and qualities of HBV-specific T cells from patients for the potential therapies.
Although clinical trials present safety, practicability, and prospective therapeutic activity of cell-based treatments by means of engineered T cells that are specific to HBV virus-infected hepatocytes, there are worries about the unfavorable effects occurring from autoimmune responses because of cross-reactivity from mispairing T cell receptor (TCR)15,16, off-target Ag recognition by non-specific TCR17 and on-target off-toxicity by a chimeric Ag receptor (CAR)18,19 with healthy tissues. Currently, the genetically modified T cells, which only have short-term persistence in vivo, are usually intermediate or later effector T cells. To date, pluripotent stem cells (PSCs) are the only source available to generate high numbers of naive single-type Ag-specific T cells20,21,22,23. Induced PSCs (iPSCs) are simply converted from a patient&#8217;s somatic cells through the use of gene transduction of several transcription factors. As a result, the iPSCs have similar characteristics as those of embryonic stem cells (ESCs)24. Owing to the flexibility and possibility for the infinite ability to self-renew, in addition to tissue replacement, iPSC-based treatments may be widely applied in regenerative medicine. Furthermore, the regiments underlying iPSCs may substantially improve current cell-based therapies.
The overall goal of this method is to generate a large amount of HBV-specific CTLs from iPSCs (i.e., iPSC-CTLs) for ACT-based immunotherapy. The advantages over alternative techniques are that HBV-specific iPSC-CTLs have a single-type TCR and naive phenotype, which results in more memory T cell development after the ACT. It is demonstrated that the ACT of HBV-specific iPSC-CTLs increases the migration of functional CD8+ T cells in the liver and reduces HBV replication in both the livers and blood of administered mice. This method reveals a potential use of viral Ag-specific iPSC-CTLs for HBV immunotherapy and may be adapted to generate other viral Ag-specific iPSC-T cells for viral immunotherapy.

<table>
	<tbody>
		<tr>
			<td>HHD mice</td>
			<td>Institut Pasteur, Paris, France</td>
			<td></td>
			<td>H-2 class I knockout, HLA-A2.1-transgenic (HHD) mice</td>
		</tr>
		<tr>
			<td>iPS-MEF-Ng-20D-17</td>
			<td>RIKEN Cell Bank</td>
			<td>APS0001</td>
			<td></td>
		</tr>
		<tr>
			<td>SNL76/7</td>
			<td>ATCC</td>
			<td>SCRC-1049</td>
			<td></td>
		</tr>
		<tr>
			<td>OP9</td>
			<td>ATCC</td>
			<td>CRL-2749</td>
			<td></td>
		</tr>
		<tr>
			<td>pAAV/HBV1.2 plasmid</td>
			<td>Dr. Dr. Pei-Jer Chen (National Taiwan University Hospital, Taiwan)</td>
			<td></td>
			<td>HBV DNA construct</td>
		</tr>
		<tr>
			<td>HBs183-91(s183) (FLLTRILTI)-specific TCR genes</td>
			<td>Dr. Adam J Gehring (Toronto General Hospital Research Institute, Toronto, Canada)</td>
			<td></td>
			<td>FLLTRILTI-specific A2-restricted human-murine hybrid TCR genes (V&#945;34 and V&#946;28)</td>
		</tr>
		<tr>
			<td>OVA257&#8211;264-specific TCR genes</td>
			<td>Dr. Dario A. Vignali (University of Pittsburgh, PA)</td>
			<td></td>
			<td>SIINFEKL-specific H-2Kb-restricted TCR genes</td>
		</tr>
		<tr>
			<td>Anti-CD3 (17A2) antibody</td>
			<td>Biolegend</td>
			<td>100236</td>
			<td></td>
		</tr>
		<tr>
			<td>Anti-CD44 (IM7) antibody</td>
			<td>BD Pharmingen</td>
			<td>103012</td>
			<td></td>
		</tr>
		<tr>
			<td>Anti-CD4 (GK1.5) antibody</td>
			<td>Biolegend</td>
			<td>100408</td>
			<td></td>
		</tr>
		<tr>
			<td>Anti-CD8 (53-6.7) antibody</td>
			<td>Biolegend</td>
			<td>100732</td>
			<td></td>
		</tr>
		<tr>
			<td>Anti-IFN-&#947; (XMG1.2) antibody</td>
			<td>Biolegend</td>
			<td>505810</td>
			<td></td>
		</tr>
		<tr>
			<td>Anti-TNF-a (MP6-XT22) antibody</td>
			<td>Biolegend</td>
			<td>506306</td>
			<td></td>
		</tr>
		<tr>
			<td>&#945;-MEM</td>
			<td>Invitrogen</td>
			<td>A10490-01</td>
			<td></td>
		</tr>
		<tr>
			<td>Anti-HBs antibody</td>
			<td>Thermo Fisher</td>
			<td>MA5-13059</td>
			<td></td>
		</tr>
		<tr>
			<td>ACK Lysis buffer</td>
			<td>Lonza</td>
			<td>10-548E</td>
			<td></td>
		</tr>
		<tr>
			<td>Brefeldin A</td>
			<td>Sigma</td>
			<td>B7651</td>
			<td></td>
		</tr>
		<tr>
			<td>DMEM</td>
			<td>Invitrogen</td>
			<td>ABCD1234</td>
			<td></td>
		</tr>
		<tr>
			<td>FBS</td>
			<td>Hyclone</td>
			<td>SH3007.01</td>
			<td></td>
		</tr>
		<tr>
			<td>FACSAria Fusion cell sorter</td>
			<td>BD</td>
			<td>656700</td>
			<td></td>
		</tr>
		<tr>
			<td>Gelatin</td>
			<td>MilliporeSigma</td>
			<td>G9391</td>
			<td></td>
		</tr>
		<tr>
			<td>GeneJammer</td>
			<td>Agilent</td>
			<td>204130</td>
			<td></td>
		</tr>
		<tr>
			<td>HLA-A201-HBs183-91-PE pentamer</td>
			<td>Proimmune</td>
			<td>F027-4A - 27</td>
			<td></td>
		</tr>
		<tr>
			<td>HRP Anti-Mouse Secondary Antibody</td>
			<td>Invitrogen</td>
			<td>A27025</td>
			<td></td>
		</tr>
		<tr>
			<td>mFlt-3L</td>
			<td>Peprotech</td>
			<td>250-31L</td>
			<td></td>
		</tr>
		<tr>
			<td>mIL-7</td>
			<td>Peprotech</td>
			<td>217-17</td>
			<td></td>
		</tr>
		<tr>
			<td>Nuclease S7</td>
			<td>Roche</td>
			<td>10107921001</td>
			<td></td>
		</tr>
		<tr>
			<td>Paraformaldehyde</td>
			<td>MilliporeSigma</td>
			<td>P6148-500G</td>
			<td>Caution: Allergenic, Carcenogenic, Toxic</td>
		</tr>
		<tr>
			<td>Permeabilization buffer</td>
			<td>Biolegend</td>
			<td>421002</td>
			<td></td>
		</tr>
		<tr>
			<td>Polybrene</td>
			<td>MilliporeSigma</td>
			<td>107689</td>
			<td></td>
		</tr>
		<tr>
			<td>ProLong&#8482; Gold Antifade Mountant with DAPI</td>
			<td>Invitrogen</td>
			<td>P36931</td>
			<td></td>
		</tr>
		<tr>
			<td>QIAamp MinElute Virus Spin Kit</td>
			<td>Qiagen</td>
			<td>57704</td>
			<td></td>
		</tr>
	</tbody>
</table>

stem cell-derived viral ag-specific t lymphocytes suppress hbv replication in mice

Hepatitis B virus (HBV) infection is a global health issue. With over 350 million people affected worldwide, HBV infection remains the leading cause of liver cancer. This is a major concern, especially in developing countries. Failure of the immune system to mount an effective response against HBV leads to chronic infection. Although HBV vaccine is present and novel antiviral medicines are being created, eradication of virus-reservoir cells remains a major health topic. Described here is a method for the generation of viral antigen (Ag) -specific CD8+ cytotoxic T lymphocytes (CTLs) derived from induced pluripotent stem cells (iPSCs) (i.e., iPSC-CTLs), which have the ability to suppress HBV replication. HBV replication is efficiently induced in mice through hydrodynamic injection of an HBV expression plasmid, pAAV/HBV1.2, into the liver. Then, HBV surface Ag-specific mouse iPSC-CTLs are adoptively transferred, which greatly suppresses HBV replication in the liver and blood as well as prevents HBV surface Ag expression in hepatocytes. This method demonstrates HBV replication in mice after hydrodynamic injection and that stem cell-derived viral Ag-specific CTLs can suppress HBV replication. This protocol provides a useful method for HBV immunotherapy.

As shown here, HBV viral Ag-specific iPSC-CD8+ T cells are generated by an in vitro culture system. After ACT of these viral Ag-specific iPSC-CD8+ T cells substantially suppress HBV replication in a murine model (Supplemental File 1). Mouse iPSC are transduced with the MIDR retroviral construct encoding a human-mouse hybrid HBV TCR gene (HBs183-191-specific, s183), then the gene-transduced iPSCs are co-cultured with OP9-DL1/DL4 cells expressing Notch ligands (both DL1 and...

Watch this Scientific Journal Video about Stem Cell-Derived Viral Ag-Specific T Lymphocytes Suppress HBV Replication in Mice at JoVE.com

Stem Cell-Derived Viral Ag-Specific T Lymphocytes Suppress HBV Replication in Mice

Presented here is a protocol for the effective suppression of hepatitis B virus (HBV) replication in mice by utilizing adoptive cell transfer (ACT) of stem cell-derived viral antigen (Ag)-specific T lymphocytes. This procedure may be adapted for potential ACT-based immunotherapy of HBV infection.

Hepatitis B virus (HBV) infection is a global health issue. With over 350 million people affected worldwide, HBV infection remains the leading cause of ...

stem-cell-derived-viral-ag-specific-t-lymphocytes-suppress-hbv

Research

JoVE Journal

Immunology and Infection

6.5K Views.  Texas A&M University Health Science Center. Presented here is a protocol for the effective suppression of hepatitis B virus (HBV) replication in mice by utilizing adoptive cell transfer (ACT) of stem cell-derived viral antigen (Ag)-specific T lymphocytes. This procedure may be adapted for potential ACT-based immunotherapy of HBV infection.

Video: Stem Cell-Derived Viral Ag-Specific T Lymphocytes Suppress HBV Replication in Mice

Retroviral Transduction of T-cell Receptors in Mouse T-cells

T-cell receptors (TCRs) play a central role in the immune system. TCRs on T-cell surfaces can specifically recognize peptide antigens presented by antigen presenting cells (APCs)1. This recognition leads to the activation of T-cells and a series of functional outcomes (e.g. cytokine production, killing of the target cells). Understanding the functional role of TCRs is critical to harness the power of the immune system to treat a variety of immunology related diseases (e.g. cancer or autoimmunity).
It is convenient to study TCRs in mouse models, which can be accomplished in several ways. Making TCR transgenic mouse models is costly and time-consuming and currently there are only a limited number of them available2-4. Alternatively, mice with antigen-specific T-cells can be generated by bone marrow chimera. This method also takes several weeks and requires expertise5. Retroviral transduction of TCRs into in vitro activated mouse T-cells is a quick and relatively easy method to obtain T-cells of desired peptide-MHC specificity. Antigen-specific T-cells can be generated in one week and used in any downstream applications. Studying transduced T-cells also has direct application to human immunotherapy, as adoptive transfer of human T-cells transduced with antigen-specific TCRs is an emerging strategy for cancer treatment6.
Here we present a protocol to retrovirally transduce TCRs into in vitro activated mouse T-cells. Both human and mouse TCR genes can be used. Retroviruses carrying specific TCR genes are generated and used to infect mouse T-cells activated with anti-CD3 and anti-CD28 antibodies. After in vitro expansion, transduced T-cells are analyzed by flow cytometry.

We present a protocol to produce antigen-specific mouse T-cells using retroviral transduction

T-cell receptors (TCRs) play a central role in the immune system. TCRs on T-cell surfaces can specifically recognize peptide antigens presented by antigen ...

Methods to Assess Beta Cell Death Mediated by Cytotoxic T Lymphocytes

Type 1 diabetes (T1D) is a T cell mediated autoimmune disease. During the pathogenesis, patients become progressively more insulinopenic as 
insulin production is lost, presumably this results from the destruction of pancreatic beta cells by T cells. Understanding the mechanisms of beta cell death during 
the development of T1D will provide insights to generate an effective cure for this disease. Cell-mediated lymphocytotoxicity (CML) assays have historically used the 
radionuclide Chromium 51 (51Cr) to label target cells. These targets are then exposed to effector cells and the release of 51Cr from target 
cells is read as an indication of lymphocyte-mediated cell death. Inhibitors of cell death result in decreased release of 51Cr.
 As effector cells, we used an activated autoreactive clonal population of CD8+ Cytotoxic T lymphocytes (CTL) isolated from a mouse stock transgenic for both the alpha and beta chains of the AI4 T cell receptor (TCR). Activated AI4 T cells were co-cultured with 51Cr labeled target NIT cells for 16 hours, release of 51Cr was recorded to calculate specific lysis 
Mitochondria participate in many important physiological events, such as energy production, regulation of signaling transduction, and apoptosis. The study of beta cell mitochondrial functional changes during the development of T1D is a novel area of research. Using the mitochondrial membrane potential dye Tetramethyl Rhodamine Methyl Ester (TMRM) and confocal microscopic live cell imaging, we monitored mitochondrial membrane potential over time in the beta cell line NIT-1. For imaging studies, effector AI4 T cells were labeled with the fluorescent nuclear staining dye Picogreen. NIT-1 cells and T cells were co-cultured in chambered coverglass and mounted on the microscope stage equipped with a live cell chamber, controlled at 37&deg;C, with 5% CO2, and humidified. During these experiments images were taken of each cluster every 3 minutes for 400 minutes.
Over a course of 400 minutes, we observed the dissipation of mitochondrial membrane potential in NIT-1 cell clusters where AI4 T cells were attached. In the simultaneous control experiment where NIT-1 cells were co-cultured with MHC mis-matched human lymphocyte Jurkat cells, mitochondrial membrane potential remained intact. This technique can be used to observe real-time changes in mitochondrial membrane potential in cells under attack of cytotoxic lymphocytes, cytokines, or other cytotoxic reagents.

Cell-mediated lymphocytotoxicity (CML) assays can be used to test autoreactive responses and study mechanisms of cell death in vitro. However, using live-cell confocal microscopic imaging techniques with fluorescent dyes, the type and kinetics of cell death as well as the pathways utilized can be studied in greater detail.

Type 1 diabetes (T1D) is a T cell mediated autoimmune disease.  During the pathogenesis, patients become progressively more insulinopenic as 
insulin ...

Generation of Multivirus-specific T Cells to Prevent/treat Viral Infections after Allogeneic Hematopoietic Stem Cell Transplant

Viral infections cause morbidity and mortality in allogeneic hematopoietic stem cell transplant (HSCT) recipients. We and others have successfully generated and infused T-cells specific for Epstein Barr virus (EBV), cytomegalovirus (CMV) and Adenovirus (Adv) using monocytes and EBV-transformed lymphoblastoid cell (EBV-LCL) gene-modified with an adenovirus vector as antigen presenting cells (APCs). As few as 2x105/kg trivirus-specific cytotoxic T lymphocytes (CTL) proliferated by several logs after infusion and appeared to prevent and treat even severe viral disease resistant to other available therapies. The broader implementation of this encouraging approach is limited by high production costs, complexity of manufacture and the prolonged time (4-6 weeks for EBV-LCL generation, and 4-8 weeks for CTL manufacture &#x2013; total 10-14 weeks) for preparation. To overcome these limitations we have developed a new, GMP-compliant CTL production protocol. First, in place of adenovectors to stimulate T-cells we use dendritic cells (DCs) nucleofected with DNA plasmids encoding LMP2, EBNA1 and BZLF1 (EBV), Hexon and Penton (Adv), and pp65 and IE1 (CMV) as antigen-presenting cells. These APCs reactivate T cells specific for all the stimulating antigens. Second, culture of activated T-cells in the presence of IL-4 (1,000U/ml) and IL-7 (10ng/ml) increases and sustains the repertoire and frequency of specific T cells in our lines. Third, we have used a new, gas permeable culture device (G-Rex) that promotes the expansion and survival of large cell numbers after a single stimulation, thus removing the requirement for EBV-LCLs and reducing technician intervention. By implementing these changes we can now produce multispecific CTL targeting EBV, CMV, and Adv at a cost per 106 cells that is reduced by &gt;90%, and in just 10 days rather than 10 weeks using an approach that may be extended to additional protective viral antigens. Our FDA-approved approach should be of value for prophylactic and treatment applications for high risk allogeneic HSCT recipients.

A rapid, simple and cost-effective protocol for the generation of donor-derived multivirus-specific CTLs (rCTL) for infusion to allogeneic hematopoietic stem cell transplant (HSCT) recipients at risk of developing CMV, Adv or EBV infections. This manufacturing process is GMP-compliant and should ensure the broader implementation of T-cell immunotherapy beyond specialized centers.

Viral infections cause morbidity and mortality in allogeneic hematopoietic stem cell transplant (HSCT) recipients. We and others have successfully ...

Expanding Cytotoxic T Lymphocytes from Umbilical Cord Blood that Target Cytomegalovirus, Epstein-Barr Virus, and Adenovirus

Virus infections after stem cell transplantation are among the most common causes of death, especially after cord blood (CB) transplantation (CBT) where the CB does not contain appreciable numbers of virus-experienced T cells which can protect the recipient from infection.1-4 We and others have shown that virus-specific CTL generated from seropositive donors and infused to the recipient are safe and protective.5-8 However, until recently, virus-specific T cells could not be generated from cord blood, likely due to the absence of virus-specific memory T cells. 
In an effort to better mimic the in vivo priming conditions of na&iuml;ve T cells, we established a method that used CB-derived dendritic cells (DC) transduced with an adenoviral vector (Ad5f35pp65) containing the immunodominant CMV antigen pp65, hence driving T cell specificity towards CMV and adenovirus.9 At initiation, we use these matured DCs as well as CB-derived T cells in the presence of the cytokines IL-7, IL-12, and IL-15.10 At the second stimulation we used EBV-transformed B cells, or EBV-LCL, which express both latent and lytic EBV antigens. Ad5f35pp65-transduced EBV-LCL are used to stimulate the T cells in the presence of IL-15 at the second stimulation. Subsequent stimulations use Ad5f35pp65-transduced EBV-LCL and IL-2. 
From 50x106 CB mononuclear cells we are able to generate upwards of 150 x 106 virus-specific T cells that lyse antigen-pulsed targets and release cytokines in response to antigenic stimulation.11 These cells were manufactured in a GMP-compliant manner using only the 20% fraction of a fractionated cord blood unit and have been translated for clinical use.

Here we describe the first good manufacturing practice (GMP)-compliant method of producing virus-specific cytotoxic T lymphocytes (CTL) from umbilical cord blood, a source of predominantly na&#238;ve T cells.

Virus infections after stem cell transplantation are among the most common causes of death, especially after cord blood (CB) transplantation (CBT) where ...

Directed Differentiation of Induced Pluripotent Stem Cells towards T Lymphocytes

Adoptive cell transfer (ACT) of antigen-specific CD8+ cytotoxic T lymphocytes (CTLs) is a promising treatment for a variety of malignancies 1. CTLs can recognize malignant cells by interacting tumor antigens with the T cell receptors (TCR), and release cytotoxins as well as cytokines to kill malignant cells. It is known that less-differentiated and central-memory-like (termed highly reactive) CTLs are the optimal population for ACT-based immunotherapy, because these CTLs have a high proliferative potential, are less prone to apoptosis than more differentiated cells and have a higher ability to respond to homeostatic cytokines 2-7. However, due to difficulties in obtaining a high number of such CTLs from patients, there is an urgent need to find a new approach to generate highly reactive Ag-specific CTLs for successful ACT-based therapies.
TCR transduction of the self-renewable stem cells for immune reconstitution has a therapeutic potential for the treatment of diseases 8-10. However, the approach to obtain embryonic stem cells (ESCs) from patients is not feasible. Although the use of hematopoietic stem cells (HSCs) for therapeutic purposes has been widely applied in clinic 11-13, HSCs have reduced differentiation and proliferative capacities, and HSCs are difficult to expand in in vitro cell culture 14-16. Recent iPS cell technology and the development of an in vitro system for gene delivery are capable of generating iPS cells from patients without any surgical approach. In addition, like ESCs, iPS cells possess indefinite proliferative capacity in vitro, and have been shown to differentiate into hematopoietic cells. Thus, iPS cells have greater potential to be used in ACT-based immunotherapy compared to ESCs or HSCs.
Here, we present methods for the generation of T lymphocytes from iPS cells in vitro, and in vivo programming of antigen-specific CTLs from iPS cells for promoting cancer immune surveillance. Stimulation in vitro with a Notch ligand drives T cell differentiation from iPS cells, and TCR gene transduction results in iPS cells differentiating into antigen-specific T cells in vivo, which prevents tumor growth. Thus, we demonstrate antigen-specific T cell differentiation from iPS cells. Our studies provide a potentially more efficient approach for generating antigen-specific CTLs for ACT-based therapies and facilitate the development of therapeutic strategies for diseases.

Generation of T lymphocytes from induced pluripotent stem (iPS) cells gives an alternative approach of using embryonic stem cells for T cell-based immunotherapy. The method shows that by utilizing either in vitro or in vivo induction system, iPS cells are able to differentiate into both conventional and antigen-specific T lymphocytes.

Adoptive cell transfer (ACT) of antigen-specific CD8+  cytotoxic T lymphocytes (CTLs) is a promising treatment for a variety of  malignancies 1. CTLs can  ...

Isolation and Th17 Differentiation of Na&iuml;ve CD4 T Lymphocytes

Th17 cells are a distinct subset of T cells that have been found to produce interleukin 17 (IL-17), and differ in function from the other T cell subsets including Th1, Th2, and regulatory T cells. Th17 cells have emerged as a central culprit in overzealous inflammatory immune responses associated with many autoimmune disorders. In this method we purify T lymphocytes from the spleen and lymph nodes of C57BL/6 mice, and stimulate purified CD4+ T cells under control and Th17-inducing environments. The Th17-inducing environment includes stimulation in the presence of anti-CD3 and anti-CD28 antibodies, IL-6, and TGF-&#946;. After incubation for at least 72 hours and for up to five days at 37 &#176;C, cells are subsequently analyzed for the capability to produce IL-17 through flow cytometry, qPCR, and ELISAs. Th17 differentiated CD4+CD25- T cells can be utilized to further elucidate the role that Th17 cells play in the onset and progression of autoimmunity and host defense. Moreover, Th17 differentiation of CD4+CD25- lymphocytes from distinct murine knockout/disease models can contribute to our understanding of cell fate plasticity.

Isolation and Th17 Differentiation of Na&#239;ve CD4 T Lymphocytes

With effector functions distinct from other T cell subsets, Th17 cells have been centrally implicated in inflammatory autoimmunity. This in vitro Th17 differentiation protocol provides a means to determine whether na&#239;ve CD4+ T lymphocytes can differentiate into Th17 cells, and to further examine their role in autoimmunity and host response.

Th17 cells are a distinct subset of T cells that have been found to produce interleukin 17 (IL-17), and differ in function from the other T cell subsets ...

Static Adhesion Assay for the Study of Integrin Activation in T Lymphocytes

T lymphocyte adhesion is required for multiple T cell functions, including migration to sites of inflammation and formation of immunological synapses with antigen presenting cells. T cells accomplish regulated adhesion by controlling the adhesive properties of integrins, a class of cell adhesion molecules consisting of heterodimeric pairs of transmembrane proteins that interact with target molecules on partner cells or extracellular matrix. The most prominent T cell integrin is lymphocyte function associated antigen (LFA)-1, composed of subunits &#945;L and &#946;2, whose target is the intracellular adhesion molecule (ICAM)-1. The ability of a T cell to control adhesion derives from the ability to regulate the affinity states of individual integrins. Inside-out signaling describes the process whereby signals inside a cell cause the external domains of integrins to assume an activated state. Much of our knowledge of these complex phenomena is based on mechanistic studies performed in simplified in&#160;vitro model systems. The T lymphocyte adhesion assay described here is an excellent tool that allows T cells to adhere to target molecules, under static conditions, and then utilizes a fluorescent plate reader to quantify adhesiveness. This assay has been useful in defining adhesion-stimulatory or inhibitory substances that act on lymphocytes, as well as characterizing the signaling events involved. Although described here for LFA-1 - ICAM-1 mediated adhesion; this assay can be readily adapted to allow for the study of other adhesive interactions (e.g.&#160;VLA-4 - fibronectin).

Static adhesion assay is a powerful tool that can be used to model the interactions between T lymphocytes and other cell types. Interactions are generated by injecting labeled T cells into wells coated with adhesion molecules, while a plate reader is used to quantify the number of adherent cells following serial washes.

T lymphocyte adhesion is required for multiple T cell functions, including migration to sites of inflammation and formation of immunological synapses with ...

Efficient Isolation Protocol for B and T Lymphocytes from Human Palatine Tonsils

Tonsils form a part of the immune system providing the first line of defense against inhaled pathogens. Usually the term &#8220;tonsils&#8221; refers to the palatine tonsils situated at the lateral walls of the oral part of the pharynx. Surgically removed palatine tonsils provide a convenient accessible source of B and T lymphocytes to study the interplay between foreign pathogens and the host immune system. This video protocol describes the dissection and processing of surgically removed human palatine tonsils, followed by the isolation of the individual B and T cell populations from the same tissue sample. We present a method, which efficiently separates tonsillar B and T lymphocytes using an antibody-dependent affinity protocol. Further, we use the method to demonstrate that human adenovirus infects specifically the tonsillar T cell fraction. The established protocol is generally applicable to efficiently and rapidly isolate tonsillar B and T cell populations to study the role of different types of pathogens in tonsillar immune responses.

Palatine tonsils are a rich source of B and T lymphocytes. Here we provide an easy, efficient and rapid protocol to isolate B and T lymphocytes from human palatine tonsils. The method described has been specifically adapted for studies of the viral etiology of tonsil inflammation known as tonsillitis.

Tonsils form a part of the immune system providing the first line of defense against inhaled pathogens. Usually the term &#8220;tonsils&#8221; refers to ...

Visualization of IL-22-expressing Lymphocytes Using Reporter Mice

Reporter mice have been widely used to observe the localization of expression of targeted genes. This protocol focuses on a strategy to establish a new transgenic reporter mouse model. We chose to visualize interleukin (IL) 22 gene expression because this cytokine has important activities in the intestine, where it contributes to repair tissues damaged by inflammation. Reporter systems offer considerable advantages over other methods of identifying products in vivo. In the case of IL-22, other studies had first isolated cells from tissues and then re-stimulated the cells in vitro. IL-22, which is normally secreted, was trapped inside cells using a drug, and intracellular staining was used to visualize it. This method identifies cells capable of producing IL-22, but it does not determine whether they were doing so in vivo. The reporter design includes inserting a gene for a fluorescent protein (tdTomato) into the IL-22 gene in such a way that the fluorescent protein cannot be secreted and therefore remains trapped inside the producing cells in vivo. Fluorescent producers can then be visualized in tissue sections or by ex vivo analysis through flow cytometry. The actual construction process for the reporter included recombineering a bacterial artificial chromosome that contained the IL-22 gene. This engineered chromosome was then introduced into the mouse genome. Homeostatic IL-22 reporter expression was observed in different mouse tissues, including the spleen, thymus, lymph nodes, Peyer&#39;s patch, and intestine, by flow cytometry analysis. Colitis was induced by T-cell (CD4+CD45RBhigh) transfer, and reporter expression was visualized. Positive T cells were first present in the mesenteric lymph nodes, and then they accumulated inside the lamina propria of the distal small intestine and colon tissues. The strategy using BACs gave good-fidelity reporter expression compared to IL-22 expression, and it is simpler than knock-in procedures.

We describe here a transgenic reporter mouse model to visualize the IL-22-producing cells inside different mouse tissues. This method can be used to track the location of other cytokines or secretary proteins in the mouse.

Reporter mice have been widely used to observe the localization of expression of targeted genes. This protocol focuses on a strategy to establish a new ...

Development of Stem Cell-derived Antigen-specific Regulatory T Cells Against Autoimmunity

Autoimmune diseases arise due to the loss of immunological self-tolerance. Regulatory T cells (Tregs) are important mediators of immunologic self-tolerance. Tregs represent about 5 - 10% of the mature CD4+ T cell subpopulation in mice and humans, with about 1 - 2% of those Tregs circulating in the peripheral blood. Induced pluripotent stem cells (iPSCs) can be differentiated into functional Tregs, which have a potential to be used for cell-based therapies of autoimmune diseases. Here, we present a method to develop antigen (Ag)-specific Tregs from iPSCs (i.e., iPSC-Tregs). The method is based on incorporating the transcription factor FoxP3 and an Ag-specific T cell receptor (TCR) into iPSCs and then differentiating on OP9 stromal cells expressing Notch ligands delta-like (DL) 1 and DL4. Following in vitro differentiation, the iPSC-Tregs express CD4, CD8, CD3, CD25, FoxP3, and Ag-specific TCR and are able to respond to Ag stimulation. This method has been successfully applied to cell-based therapy of autoimmune arthritis in a murine model. Adoptive transfer of these Ag-specific iPSC-Tregs into Ag-induced arthritis (AIA)-bearing mice has the ability to reduce joint inflammation and swelling and to prevent bone loss.

We present here a method to develop functional antigen (Ag)-specific regulatory T cells (Tregs) from induced pluripotent stem cells (iPSCs) for immunotherapy of autoimmune arthritis in a murine model.