The authors thank Mohamed Abdullahi Ahmed for the expert technician assistance. This work was supported by grants from the Lundbeck Foundation, the Novo Nordisk Foundation, the Danish Kidney Association, the Aase og Ejnar Danielsen Foundation, the A.P. M&#248;ller Foundation for the Advancement of Medical Science, and Knud and Edith Eriksen Memorial Foundation.

1. Insertion of Peptide Coding Sequencing Sequence in pBAD BirA-eCPX-AP
NOTE: To select for BirA variants that biotinylate a native target protein, start by identifying a 15-amino acid peptide sequence in the proteins primary sequence that contains at least one lysine (K) residue.
<ol>
	<li>Go to the sequence manipulation suite12.</li>
	<li>Paste the identified 15 amino acid peptide sequence into the input box in FASTA format and press Submit.</li>
	<li>Select and copy the 45 nucleotide reverse translation of the peptide sequence.</li>
	<li>Download the GenBank File for pBAD-BirA-eCPX-AP from http://n2t.net/addgene:121907.</li>
	<li>Load the file in a plasmid editor (e.g., ApE) and, in the feature window, select the AP sequence designated &#34;AviTag(TM)&#34;.</li>
	<li>Right-click the highlighted AP sequence in the DNA sequence window and select Paste Rev-Com in the contextual menu. 
	NOTE: The coding sequence of eCPX is in the reverse direction and the peptide coding sequence should, therefore, be pasted as a reverse complement.</li>
	<li>Right-click the highlighted sequence and select New Feature.</li>
	<li>Add a descriptive name of the inserted sequence and press OK.</li>
	<li>Select Save As in the File menu to save the modified file.</li>
	<li>Design the forward primer to include the last 30 nucleotides of the reverse complement of the peptide coding sequence and add the plasmid binding nucleotide sequence (3&#8217;-GCGGCCGCCTGC-5&#8217;) to its 5&#8217; end.</li>
	<li>Design the reverse primer to include the first 30 nucleotides of the reverse complement of the peptide coding sequence and add the plasmid binding nucleotide sequence (3&#8217;- CTTAAGTAATGTTTAAACGAATTCGAG-5&#8217;) to its 5&#8217; end.</li>
	<li>Set up a 20 &#181;L PCR reaction in a thin-walled PCR tube by adding the reagents listed in Table 1.</li>
	<li>Transfer the tube to a thermal cycler and perform PCR using a program with an initial denaturing at 98 &#176;C for 30 s, 30 cycles of [15 s at 98 &#176;C, 15 s at 60 &#176;C and 3 min at 72 &#176;C], final extension for 2 min at 72 &#176;C and hold at 4 &#176;C.</li>
	<li>Run 5 &#181;L of the PCR reaction on a 1% agarose gel to confirm the amplification of a ~6 kb PCR product. 
	NOTE: If no PCR product is observed, optimize the PCR condition according to the manufacturer&#8217;s instructions. The protocol can be paused here.</li>
	<li>Add 1 &#181;L of DpnI to the PCR reaction and incubate for 1 h at 37 &#176;C</li>
	<li>Transform the competent E. coli with 2 &#181;L of DpnI digested PCR reaction and plate on Lysogenic broth (LB)/Amp plates. Incubate overnight at 37 &#176;C.</li>
	<li>Inoculate 5 mL LB containing 100 &#181;g/mL ampicillin with a single colony. Incubate overnight at 37 &#176;C with shaking at 200 rpm. 
	NOTE: It is recommended to test at least 6 colonies.</li>
	<li>Make freeze stocks of 850 &#181;L of each overnight culture by adding glycerol to a final concentration of 15% to the culture. Store at -80 &#176;C.</li>
	<li>Extract the plasmid DNA from the remaining 4 mL culture by mini-prep DNA extraction kit.</li>
	<li>Confirm the correct insert of the peptide coding sequence by DNA sequencing using T7 Terminal primer (GCTAGTTATTGCTCAGCGG).</li>
</ol>
2. Generation of a BirA Library
NOTE: The initial BirA mutational library (Figure 1c, step 1) is created by error-prone PCR. Other methods to generate the BirA mutational library are likely to work as well.
<ol>
	<li>Synthesize the mutant megaprimers with BirA-6xHis forward (ATGAAGGATAACACCGTGCC) and reverse (TCAATGATGATGATGATGATGTTT) primers using 1 ng of pBAD-BirA-eCPX with the target peptide sequence (prepared and confirmed in step 1.20) as a template and 35 PCR cycles with an annealing temperature of 60 &#176;C according to the manufacturer&#8217;s instruction.</li>
	<li>Run 5 &#181;L of the amplification reaction on a 1% agarose gel to verify the amplification of a 984 bp PCR product.</li>
	<li>Purify the PCR product from the remaining 45 &#181;L of the amplification reaction using a commercial PCR purification kit and use a spectrophotometer to quantitate the DNA yield. 
	NOTE: Purification from a single 45 &#181;L amplification reaction generally produces a enough yield (&#62;250 ng).</li>
	<li>Prepare the sample reaction in a thin-walled PCR tube by adding the reagents listed in Table 2.</li>
	<li>Transfer the reaction mixture to a thermal cycler and run the PCR with the mutant megaprimers prepared in step 2.3 using the following parameters: 1 min at 95 &#176;C and 25 cycles of 50 s at 95 &#176;C, 50 s at 60 &#176;C and 12 min at 68 &#176;C. Store the reaction at 4 &#176;C.</li>
	<li>Add 1 &#181;L of DpnI restriction enzyme directly to the amplification reaction and mix gently.</li>
	<li>Spin down the reaction mixture and incubate for 2 h at 37 &#176;C.</li>
	<li>Transform T7 Express lysY/Iq competent E. coli cells with 2 &#181;L of the DpnI reaction.</li>
	<li>Inoculate 100 mL LB containing 100 &#181;g/mL ampicillin with the transformed cells and incubate overnight at 37 &#176;C with shaking at 200 rpm.</li>
	<li>Make freezer stocks with 10 mL of the overnight culture in LB with 15% glycerol and store at -80 &#176;C.</li>
</ol>
3. Selection of Bacteria Expressing Biotinylated Peptide
NOTE: This part of the protocol covers step 2-5 of Figure 1c. It is highly recommended that the selection approach is setup using pBAD-BirA-eCPX-AP and pBAD-BirA-eCPX-AP(K10A) as positive and negative controls.
<ol>
	<li>Inoculate 100 mL of LB containing 1% glucose and 100 &#181;g/mL ampicillin with 1 mL of BirA library and incubate overnight at 37 &#176;C with shaking at 200 rpm.</li>
	<li>Inoculate 5 mL of LB containing 1% glucose and 100 &#181;g/mL ampicillin with 100 &#181;L of the overnight culture.</li>
	<li>Incubate for 2 h and 30 min until the culture reaches an OD600 of approximately 0.5.</li>
	<li>Induce eCPX and BirA expression with 0.2% w/v L-arabinose, 100 &#181;M Isopropyl &#946;-D-1-thiogalactopyranoside (IPTG) and 100 &#181;M biotin and shake the culture at 200 rpm for 1 h at 37 &#176;C.</li>
	<li>Centrifuge the culture for 10 min at 5,000 x g and remove the supernatant.</li>
	<li>Resuspend the cells in 1 mL of the ice-cold PBS and centrifuge at 5,000 x g for 5 min.</li>
	<li>Discard the supernatant and resuspend the cells in 400 &#181;L of ice-cold PBS and store cells on the ice.</li>
	<li>Remove 10 &#181;L of resuspended cells and store on the ice in a 1.5 mL tube labeled &#34;Input&#34;.</li>
	<li>Wash 20 &#181;L of streptavidin magnetic beads in 1 mL of ice-cold PBS and place the tube in a bench top magnetic particle separator before carefully removing the supernatant.</li>
	<li>Resuspend the streptavidin magnetic beads in 20 &#181;L of ice-cold PBS and transfer to the 390 &#181;L of resuspended cells from step 3.8.</li>
	<li>Mix by gently pipetting and then incubate for 30 min at 4 &#176;C. 
	NOTE: Do not vortex as this may lyse the cells. Aggregation of beads is often observed with a high abundance of bacteria displaying a biotinylated peptide.</li>
	<li>Place a column with ferromagnetic spheres in a magnetic particle separator and wash with 5 mL of ice-cold PBS.</li>
	<li>Transfer cells and streptavidin magnetic beads to the column attached in the separator.</li>
	<li>Once the column reservoir is empty, add 500 &#181;L of ice-cold PBS and repeat until the column has been washed with a total volume of 5 mL of ice-cold PBS.</li>
	<li>Remove the column from the separator and place it in a 1.5 mL tube.</li>
	<li>Pipette 1 mL of the ice-cold PBS onto the column and elute the magnetically labeled cells by applying the plunger supplied with the column.</li>
	<li>Transfer the 1.5 mL tube to a bench top separator and wash the magnetically labeled cell with 1 mL of ice-cold PBS.</li>
	<li>Gently resuspend the magnetically labeled cells in 1 mL of the ice-cold PBS before removing and storing 10 &#181;L of the resuspension in a 1.5 mL tube labeled &#34;Output&#34;.</li>
	<li>Inoculate 100 mL of LB containing 1% glucose and 100 &#181;g/mL ampicillin with the magnetically labeled cells and incubate overnight at 37 &#176;C with shaking at 200 rpm.</li>
	<li>The next day, use 10 mL of the overnight culture to make freezer stocks with cells in LB with 15% glycerol and store at -80 &#176;C and 1 mL of the overnight culture for the next round of selection, i.e., step 3.2. 
	NOTE: Generally, 3-5 rounds of selection are recommended for the enrichment of streptavidin binding bacteria.</li>
</ol>
4. Quantification of Enrichment
NOTE: Quantification of the live bacteria in the &#34;input&#34;&#160;and &#34;output&#34;&#160;samples are performed after each selection round by plating of serial dilutions of the samples and subsequent counting of colony forming units (CFUs).
<ol>
	<li>Add 990 &#181;L ice-cold PBS to the input (from step 3.8) and output (from step 3.18) samples and label the tubes &#34;Input 10-2&#34;&#160;and &#34;Output 10-2&#34;, respectively.</li>
	<li>Make 10-fold serial dilutions of the &#34;Input 10-2&#34; and &#34;Output 10-2&#34; samples in ice-cold PBS until a final dilution of 10-10 is reached in the input sample and 10-4 in the output sample.</li>
	<li>Plate 100 &#181;L of samples from &#34;Input 10-6&#34;, &#34;Input 10-8&#34;, &#34;Input 10-10&#34;, &#34;Output 10-2&#34;, &#34;Output 10-3&#34; and &#34;Output 10-4&#34; on LB/Amp plates and incubate overnight at 37 &#176;C.</li>
	<li>Count the number of colonies on the plates with clearly separated colonies. Multiply the colony count with the dilution factor to obtain the bacterial concentration count/100 &#181;L.</li>
	<li>Calculate the total bacterial count in the input and output samples by multiplying the cell concentration with the input (400 &#181;L) and output volume (1 mL), respectively, and estimate the enrichment by dividing output with input cell count. 
	NOTE: A significant enrichment should be visible after 3-5 selection rounds</li>
</ol>
5. Characterization of Selected BirA Variant
NOTE: The characterization can be performed after selecting BirA variants from the first BirA library; however, the BirA variants generally have low activity towards the peptide. Therefore, an additional round of mutation and selection can also be performed before the characterization. Usually, 10 clones from the final selection round are isolated for further characterization.
<ol>
	<li>Inoculate 5 mL LB containing 100 &#181;g/mL ampicillin with selected clones from the final selection round. In addition, inoculate 5 mL LB containing 100 &#181;g/mL ampicillin with T7 Express lysY/Iq E. coli transformed with pBAD-BirA-eCPX-AP, which will be used as a positive control for the western blot described below.</li>
	<li>Incubate overnight at 37 &#176;C with shaking at 200 rpm.</li>
	<li>Make freeze stocks of 850 &#181;L of each overnight culture by adding glycerol to a final concentration of 15% to the culture. Store at -80 &#176;C.</li>
	<li>Inoculate 5 mL of LB containing 100 &#181;g/mL ampicillin with 100 &#181;L of overnight culture and incubate at 37 &#176;C with shaking at 200 rpm for 2 h.</li>
	<li>Extract the plasmid DNA from the remaining 4 mL culture by s commercially mini-prep DNA extraction kit. Perform the DNA sequence in forward and reverse directions of the BirA variants with pBAD (ATGCCATAGCATTTTTATCC) and pTrcHis rev (CTTCTGCGTTCTGATTTAATCTG) primers.</li>
	<li>Add 0.2% w/v L-arabinose and 100 &#181;M IPTG and 100 &#181;M biotin to cultures from step 5.4 and shake the culture at 200 rpm for 1 h at 37 &#176;C to induce the expression of eCPX and BirA variants.</li>
	<li>Transfer 65 &#181;L of the culture to 1.5 mL tubes containing 25 &#181;L of the sample loading buffer and 10 &#181;L of the reducing agent.</li>
	<li>Incubate at 95 &#176;C for 5 min.</li>
	<li>Load the sample (including the positive control) onto a 12% SDS-polyacrylamide gel along with a size marker and perform gel electrophoresis at 200 V for approximately 45 min until the 20, 25 and 37 kDa standard bands are clearly separated.</li>
	<li>Release the gel from the cassette and assemble the sandwich for blotting of the gel onto a PVDF membrane.</li>
	<li>Electroblot at 35 V for 2 h on ice.</li>
	<li>Remove the PVDF membrane and incubate in blocking buffer [PBS, 0.05% Tween-20, 3% Skim Milk Powder] for 1 h at room temperature with shaking.</li>
	<li>Prepare the biotin-detection solution by diluting streptavidin-HRP 1:1,000 in PBST. 
	NOTE: The blocking buffer contains biotin and should therefore not be used as dilution buffer for streptavidin-HRP.</li>
	<li>Discard the blocking buffer, wash the membrane swiftly in PBST [PBS, 0.05% Tween-20] and add the biotin-detection solution. Incubate for 1 h at room temperature with shaking.</li>
	<li>Discard the biotin-detection solution and wash the membrane thoroughly in PBST for 5 min twice and 10 min once with gentle shaking at room temperature.</li>
	<li>Discard the PBST, add 2 mL ECL mix and incubate for 1 min with shaking.</li>
	<li>Dry the membrane swiftly on a tissue paper and develop the image on an X-ray film or in a digital gel imaging system. 
	NOTE: In the lane loaded with the positive control, two distinct streptavidin-reaction bands should be clearly visible: a 30 kDa biotinylated endogenously expressed protein and the ~22 kDa eCXP-AP band. If the 10 selected colonies can biotinylate the displayed peptide, a band at ~22 kDa should be visible. The intensity of these bands is generally lower than the positive control and may, therefore, require longer exposure times.&#160;</li>
</ol>

<ol>
	<li>Polyak, S. W., Abell, A. D., Wilce, M. C. J., Zhang, L., Booker, G. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Structure,+function+and+selective+inhibition+of+bacterial+acetyl-CoA+carboxylase.">Structure, function and selective inhibition of bacterial acetyl-CoA carboxylase.</a> Applied Microbiology and Biotechnology. 93 (3), 983-992 (2011).</li><li>Schatz, P. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Use+of+Peptide+Libraries+to+Map+the+Substrate+Specificity+of+a+Peptide-Modifying+Enzyme:+A+13+Residue+Consensus+Peptide+Specifies+Biotinylation+in+Escherichia+coli.">Use of Peptide Libraries to Map the Substrate Specificity of a Peptide-Modifying Enzyme: A 13 Residue Consensus Peptide Specifies Biotinylation in Escherichia coli.</a> Nature Biotechnology. 11 (10), 1138-1143 (1993).</li><li>de Boer, E., Rodriguez, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Efficient+biotinylation+and+single-step+purification+of+tagged+transcription+factors+in+mammalian+cells+and+transgenic+mice.">Efficient biotinylation and single-step purification of tagged transcription factors in mammalian cells and transgenic mice.</a> Proceedings of the National Academy of Sciences. 100 (13), 7480-7485 (2003).</li><li>Tannous, B. A., Grimm, J., Perry, K. F., Chen, J. W., Weissleder, R., Breakefield, X. O. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Metabolic+biotinylation+of+cell+surface+receptors+for+in+vivo+imaging.">Metabolic biotinylation of cell surface receptors for in vivo imaging.</a> Nature Methods. 3 (5), 391-396 (2006).</li><li>Howarth, M., Takao, K., Hayashi, Y., Ting, A. Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Targeting+quantum+dots+to+surface+proteins+in+living+cells+with+biotin+ligase.">Targeting quantum dots to surface proteins in living cells with biotin ligase.</a> Proceedings of the National Academy of Sciences. 102 (21), 7583-7588 (2005).</li><li>Michael Green, N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Avidin+and+streptavidin.">Avidin and streptavidin.</a> Avidin-Biotin Technology. 184, 51-67 (1990).</li><li>Fujita, S., Taki, T., Taira, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Selection+of+an+Active+Enzyme+by+Phage+Display+on+the+Basis+of+the+Enzyme's+Catalytic+Activity+in+vivo.">Selection of an Active Enzyme by Phage Display on the Basis of the Enzyme's Catalytic Activity in vivo.</a> ChemBioChem. 6 (2), 315-321 (2005).</li><li>Iwamoto, M., Taki, T., Fujita, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Selection+of+a+biotin+protein+ligase+by+phage+display+using+a+combination+of+in+vitro+selection+and+in+vivo+enzymatic+activity.">Selection of a biotin protein ligase by phage display using a combination of in vitro selection and in vivo enzymatic activity.</a> Journal of Bioscience and Bioengineering. 107 (3), 230-234 (2009).</li><li>Granh&#248;j, J., Dimke, H., Svenningsen, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+bacterial+display+system+for+effective+selection+of+protein-biotin+ligase+BirA+variants+with+novel+peptide+specificity.">A bacterial display system for effective selection of protein-biotin ligase BirA variants with novel peptide specificity.</a> Scientific Reports. 9 (1), 4118 (2019).</li><li>Rice, J. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Bacterial+display+using+circularly+permuted+outer+membrane+protein+OmpX+yields+high+affinity+peptide+ligands.">Bacterial display using circularly permuted outer membrane protein OmpX yields high affinity peptide ligands.</a> Protein Science. 15 (4), 825-836 (2006).</li><li>Rice, J. J., Daugherty, P. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Directed+evolution+of+a+biterminal+bacterial+display+scaffold+enhances+the+display+of+diverse+peptides.">Directed evolution of a biterminal bacterial display scaffold enhances the display of diverse peptides.</a> Protein Engineering Design and Selection. 21 (7), 435-442 (2008).</li><li>Stothard, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+sequence+manipulation+suite:+JavaScript+programs+for+analyzing+and+formatting+protein+and+DNA+sequences.">The sequence manipulation suite: JavaScript programs for analyzing and formatting protein and DNA sequences.</a> BioTechniques. 28, 1102-1104 (2000).</li></ol>

The authors have nothing to disclose.

As for all selection methods, the stringency of the washing steps is of utmost importance. Since bacteria do not need to be eluted from the beads before the amplification of the selected clones, the high affinity binding between biotin and streptavidin can be used instead of using lower affinity avidins, as previously done with the phage display system, for the selection of BirA variants7,8. This ensures that rare clones are selected and that non-biotinylated bac...

Biotinylation of a protein creates a powerful tag for its affinity isolation and detection. Enzymatic protein biotinylation is a highly specific post-translational modification catalyzed by biotin-protein ligases. The E. coli biotin-protein ligase BirA is extremely specific and covalently biotinylates only a restricted number of naturally occurring proteins at specific lysine residues1. The advantages of the BirA catalyzed biotinylation are currently harnessed by fusing the target protein with a small synthetic 15-amino-acid biotin acceptor peptide (AP) that is effectively biotinylated2 and allows for the highly specific and efficient in vivo and in vitro biotinylation by co-expression or addition of BirA3,4,5. Although the in vivo and in vitro BirA catalyzed biotin-protein ligation is an attractive labeling strategy, its application is limited to samples that contain AP-fused proteins. The purpose of this method is the development of new mutants of biotin-protein ligases that selectively biotinylate native unmodified proteins and, thereby expand the number of applications in which the enzymatic biotinylation strategy can be used.
Protein function can be evolved through iterative rounds of the gene mutation, selection, and amplification of gene variants with the desired function. A strong and efficient selection strategy is crucial for the directed evolution and biotin-protein ligase activity is readily selected due to the strong binding between biotin and streptavidin and its homologs6. Phage display technologies allow for the selection of phages that display biotinylated peptides7,8. Since amplification of isolated phages requires infection of a bacterial host, however, the phage selection with streptavidin creates a bottleneck in that the high-affinity binding of biotin to streptavidin is virtually irreversible under non-denaturing conditions. To ensure reversible binding of biotinylated phages, monomeric avidins with lower affinity were used which resulted in a modest ~10-fold enrichment7. We recently developed a bacterial display method for the isolation of novel BirA variants that eliminates the need for the elution from the affinity matrix and thereby removes a bottleneck from previous BirA selection systems9. Indeed, our bacterial display system allows for a &#62;1,000,000-fold enrichment of active clones in a single selection step9, thus providing an effective selection system for the directed evolution of novel BirA variants.
Our bacterial display system consists of two components, BirA with a C-terminal 6xHis tag and a scaffold protein that allows for the surface display of a target peptide. We used the scaffold protein enhanced circularly permuted outer membrane protein X (eCPX) since the effective display of peptides can be observed at both the N- and C-termini10,11. The fusion of the target peptide sequence to the C-terminus of eCPX ensures biotinylation of bacteria expressing active BirA variants. The bacteria allow for the effective streptavidin selection as the biotinylated peptide now displays on the surface (Figure 1a).
The purpose of this method is to select for novel variants of BirA that biotinylates peptide sequences present in native proteins. The system is encoded by genes present on the plasmid pBAD-BirA-eCPX-AP, which contains an arabinose-inducible promoter controlling BirA (araBAD), and a T7 promoter controlling eCPX9 (Figure 1b). The present protocol describes the detailed procedure for 1) incorporation of a peptide derived from a target protein into the C-terminal of eCPX, 2) creation of a mutational library of BirA by error-prone PCR, 3) selection of streptavidin-binding bacteria by magnetic-activated cell sorting (MACS), 4) quantification of bacteria enrichment, and 5) initial characterization of isolated clones.

<table border="0" cellpadding="0" cellspacing="0" style="width:747px;" width="747">
	<colgroup>
		<col />
		<col />
		<col />
		<col />
	</colgroup>
	<tbody>
		<tr height="21">
			<td height="21" style="height:21px;width:307px;">10% precast polyacrylamide gel</td>
			<td style="width:155px;">Bio-Rad</td>
			<td align="right" style="width:119px;">4561033</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:307px;">Ampicilin</td>
			<td style="width:155px;">Sigma-Aldrich</td>
			<td style="width:119px;">A1593</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:307px;">ApE - A plasmid editor v2.0</td>
			<td style="width:155px;">NA</td>
			<td style="width:119px;">NA</td>
			<td>downloaded from http://jorgensen.biology.utah.edu/wayned/ape/</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:307px;">Arabinose</td>
			<td style="width:155px;">Sigma-Aldrich</td>
			<td style="width:119px;">A3256</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:307px;">Biotin</td>
			<td style="width:155px;">Sigma-Aldrich</td>
			<td style="width:119px;">B4501</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:307px;">DMSO</td>
			<td style="width:155px;">Sigma-Aldrich</td>
			<td style="width:119px;">D2650</td>
			<td></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:307px;">DPBS (10X), no calcium, no magnesium</td>
			<td style="width:155px;">ThermoFischer Scientific</td>
			<td align="right" style="width:119px;">14200083</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:307px;">DpnI restriction enzyme</td>
			<td style="width:155px;">New England BioLabs</td>
			<td style="width:119px;">R0176</td>
			<td></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:307px;">Dynabeads MyOne Streptavidin C1</td>
			<td style="width:155px;">ThermoFischer Scientific</td>
			<td align="right" style="width:119px;">65001</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:307px;">GenElute Plasmid Miniprep Kit</td>
			<td style="width:155px;">Sigma-Aldrich</td>
			<td style="width:119px;">PLN350</td>
			<td></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:307px;">GeneMorph II EZClone Domain Mutagensis kit</td>
			<td style="width:155px;">Agilent Technologies</td>
			<td align="right" style="width:119px;">200552</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:307px;">Glucose</td>
			<td style="width:155px;">Sigma-Aldrich</td>
			<td style="width:119px;">G8270</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:307px;">Glycerol</td>
			<td style="width:155px;">Sigma-Aldrich</td>
			<td style="width:119px;">G5516</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:307px;">Immobilon-P PVDF Membrane</td>
			<td style="width:155px;">Millipore</td>
			<td style="width:119px;">IPVH15150</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:307px;">IPTG</td>
			<td style="width:155px;">Sigma-Aldrich</td>
			<td style="width:119px;">I6758</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:307px;">LS Columns</td>
			<td style="width:155px;">Miltenyi Biotec</td>
			<td style="width:119px;">130-042-401</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:307px;">NaCl</td>
			<td style="width:155px;">Sigma-Aldrich</td>
			<td style="width:119px;">S7653</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:307px;">NEB 5-alpha Competent E. coli</td>
			<td style="width:155px;">New England BioLabs</td>
			<td style="width:119px;">C2987</td>
			<td></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:307px;">NuPAGE LDS Sample Buffer (4X)</td>
			<td style="width:155px;">ThermoFischer Scientific</td>
			<td style="width:119px;">NP0007</td>
			<td></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:307px;">NuPAGE Sample Reducing Agent (10X)</td>
			<td style="width:155px;">ThermoFischer Scientific</td>
			<td style="width:119px;">NP0009</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:307px;">pBAD-BirA-eCPX-AP</td>
			<td style="width:155px;">Addgene</td>
			<td align="right" style="width:119px;">121907</td>
			<td>Used a template and positive control</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:307px;">pBAD-BirA-eCPX-AP(K10A)</td>
			<td style="width:155px;">Addgene</td>
			<td align="right" style="width:119px;">121908</td>
			<td>negative control</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:307px;">Q5 High-Fidelity DNA Polymerase</td>
			<td style="width:155px;">New England BioLabs</td>
			<td style="width:119px;">M0491</td>
			<td>For insertion of peptide sequence in pBAD-BirA-eCPX-AP, any high fidelity polymerase will do</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:307px;">QuadroMACS Separator</td>
			<td style="width:155px;">Miltenyi Biotec</td>
			<td style="width:119px;">130-090-976</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:307px;">Skim Milk Powder</td>
			<td style="width:155px;">Sigma-Aldrich</td>
			<td align="right" style="width:119px;">70166</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:307px;">Streptavidin-HRP</td>
			<td style="width:155px;">Agilent Technologies</td>
			<td style="width:119px;">P0397</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:307px;">T7 Express lysY/Iq Competent E. coli</td>
			<td style="width:155px;">New England BioLabs</td>
			<td style="width:119px;">C3013</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:307px;">Tryptone</td>
			<td style="width:155px;">Millipore</td>
			<td style="width:119px;">T9410</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:307px;">Tween-20</td>
			<td style="width:155px;">Sigma-Aldrich</td>
			<td style="width:119px;">P9416</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:307px;">Western Lightning Plus-ECL</td>
			<td style="width:155px;">PerkinElmer</td>
			<td style="width:119px;">NEL103001EA</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:307px;">Yeast extract</td>
			<td style="width:155px;">Sigma-Aldrich</td>
			<td style="width:119px;">Y1625</td>
			<td></td>
		</tr>
	</tbody>
</table>

bacterial peptide display for the selection of novel biotinylating enzymes

Biotin is an attractive post-translational modification of proteins that provides a powerful tag for the isolation and detection of protein. Enzymatic biotinylation by the E. coli biotin-protein ligase BirA is highly specific and allows for the biotinylation of target proteins in their native environment; however, the current usage of BirA mediated biotinylation requires the presence of a synthetic acceptor peptide (AP) in the target protein. Therefore, its application is limited to proteins that have been engineered to contain the AP. The purpose of the present protocol is to use the bacterial display of a peptide derived from an unmodified target protein to select for BirA variants that biotinylates the peptide. The system is based on a single plasmid that allows for the co-expression of BirA variants along with a scaffold for the peptide display on the bacterial surface. The protocol describes a detailed procedure for the incorporation of the target peptide into the display scaffold, creation of the BirA library, selection of active BirA variants and initial characterization of the isolated BirA variants. The method provides a highly effective selection system for the isolation of novel BirA variants that can be used for the further directed evolution of biotin-protein ligases that biotinylate a native protein in complex solutions.

Western blot of pBAD-BirA-eCPX-AP expressing bacteria produces a ~22 kDa streptavidin-reacting band consistent with the molecular weight of eCPX (Figure 2a). Unlike BirA-6xHis, biotinylated eCPX-AP was present in both uninduced and induced cultures (Figure 2a) due to a small degree of T7 promoter activity even in uninduced cultures and subsequent biotinylation of the AP by endogenous BirA. In BirA-eCPX-AP(K10A) expressing cultur...

Watch this Scientific Journal Video about Bacterial Peptide Display for the Selection of Novel Biotinylating Enzymes at JoVE.com

Bacterial Peptide Display for the Selection of Novel Biotinylating Enzymes

Here we present a method to select for novel variants of the E. coli biotin-protein ligase BirA that biotinylates a specific target peptide. The protocol describes the construction of a plasmid for the bacterial display of the target peptide, generation of a BirA library, selection and characterization of BirA variants.

Biotin is an attractive post-translational modification of proteins that provides a powerful tag for the isolation and detection of protein. Enzymatic ...

bacterial-peptide-display-for-selection-novel-biotinylating

Research

JoVE Journal

Immunology and Infection

5.6K Views.  University of Southern Denmark. Here we present a method to select for novel variants of the E. coli biotin-protein ligase BirA that biotinylates a specific target peptide. The protocol describes the construction of a plasmid for the bacterial display of the target peptide, generation of a BirA library, selection and characterization of BirA variants.

Video: Bacterial Peptide Display for the Selection of Novel Biotinylating Enzymes

'Bioluminescent' Reporter Phage for the Detection of Category A Bacterial Pathogens

Yersinia pestis and Bacillus anthracis are Category A bacterial pathogens that are the causative agents of the plague and anthrax, respectively 1. Although the natural occurrence of both diseases&#39; is now relatively rare, the possibility of terrorist groups using these pathogens as a bioweapon is real. Because of the disease&#39;s inherent communicability, rapid clinical course, and high mortality rate, it is critical that an outbreak be detected quickly. Therefore methodologies that provide rapid detection and diagnosis are essential to ensure immediate implementation of public health measures and activation of crisis management.
Recombinant reporter phage may provide a rapid and specific approach for the detection of Y. pestis and B. anthracis. The Centers for Disease Control and Prevention currently use the classical phage lysis assays for the confirmed identification of these bacterial pathogens 2-4. These assays take advantage of naturally occurring phage which are specific and lytic for their bacterial hosts. After overnight growth of the cultivated bacterium in the presence of the specific phage, the formation of plaques (bacterial lysis) provides a positive identification of the bacterial target. Although these assays are robust, they suffer from three shortcomings: 1) they are laboratory based; 2) they require bacterial isolation and cultivation from the suspected sample, and 3) they take 24-36 h to complete. To address these issues, recombinant &#34;light-tagged&#34; reporter phage were genetically engineered by integrating the Vibrio harveyi luxAB genes into the genome of Y. pestis and B. anthracis specific phage 5-8. The resulting luxAB reporter phage were able to detect their specific target by rapidly (within minutes) and sensitively conferring a bioluminescent phenotype to recipient cells. Importantly, detection was obtained either with cultivated recipient cells or with mock-infected clinical specimens 7.
For demonstration purposes, here we describe the method for the phage-mediated detection of a known Y. pestis isolate using a luxAB reporter phage constructed from the CDC plague diagnostic phage &#934;A1122 6,7 (Figure 1). A similar method, with minor modifications (e.g. change in growth temperature and media), may be used for the detection of B. anthracis isolates using the B. anthracis reporter phage W&#946;::luxAB 8. The method describes the phage-mediated transduction of a biolumescent phenotype to cultivated Y. pestis cells which are subsequently measured using a microplate luminometer. The major advantages of this method over the traditional phage lysis assays is the ease of use, the rapid results, and the ability to test multiple samples simultaneously in a 96-well microtiter plate format.
<img alt="Figure 1" src="/files/ftp_upload/2740/2740fig1.jpg" /> 
Figure 1. Detection schematic. The phage are mixed with the sample, the phage infects the cell, luxAB are expressed, and the cell bioluminesces. Sample processing is not necessary; the phage and cells are mixed and subsequently measured for light.

A simple method for the identification of priority bacterial pathogens is to use genetically engineered reporter phage. These reporter phage, which are specific to their particular host species, are capable of rapidly transducing a bioluminescent signal response to host cells. Herein, we describe the use of reporter phage for the detection of Yersinia pestis.

Yersinia pestis and Bacillus anthracis are Category A bacterial pathogens that are the causative agents of the plague and anthrax, respectively 1. ...

Development of Cell-type specific anti-HIV gp120 aptamers for siRNA delivery

The global epidemic of infection by HIV has created an urgent need for new classes of antiretroviral agents. The potent ability of small interfering (si)RNAs to inhibit the expression of complementary RNA transcripts is being exploited as a new class of therapeutics for a variety of diseases including HIV. Many previous reports have shown that novel RNAi-based anti-HIV/AIDS therapeutic strategies have considerable promise; however, a key obstacle to the successful therapeutic application and clinical translation of siRNAs is efficient delivery. Particularly, considering the safety and efficacy of RNAi-based therapeutics, it is highly desirable to develop a targeted intracellular siRNA delivery approach to specific cell populations or tissues. The HIV-1 gp120 protein, a glycoprotein envelope on the surface of HIV-1, plays an important role in viral entry into CD4 cells. The interaction of gp120 and CD4 that triggers HIV-1 entry and initiates cell fusion has been validated as a clinically relevant anti-viral strategy for drug discovery. 
Herein, we firstly discuss the selection and identification of 2'-F modified anti-HIV gp120 RNA aptamers. Using a conventional nitrocellulose filter SELEX method, several new aptamers with nanomolar affinity were isolated from a 50 random nt RNA library. In order to successfully obtain bound species with higher affinity, the selection stringency is carefully controlled by adjusting the conditions. The selected aptamers can specifically bind and be rapidly internalized into cells expressing the HIV-1 envelope protein. Additionally, the aptamers alone can neutralize HIV-1 infectivity. Based upon the best aptamer A-1, we also create a novel dual inhibitory function anti-gp120 aptamer-siRNA chimera in which both the aptamer and the siRNA portions have potent anti-HIV activities. Further, we utilize the gp120 aptamer-siRNA chimeras for cell-type specific delivery of the siRNA into HIV-1 infected cells. This dual function chimera shows considerable potential for combining various nucleic acid therapeutic agents (aptamer and siRNA) in suppressing HIV-1 infection, making the aptamer-siRNA chimeras attractive therapeutic candidates for patients failing highly active antiretroviral therapy (HAART).

Several 2&#x2019;-Fluoro RNA aptamers against HIV-1Ba-L gp120 with nanomole affinity are isolated from a RNA library by in vitro SELEX procedure. A new dual inhibitory function anti-gp120 aptamer-siRNA chimera is created and shows considerable promise for systemic anti-HIV therapy.

The global epidemic of infection by HIV has created an urgent need for new classes of antiretroviral agents. The potent ability of small interfering ...

Selection of Plasmodium falciparum Parasites for Cytoadhesion to Human Brain Endothelial Cells

Most human malaria deaths are caused by blood-stage Plasmodium falciparum parasites. Cerebral malaria, the most life-threatening complication of the disease, is characterised by an accumulation of Plasmodium falciparum infected red blood cells (iRBC) at pigmented trophozoite stage in the microvasculature of the brain2-4. This microvessel obstruction (sequestration) leads to acidosis, hypoxia and harmful inflammatory cytokines (reviewed in 5). Sequestration is also found in most microvascular tissues of the human body2, 3. The mechanism by which iRBC attach to the blood vessel walls is still poorly understood.
The immortalized Human Brain microvascular Endothelial Cell line (HBEC-5i) has been used as an in vitro model of the blood-brain barrier6. However, Plasmodium falciparum iRBC attach only poorly to HBEC-5i in vitro, unlike the dense sequestration that occurs in cerebral malaria cases. We therefore developed a panning assay to select (enrich) various P. falciparum strains for adhesion to HBEC-5i in order to obtain populations of high-binding parasites, more representative of what occurs in vivo.
A sample of a parasite culture (mixture of iRBC and uninfected RBC) at the pigmented trophozoite stage is washed and incubated on a layer of HBEC-5i grown on a Petri dish. After incubation, the dish is gently washed free from uRBC and unbound iRBC. Fresh uRBC are added to the few iRBC attached to HBEC-5i and incubated overnight. As schizont stage parasites burst, merozoites reinvade RBC and these ring stage parasites are harvested the following day. Parasites are cultured until enough material is obtained (typically 2 to 4 weeks) and a new round of selection can be performed. Depending on the P. falciparum strain, 4 to 7 rounds of selection are needed in order to get a population where most parasites bind to HBEC-5i. The binding phenotype is progressively lost after a few weeks, indicating a switch in variant surface antigen gene expression, thus regular selection on HBEC-5i is required to maintain the phenotype.
In summary, we developed a selection assay rendering P. falciparum parasites a more "cerebral malaria adhesive" phenotype. We were able to select 3 out of 4 P. falciparum strains on HBEC-5i. This assay has also successfully been used to select parasites for binding to human dermal and pulmonary endothelial cells. Importantly, this method can be used to select tissue-specific parasite populations in order to identify candidate parasite ligands for binding to brain endothelium. Moreover, this assay can be used to screen for putative anti-sequestration drugs7.

Selection of Plasmodium falciparum Parasites for Cytoadhesion to Human Brain Endothelial Cells

An in vitro model for cerebral malaria sequestration is described1. Plasmodium falciparum infected red blood cells are selected for binding to immortalized human brain microvascular endothelial cells. The selected parasites show a distinct phenotype. The selection process can be applied using various P. falciparum strains and endothelial cell lines.

Most human malaria deaths are caused by blood-stage Plasmodium falciparum parasites. Cerebral malaria, the most life-threatening complication of the ...

Introducing Shear Stress in the Study of Bacterial Adhesion

During bacterial infections a sequence of interactions occur between the pathogen and its host. Bacterial adhesion to the host cell surface is often the initial and determining step of the pathogenesis. Although experimentally adhesion is mostly studied in static conditions adhesion actually takes place in the presence of flowing liquid. First encounters between bacteria and their host often occur at the mucosal level, mouth, lung, gut, eye, etc. where mucus flows along the surface of epithelial cells. Later in infection, pathogens occasionally access the blood circulation causing life-threatening illnesses such as septicemia, sepsis and meningitis. A defining feature of these infections is the ability of these pathogens to interact with endothelial cells in presence of circulating blood. The presence of flowing liquid, mucus or blood for instance, determines adhesion because it generates a mechanical force on the pathogen. To characterize the effect of flowing liquid one usually refers to the notion of shear stress, which is the tangential force exerted per unit area by a fluid moving near a stationary wall, expressed in dynes/cm2. Intensities of shear stress vary widely according to the different vessels type, size, organ, location etc. (0-100 dynes/cm2). Circulation in capillaries can reach very low shear stress values and even temporarily stop during periods ranging between a few seconds to several minutes 1. On the other end of the spectrum shear stress in arterioles can reach 100 dynes/cm2 2. The impact of shear stress on different biological processes has been clearly demonstrated as for instance during the interaction of leukocytes with the endothelium 3. To take into account this mechanical parameter in the process of bacterial adhesion we took advantage of an experimental procedure based on the use of a disposable flow chamber 4. Host cells are grown in the flow chamber and fluorescent bacteria are introduced in the flow controlled by a syringe pump. We initially focused our investigations on the bacterial pathogen Neisseria meningitidis, a Gram-negative bacterium responsible for septicemia and meningitis. The procedure described here allowed us to study the impact of shear stress on the ability of the bacteria to: adhere to cells 1, to proliferate on the cell surface 5and to detach to colonize new sites 6 (Figure 1). Complementary technical information can be found in reference 7. Shear stress values presented here were chosen based on our previous experience1 and to represent values found in the literature. The protocol should be applicable to a wide range of pathogens with specific adjustments depending on the objectives of the study.

During the infection process, a key step is the adhesion of pathogens with host cells. In most instances this adhesion step occurs in the presence of mechanical stress generated by flowing liquid. We describe a technique that introduces shear stress as an important parameter in the study of bacterial adhesion.

During bacterial infections a sequence of interactions occur between the pathogen and its host. Bacterial adhesion to the host cell surface is often the ...

Saliva, Salivary Gland, and Hemolymph Collection from Ixodes scapularis Ticks

Ticks are found worldwide and afflict humans with many tick-borne illnesses. Ticks are vectors for pathogens that cause Lyme disease and tick-borne relapsing fever (Borrelia spp.), Rocky Mountain Spotted fever (Rickettsia rickettsii), ehrlichiosis (Ehrlichia chaffeensis and E. equi), anaplasmosis (Anaplasma phagocytophilum), encephalitis (tick-borne encephalitis virus), babesiosis (Babesia spp.), Colorado tick fever (Coltivirus), and tularemia (Francisella tularensis) 1-8. To be properly transmitted into the host these infectious agents differentially regulate gene expression, interact with tick proteins, and migrate through the tick 3,9-13. For example, the Lyme disease agent, Borrelia burgdorferi, adapts through differential gene expression to the feast and famine stages of the tick's enzootic cycle 14,15. Furthermore, as an Ixodes tick consumes a bloodmeal Borrelia replicate and migrate from the midgut into the hemocoel, where they travel to the salivary glands and are transmitted into the host with the expelled saliva 9,16-19.
As a tick feeds the host typically responds with a strong hemostatic and innate immune response 11,13,20-22. Despite these host responses, I. scapularis can feed for several days because tick saliva contains proteins that are immunomodulatory, lytic agents, anticoagulants, and fibrinolysins to aid the tick feeding 3,11,20,21,23. The immunomodulatory activities possessed by tick saliva or salivary gland extract (SGE) facilitate transmission, proliferation, and dissemination of numerous tick-borne pathogens 3,20,24-27. To further understand how tick-borne infectious agents cause disease it is essential to dissect actively feeding ticks and collect tick saliva. This video protocol demonstrates dissection techniques for the collection of hemolymph and the removal of salivary glands from actively feeding I. scapularis nymphs after 48 and 72 hours post mouse placement. We also demonstrate saliva collection from an adult female I. scapularis tick.

Saliva, Salivary Gland, and Hemolymph Collection from Ixodes scapularis Ticks

The collection of infected tick hemolymph, salivary glands, and saliva is important to study how tick-borne pathogens cause disease. In this protocol we demonstrate how to collect hemolymph and salivary glands from feeding Ixodes scapularis nymphs. We also demonstrate saliva collection from female I. scapularis adults.

Ticks are found worldwide and afflict humans with many tick-borne illnesses. Ticks are vectors for pathogens that cause Lyme disease and tick-borne ...

A New Screening Method for the Directed Evolution of Thermostable Bacteriolytic Enzymes

Directed evolution is defined as a method to harness natural selection in order to engineer proteins to acquire particular properties that are not associated with the protein in nature. Literature has provided numerous examples regarding the implementation of directed evolution to successfully alter molecular specificity and catalysis1. The primary advantage of utilizing directed evolution instead of more rational-based approaches for molecular engineering relates to the volume and diversity of variants that can be screened2. One possible application of directed evolution involves improving structural stability of bacteriolytic enzymes, such as endolysins. Bacteriophage encode and express endolysins to hydrolyze a critical covalent bond in the peptidoglycan (i.e. cell wall) of bacteria, resulting in host cell lysis and liberation of progeny virions. Notably, these enzymes possess the ability to extrinsically induce lysis to susceptible bacteria in the absence of phage and furthermore have been validated both in vitro and in vivo for their therapeutic potential3-5. The subject of our directed evolution study involves the PlyC endolysin, which is composed of PlyCA and PlyCB subunits6. When purified and added extrinsically, the PlyC holoenzyme lyses group A streptococci (GAS) as well as other streptococcal groups in a matter of seconds and furthermore has been validated in vivo against GAS7. Significantly, monitoring residual enzyme kinetics after elevated temperature incubation provides distinct evidence that PlyC loses lytic activity abruptly at 45 &deg;C, suggesting a short therapeutic shelf life, which may limit additional development of this enzyme. Further studies reveal the lack of thermal stability is only observed for the PlyCA subunit, whereas the PlyCB subunit is stable up to ~90 &deg;C (unpublished observation). In addition to PlyC, there are several examples in literature that describe the thermolabile nature of endolysins. For example, the Staphylococcus aureus endolysin LysK and Streptococcus pneumoniae endolysins Cpl-1 and Pal lose activity spontaneously at 42 &deg;C, 43.5 &deg;C and 50.2 &deg;C, respectively8-10. According to the Arrhenius equation, which relates the rate of a chemical reaction to the temperature present in the particular system, an increase in thermostability will correlate with an increase in shelf life expectancy11. Toward this end, directed evolution has been shown to be a useful tool for altering the thermal activity of various molecules in nature, but never has this particular technology been exploited successfully for the study of bacteriolytic enzymes. Likewise, successful accounts of progressing the structural stability of this particular class of antimicrobials altogether are nonexistent. In this video, we employ a novel methodology that uses an error-prone DNA polymerase followed by an optimized screening process using a 96 well microtiter plate format to identify mutations to the PlyCA subunit of the PlyC streptococcal endolysin that correlate to an increase in enzyme kinetic stability (Figure 1). Results after just one round of random mutagenesis suggest the methodology is generating PlyC variants that retain more than twice the residual activity when compared to wild-type (WT) PlyC after elevated temperature treatment.

A novel directed evolution method specific to the field of thermostability engineering was developed and consequently validated for bacteriolytic enzymes. After only one round of random mutagenesis, an evolved bacteriolytic enzyme, PlyC 29C3, displayed greater than twice the residual activity when compared to the wild-type protein after elevated temperature incubation.

Directed evolution is defined as a method to harness natural selection in order to engineer proteins to acquire particular properties that are not ...

Assays for the Identification of Novel Antivirals against Bluetongue Virus

To identify potential antivirals against BTV, we have developed, optimized and validated three assays presented here. The CPE-based assay was the first assay developed to evaluate whether a compound showed any antiviral efficacy and have been used to screen large compound library. Meanwhile, cytotoxicity of antivirals could also be evaluated using the CPE-based assay. The dose-response assay was designed to determine the range of efficacy for the selected antiviral, i.e. 50% inhibitory concentration (IC50) or effective concentration (EC50), as well as its range of cytotoxicity (CC50). The ToA assay was employed for the initial MoA study to determine the underlying mechanism of the novel antivirals during BTV viral lifecycle or the possible effect on host cellular machinery. These assays are vital for the evaluation of antiviral efficacy in cell culture system, and have been used for our recent researches leading to the identification of a number of novel antivirals against BTV.

Three assays, including the cytopathic effect (CPE)-based assay, dose-response assay and Time-of-Addition (ToA) assay have been developed, optimized, validated and utilized to identify novel antivirals against Bluetongue virus (BTV), as well as to determine the possible Mechanism-of-Action (MoA) for newly identified antivirals.

To identify potential antivirals against BTV, we have  developed, optimized and validated three assays presented here. The CPE-based  assay was the first ...

Scalable High Throughput Selection From  Phage-displayed Synthetic Antibody Libraries

The demand for antibodies that fulfill the needs of both basic and clinical research applications is high and will dramatically increase in the future. However, it is apparent that traditional monoclonal technologies are not alone up to this task. This has led to the development of alternate methods to satisfy the demand for high quality and renewable affinity reagents to all accessible elements of the proteome. Toward this end, high throughput methods for conducting selections from phage-displayed synthetic antibody libraries have been devised for applications involving diverse antigens and optimized for rapid throughput and success. Herein, a protocol is described in detail that illustrates with video demonstration the parallel selection of Fab-phage clones from high diversity libraries against hundreds of targets using either a manual 96 channel liquid handler or automated robotics system. Using this protocol, a single user can generate hundreds of antigens, select antibodies to them in parallel and validate antibody binding within 6-8 weeks. Highlighted are: i) a viable antigen format, ii) pre-selection antigen characterization, iii) critical steps that influence the selection of specific and high affinity clones, and iv) ways of monitoring selection effectiveness and early stage antibody clone characterization. With this approach, we have obtained synthetic antibody fragments (Fabs) to many target classes including single-pass membrane receptors, secreted protein hormones, and multi-domain intracellular proteins. These fragments are readily converted to full-length antibodies and have been validated to exhibit high affinity and specificity. Further, they have been demonstrated to be functional in a variety of standard immunoassays including Western blotting, ELISA, cellular immunofluorescence, immunoprecipitation and related assays. This methodology will accelerate antibody discovery and ultimately bring us closer to realizing the goal of generating renewable, high quality antibodies to the proteome.

A method is described with visual accompaniment for conducting scalable, high throughput selections from phage-displayed combinatorial synthetic antibody libraries against hundreds of antigens simultaneously. Using this parallel approach, we have isolated antibody fragments that exhibit high affinity and specificity for diverse antigens that are functional in standard immunoassays.

The demand for antibodies that fulfill the needs of both basic and clinical research applications is high and will dramatically increase in the future. ...

Generation and Multi-phenotypic High-content Screening of Coxiella burnetii Transposon Mutants

Invasion and colonization of host cells by bacterial pathogens depend on the activity of a large number of prokaryotic proteins, defined as virulence factors, which can subvert and manipulate key host functions. The study of host/pathogen interactions is therefore extremely important to understand bacterial infections and develop alternative strategies to counter infectious diseases. This approach however, requires the development of new high-throughput assays for the unbiased, automated identification and characterization of bacterial virulence determinants. Here, we describe a method for the generation of a GFP-tagged mutant library by transposon mutagenesis and the development of high-content screening approaches for the simultaneous identification of multiple transposon-associated phenotypes. Our working model is the intracellular bacterial pathogen Coxiellaburnetii, the etiological agent of the zoonosis Q fever, which is associated with severe outbreaks with a consequent health and economic burden. The obligate intracellular nature of this pathogen has, until recently, severely hampered the identification of bacterial factors involved in host pathogen interactions, making of Coxiella the ideal model for the implementation of high-throughput/high-content approaches.

Generation and Multi-phenotypic High-content Screening of Coxiella burnetii Transposon Mutants

Coxiella burnetii is an obligate intracellular Gram-negative bacterium responsible for the zoonotic disease Q fever. Here we describe methods for the generation of Coxiella fluorescent transposon mutants as well as the automated identification and analysis of the resulting internalization, replication and cytotoxic phenotypes.

Invasion and colonization of host cells by bacterial pathogens depend on the activity of a large number of prokaryotic proteins, defined as virulence ...

A Novel Feeder-free System for Mass Production of Murine Natural Killer Cells In Vitro

Natural killer (NK) cells belong to the innate immune system and are a first-line anti-cancer immune defense; however, they are suppressed in the tumor microenvironment and the underlying mechanism is still largely unknown. The lack of a consistent and reliable source of NK cells limits the research progress of NK cell immunity. Here, we report an in vitro system that can provide high quality and quantity of bone marrow-derived murine NK cells under a feeder-free condition. More importantly, we also demonstrate that siRNA-mediated gene silencing successfully inhibits the E4bp4-dependent NK cell maturation by using this system. Thus, this novel in vitro NK cell differentiating system is a biomaterial solution for immunity research.

A Novel Feeder-free System for Mass Production of Murine Natural Killer Cells In Vitro

Here, we present a protocol to mass-produce gene-silencing murine NK cells by using a feeder-free differentiation system for mechanistic study in vitro and in vivo.

Natural killer (NK) cells belong to the innate immune system and are a first-line anti-cancer immune defense; however, they are suppressed in the tumor ...

Bacterial Peptide Display for the Selection of Novel Biotinylating Enzymes

Podsumowanie

Przeglądaj więcej filmów

Rozdziały w tym wideo

'Bioluminescent' Reporter Phage for the Detection of Category A Bacterial Pathogens

Development of Cell-type specific anti-HIV gp120 aptamers for siRNA delivery

Selection of Plasmodium falciparum Parasites for Cytoadhesion to Human Brain Endothelial Cells

Introducing Shear Stress in the Study of Bacterial Adhesion

Saliva, Salivary Gland, and Hemolymph Collection from Ixodes scapularis Ticks

A New Screening Method for the Directed Evolution of Thermostable Bacteriolytic Enzymes

Assays for the Identification of Novel Antivirals against Bluetongue Virus

Scalable High Throughput Selection From Phage-displayed Synthetic Antibody Libraries

Generation and Multi-phenotypic High-content Screening of Coxiella burnetii Transposon Mutants

A Novel Feeder-free System for Mass Production of Murine Natural Killer Cells In Vitro