Name: establishing 3d endometrial organoids from the mouse uterus
Uploaded: 2023-01-06T13:10:00.000+00:00
Duration: 6 min 24 s
Description: Watch this Scientific Journal Video about Establishing 3D Endometrial Organoids from the Mouse Uterus at JoVE.com

We thank Dr. Stephanie Pangas and Dr. Martin M. Matzuk (M.M.M.) for critical reading and editing of our manuscript. Studies were supported by Eunice Kennedy Shriver National Institute of Child Health and Human Development grants R00-HD096057 (D.M.), R01-HD105800 (D.M.), R01-HD032067 (M.M.M.), and R01-HD110038 (M.M.M.), and by NCI- P30 Cancer Center Support Grant (NCI-CA125123). Diana Monsivais, Ph.D. holds&#160;a Next Gen Pregnancy Award from the Burroughs Wellcome Fund.

Mouse handling and experimental studies were performed under protocols approved by the Institutional Animal Care and Use Committee (IACUC) of Baylor College of Medicine and guidelines established by the NIH Guide for the Care and Use of Laboratory Animals.
1. Isolation of uterine epithelium from mice using enzymatic and mechanical methods
NOTE: This section describes the steps required to establish, passage, freeze, and thaw epithelial endometrial organoids from mice using a gel matrix scaffold. Previous studies have determined that optimal cultures of mouse endometrial organoids are established from mice during the estrus phase4, which can be determined by cytological examination of a vaginal swab15. Adult female WT mice (6-8 weeks old, hybrid C57BL/6J and 129S5/SvEvBrd) were used for all experiments. The mice were humanely euthanized according to IACUC-approved guidelines using isoflurane sedation followed by cervical disarticulation. Once the mice are euthanized, the following steps should be followed. See the Table of Materials for details related to materials and solutions used in this protocol.
<ol>
	<li>Allow the gel matrix to thaw on ice for approximately 1-2 h before use.</li>
	<li>To dissect the mouse, use scissors to make a mid-line incision on the abdomen and gently peel back the skin to expose the underlying peritoneal layer. Use forceps to hold up the peritoneal layer and make lateral incisions with the scissors to expose the abdominal contents.
	<ol>
		<li>Locate the uterine horns by gently moving the abdominal fat pads aside. Dissect them by first holding them at the cervical junction and using scissors to cut along the mesenteric fat. Following the dissection of the mouse uterus, thoroughly remove fat tissue from the uterine horn with small scissors. 
		NOTE: Maintain sterility during the cell isolation by sterilizing all surgery tools before use, spray the mouse abdomen with 70% ethanol, and perform all steps following dissection under a sterile tissue culture hood.</li>
	</ol>
	</li>
	<li>Cut each uterine horn into small fragments, each measuring approximately 4-5 mm.</li>
	<li>Place all the uterine fragments from one uterus into one well of a 24-well plate containing 0.5 mL of 1% Trypsin. Allow the enzymatic solution to enter the uterine lumen, causing enzymatic separation of the endometrial epithelium from the underlying stroma.</li>
	<li>Incubate the 24-well plate in a 37 &#730;C humidified tissue culture incubator for approximately 1 h.</li>
	<li>After the 1 h incubation, transfer the uterine fragments to a 35 mm tissue culture plate containing 1 mL of Dulbecco&#39;s phosphate-buffered solution (DPBS).</li>
	<li>Under a dissection microscope, use fine forceps and a 1 mL pipette to mechanically separate the uterine epithelium from the uterine tube. While holding down one end of a uterine fragment with the forceps, gently run the pipette tip longitudinally across the fragment, squeezing the epithelium out of the other end of the uterine tube. Observe the separated epithelial sheets from the uterine fragment under the dissection microscope.</li>
	<li>Use the 1 mL pipette to collect and gently transfer the epithelial sheets into a 1.5 mL tube.</li>
	<li>Repeat the process for the remaining uterine fragments, transferring all the epithelial sheets to the same collection tube.</li>
	<li>Pellet the dissociated epithelial sheets by centrifugation for 5 min at 375 &#215; g.</li>
	<li>Carefully remove the supernatant to avoid disturbing the cell pellet.</li>
	<li>Resuspend the cell pellet in 0.5 mL of 2.5 mg/mL collagenase + 2 mg/mL DNase solution. Pipette up and down approximately 10x, or until a single-cell suspension is achieved.</li>
	<li>Add 0.5 mL of DMEM/F12 + 10% fetal bovine serum (FBS) + antibiotics, and centrifuge the cells for 5 min at 375 &#215; g. 
	&#8203;NOTE: For additional information on the broad-spectrum antibiotic used for cell culture, refer to the Table of Materials.</li>
	<li>Carefully remove the supernatant and resuspend the cells in 1 mL of DMEM/F12 + 10% FBS + antibiotics. Centrifuge the cells for 5 min at 375 &#215; g.</li>
</ol>
2. Processing of the stromal compartment
NOTE: This section outlines the protocols necessary for isolating the stromal compartment of the mouse endometrium. Given the increasing interest in epithelial/stromal co-culture experiments, it is important to be able to process the stromal cell populations in addition to the epithelial cells that will generate organoids.
<ol>
	<li>Once all the epithelium has been enzymatically and mechanically separated from the uterine fragments, the remaining tube-like structures are the &#34;stromal/myometrial&#34; compartments. Collect this tissue in a 2.5 mg/mL collagenase + 2 mg/mL DNase in HBSS solution.</li>
	<li>Incubate the stromal/myometrial sample on a 37 &#730;C shaker for 15 min.</li>
	<li>Following incubation, add 500 &#181;L of DMEM/F12 + 10% FBS + antibiotics per mouse, and filter the non-dissociated fragments through a 40 &#181;m cell filter.</li>
	<li>Pellet the cells by centrifugation for 5 min at 375 &#215; g.</li>
	<li>Carefully remove the supernatant and resuspend the cell pellet in 1 mL of DMEM/F12 + 10% FBS + antibiotics. Add the mixture dropwise to 10 mL of DMEM/F12 + 10% FBS + antibiotics in a 10 cm cell culture plate. Incubate the plate at 37 &#730;C in a humidified cell culture incubator.</li>
	<li>To generate co-cultures of mouse endometrial epithelial and stromal cells, follow the methods described for human endometrial organoids using scaffold-free or collagen matrix systems6,8. 
	&#8203;NOTE: While these techniques have not yet been published for mice, they can be adapted based on the published protocols with human endometrium.</li>
</ol>
3. Encapsulation of uterine epithelium into gel matrix to establish organoids
NOTE: Keep the gel matrix on ice until it is ready to be used.
<ol>
	<li>Remove the supernatant and resuspend the cell pellet in a volume of gel matrix that is 20x that of the cell pellet (i.e., if the cell pellet is 20 &#181;L, resuspend the cells with 400 &#181;L of gel matrix). Resuspend the pellet carefully to avoid introducing bubbles.</li>
	<li>Allow the gel matrix/cell suspension to settle at room temperature for ~10 min.</li>
	<li>Once the gel matrix/cell suspension becomes a semi-solid gel, use a P200 micropipette with a wide bore 200 &#181;L tip to gently aspirate 25 &#181;L of the gel matrix/cell suspension. Dispense three separate 25 &#181;L domes per well of a 12-well plate, and allow the gel matrix to cure for 15 min in a 37 &#730;C humidified tissue culture incubator.</li>
	<li>After the gel matrix has cured, add 750 &#181;L of organoid medium to each well containing gel matrix domes. Incubate at 37 &#730;C in a humidified tissue culture incubator. 
	&#8203;NOTE: Organoid media formulation is noted in the Table of Materials. Organoids typically form within 4 days of initial culture.</li>
</ol>
4. Gene expression analysis of endometrial organoids following treatment with estradiol
NOTE: This section describes the methods used to profile the gene expression of endometrial epithelial organoids using real-time qPCR following treatment with estradiol (E2; see Table 1). Because the endometrium is under the cyclical control of the ovarian hormone E2, testing the responsiveness of the organoids to E2 is an important measure of physiological function. We have obtained high-quality RNA and generated sufficient mRNA to profile gene expression using qPCR and/or RNA-sequencing from our endometrial epithelial organoids. This section describes how to collect organoids and process them for downstream analysis of gene expression. The selected treatment medium reflects the one used to treat cultured endometrial cells. However, it should be noted that this treatment medium can be optimized accordingly, as done for the treating of human endometrial 3D cultures with hormones8,16,17.
<ol>
	<li>Culture the endometrial organoids as described above.</li>
	<li>Remove the organoid medium and replace it with 750 &#181;L of starvation medium four days after seeding. Incubate overnight.</li>
	<li>The following morning, remove the starvation medium. Add 750 &#181;L of treatment medium containing either vehicle or 10 nM E2. Incubate for 48 h.</li>
	<li>Proceed with RNA isolation following the kit manufacturer&#39;s protocol.</li>
</ol>
5. Histological analysis of endometrial organoids
NOTE: Imaging the morphological features of endometrial organoids is critical to evaluating the cellular effect of growth factors, genetic manipulations, or small molecule inhibitors. This section describes the techniques used to fix, process, and image endometrial epithelial organoids using histological stains and antibody immunofluorescent staining.
<ol>
	<li>Prepare 1.5 mL microcentrifuge tubes containing 1 mL of 4% paraformaldehyde in 1x PBS. Place them on ice.</li>
	<li>Aspirate the medium from the wells of the 12-well plate containing the organoids.</li>
	<li>Using a 1 mL pipette tip with a cut tip, transfer 500 &#181;L of 4% paraformaldehyde to each well and gently detach the gel matrix domes from the bottom of the plate.</li>
	<li>Gently aspirate the entire gel matrix domes into the pipette tip and transfer to the 1.5 mL microcentrifuge tube.</li>
	<li>Fix the organoids by placing them on a rotator at 4 &#730;C overnight.</li>
	<li>The following morning, centrifuge the tube at 600 &#215; g for 5 min to pellet the organoids. Gently remove the 4% paraformaldehyde solution with a pipette and discard. Wash the organoids 2x with 70% ethanol.</li>
	<li>After the last wash, remove all but 50-100 &#181;L of ethanol from the tube. Set the tube aside.</li>
	<li>Place a tube of specimen processing gel in a water bath and microwave for ~30 s to melt the gel. Ensure that the specimen processing gel does not boil over by monitoring the consistency of the gel. 
	NOTE: Once the specimen processing gel is melted, but not boiling hot, work quickly to encapsulate the organoids.</li>
	<li>Transfer enough specimen processing gel to cover the entire surface of the mold (approximately 250 &#181;L).</li>
	<li>While the specimen processing gel is still molten, quickly transfer the 50 &#181;L of 70% ethanol solution containing the organoids. Ensure that the organoids are sunken or pushed to the bottom portion of the mold.</li>
	<li>Place the histology mold on a bucket of ice and allow the specimen processing gel to cool and solidify.</li>
	<li>Once the specimen processing gel is completely dry, carefully transfer the specimen processing gel square to a specimen bag, keeping track of the plane where the organoids are located.</li>
	<li>Place the bag in a histology cassette and process using standard methods used for formalin fixation and paraffin embedding of tissues18.</li>
	<li>Following fixation and embedding in paraffin, section into 5 &#181;m sections using a microtome19. Proceed with standard hematoxylin and eosin (H&#38;E) staining or immunostaining procedures, as outlined below.</li>
</ol>
6. Hematoxylin &#38; eosin staining
<ol>
	<li>Deparaffinize the sections as follows: xylene, 2 x 10 min; 100% ethanol, 2 x 3 min; 80% ethanol, 3 min; 60% ethanol, 3 min; dH2O, 2 x 3 min; 1 min in hematoxylin; tap water (3 x 5 s); 1 min in eosin.</li>
	<li>Dehydrate the sections as follows: 60% ethanol, 3 min; 80% ethanol, 3 min; 95% ethanol, 3 min; 100% ethanol, 2 x 3 min; xylene, 2 x 15 min.</li>
	<li>Mount using mounting medium.</li>
</ol>
7. Immunofluorescence staining
<ol>
	<li>Deparaffinize the sections as described in step 6.1.</li>
	<li>Perform antigen retrieval
	<ol>
		<li>Submerge the slides in antigen retrieval solution in a microwave-safe container.</li>
		<li>Microwave at high heat for 20 min, using 5 min intervals to ensure that the solution does not boil over.</li>
	</ol>
	</li>
	<li>After the 20 min antigen retrieval step is complete, allow the slides to cool on ice for 40 min while still submerged in antigen retrieval buffer.</li>
	<li>Wash the slides with 1x TBST for 3 min</li>
	<li>Block the slides by incubating in 3% BSA in TBST for 1 h at room temperature.</li>
	<li>Primary antibody incubation
	<ol>
		<li>Dilute the antibody in 3% BSA in TBST (1:50-1:1,000, depending on Ab).</li>
		<li>Incubate overnight at 4 &#176;C in a humidified chamber.</li>
		<li>Wash 3 x 5 min with TBST.</li>
	</ol>
	</li>
	<li>Secondary antibody incubation
	<ol>
		<li>Dilute the antibody in 3% BSA (in TBST) (1:250), or in 5% normal donkey serum.</li>
		<li>Incubate for 1 h at room temperature (RT) in the dark, since the antibody is conjugated to a fluorophore.</li>
	</ol>
	</li>
	<li>Nuclear staining
	<ol>
		<li>Dilute 4&#8242;,6-diamidino-2-phenylindole (DAPI) 1:1,000 in TBST.</li>
		<li>Incubate for 5 min at RT.</li>
		<li>Wash 2 x 5 min with TBST.</li>
	</ol>
	</li>
	<li>Mounting
	<ol>
		<li>Use one drop of mounting medium to mount the coverslip.</li>
		<li>Seal the coverslip using nail polish the following day.</li>
	</ol>
	</li>
</ol>

The authors have no conflicts of interest to disclose.

Here, we describe methods to generate endometrial epithelial organoids from mouse endometrium and the protocols routinely used for their downstream analysis. Endometrial organoids are a powerful tool to study the mechanisms that control endometrial-related diseases, such as endometriosis, endometrial cancer, and implantation failure. Landmark studies published in 2017 reported the conditions to culture long-term and renewable cultures of endometrial organoids from mouse and human epithelium4,...

The endometrium - the inner lining mucosal tissue of the uterine cavity - is a unique and highly dynamic tissue that plays critical roles in a woman&#39;s reproductive health. During the reproductive lifespan, the endometrium holds the potential to undergo hundreds of cycles of proliferation, differentiation, and breakdown, coordinated by the concerted action of the ovarian hormones - estrogen and progesterone. Studies of genetically engineered mice have uncovered basic biological mechanisms underpinning the endometrial response to hormones and control of embryo implantation, stromal cell decidualization, and pregnancy1. In vitro studies, however, have been limited due to difficulties in maintaining non-transformed primary mouse endometrial tissues in traditional 2D cell cultures2,3. Recent advances in the culture of endometrial tissues as 3D organ systems, or organoids, present a novel opportunity to investigate biological pathways that control endometrial cell regeneration and differentiation. Mouse and human endometrial organoid systems have been developed from pure endometrial epithelium encapsulated in various matrices4,5, while human endometrium has been cultured as scaffold-free epithelial/stromal co-cultures6,7, and more recently as collagen-encapsulated epithelial/stromal assembloids8. The growth and regenerative potential of epithelial organoid cultures is supported by a defined cocktail of growth factors and small molecule inhibitors that have been empirically determined to maximize growth and regeneration of the organoids4,5,9. Furthermore, the ability to freeze and thaw endometrial organoids permits the long-term banking of endometrial organoids from mice and humans for future studies.
Genetically engineered mice have revealed the complex signaling pathways that control early pregnancy and decidualization, and have been used as models of pregnancy loss, endometrial cancer, and endometriosis. These genetic studies have been largely achieved with cell-specific deletion of loxP flanked alleles (&#34;floxed&#34;) using cre recombinases that are specifically active in female reproductive tissues. These mouse models include the widely used progesterone receptor-cre10, which has strong recombinase activity in the endometrial epithelial and stromal tissues, lactoferrin i-cre, which induces endometrial epithelial recombination in adult mice11, or Wnt7a-cre, which triggers epithelial-specific deletion in M&#252;llerian-derived tissues12. Culturing endometrial tissues from genetically engineered mouse models as 3D organoids has provided an excellent opportunity to investigate endometrial biology and facilitate the identification of growth factors and signaling pathways that control endometrial cell renewal and differentiation13,14. Methods for the isolation and culture of mouse endometrial tissue are described in the literature and report the use of various enzymatic strategies for the isolation of uterine epithelium for subsequent culturing of endometrial epithelial organoids4. While previous literature provides a critical framework for endometrial epithelial organoid culture protocols4,5,6, this paper provides a clear, comprehensive method for generating, maintaining, processing, and analyzing these organoids. Standardization of these techniques is important for accelerating advancements in the field of women&#39;s reproductive biology. Here, we report a detailed methodology for the enzymatic and mechanical purification of mouse endometrial epithelial tissue for the subsequent culture of endometrial organoids in a gel matrix scaffold. We also describe the methodologies for downstream histological and molecular analyses of the gel matrix-encapsulated mouse endometrial epithelial organoids.

<table><tbody><tr><td>&lt;strong&gt;Organoid Media Formulation&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>&lt;strong&gt;Name&lt;/strong&gt;</td><td>&lt;strong&gt;Company&lt;/strong&gt;</td><td>&lt;strong&gt;Catalog Number&lt;/strong&gt;</td><td>&lt;strong&gt;Final concentration&lt;/strong&gt;</td></tr><tr><td>Corning Matrigel Growth Factor Reduced (GFR) Basement Membrane Matrix, *LDEV-free</td><td>Corning</td><td>354230</td><td>100%</td></tr><tr><td>Trypsin from Bovine Pancreas</td><td>Sigma Aldrich</td><td>T1426-1G</td><td>1%</td></tr><tr><td>Advanced DMEM/F12</td><td>Life Technologies</td><td>12634010</td><td>1X</td></tr><tr><td>N2 supplement</td><td>Life Technologies</td><td>17502048</td><td>1X</td></tr><tr><td>B-27&amp;trade; Supplement (50X), minus vitamin A</td><td>Life Technologies</td><td>12587010</td><td>1X</td></tr><tr><td>Primocin</td><td>Invivogen</td><td>ant-pm-1</td><td>100 &amp;micro;g/mL</td></tr><tr><td>N-Acetyl-L-cysteine</td><td>Sigma Aldrich</td><td>A9165-5G</td><td>1.25 mM</td></tr><tr><td>L-glutamine</td><td>Life Technologies</td><td>25030024</td><td>2 mM</td></tr><tr><td>Nicotinamide</td><td>Sigma Aldrich</td><td>N0636-100G</td><td>10 nM</td></tr><tr><td>ALK-4, -5, -7 inhibitor, A83-01</td><td>Tocris</td><td>2939</td><td>500 nM</td></tr><tr><td>Recombinant human EGF</td><td>Peprotech</td><td>AF-100-15</td><td>50 ng/mL</td></tr><tr><td>Recombinant human Noggin</td><td>Peprotech</td><td>120-10C</td><td>100 ng/mL</td></tr><tr><td>Recombinant human Rspondin-1</td><td>Peprotech</td><td>120-38</td><td>500 ng/mL</td></tr><tr><td>Recombinant human FGF-10</td><td>Peprotech</td><td>100-26</td><td>100 ng/mL</td></tr><tr><td>Recombinant human HGF</td><td>Peprotech</td><td>100-39</td><td>50 ng/mL</td></tr><tr><td>WNT3a</td><td>R&amp;amp;D systems</td><td>5036-WN</td><td>200 ng/mL</td></tr><tr><td>&lt;strong&gt;Other supplies and reagents&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>&lt;strong&gt;Name&lt;/strong&gt;</td><td>&lt;strong&gt;Company&lt;/strong&gt;</td><td>&lt;strong&gt;Catalog Number&lt;/strong&gt;</td><td>&lt;strong&gt;Final concentration&lt;/strong&gt;</td></tr><tr><td>Collagenase from Clostridium histolyticum</td><td>Sigma Aldrich</td><td>C0130-1G</td><td>5 mg/mL</td></tr><tr><td>Deoxyribonuclease I from bovine pancreas</td><td>Sigma Aldrich</td><td>DN25-100MG</td><td>2 mg/mL</td></tr><tr><td>DPBS, no calcium, no magnesium</td><td>ThermoFisher</td><td>14190-250</td><td>1X</td></tr><tr><td>HBSS, no calcium, no magnesium</td><td>ThermoFisher</td><td>14170112</td><td>1X</td></tr><tr><td>Falcon&amp;nbsp;Polystyrene Microplates (24-Well)</td><td>Fisher Scientific</td><td>#08-772-51</td><td></td></tr><tr><td>Falcon&amp;nbsp;Polystyrene Microplates (12-Well)</td><td>Fisher Scientific</td><td>#0877229</td><td></td></tr><tr><td>Falcon Cell Strainers, 40 &amp;micro;m</td><td>Fisher Scientific</td><td>#08-771-1</td><td></td></tr><tr><td>Direct-zol RNA MiniPrep (50 &amp;micro;g)</td><td>Genesee Scientific</td><td>11-331</td><td></td></tr><tr><td>Trizol reagent</td><td>Invitrogen</td><td>15596026</td><td></td></tr><tr><td>DMEM/F-12, HEPES, no phenol red</td><td>ThermoFisher</td><td>11039021</td><td></td></tr><tr><td>Fetal Bovine Serum, Charcoal stripped</td><td>Sigma Aldrich</td><td>F6765-500ML</td><td>2%</td></tr><tr><td>Estratiol (E2)</td><td>Sigma Aldrich</td><td>E1024-1G</td><td>10 nM</td></tr><tr><td>Formaldehyde 16% in aqueous solution, EM Grade</td><td>VWR</td><td>15710</td><td>4%</td></tr><tr><td>Epredia Cassette 1 Slotted Tissue Cassettes</td><td>Fisher Scientific</td><td>1000961</td><td></td></tr><tr><td>Epredia Stainless-Steel Embedding Base Molds</td><td>Fisher Scientific</td><td>64-010-15&amp;nbsp;</td><td></td></tr><tr><td>Ethanol, 200 proof (100%)</td><td>Fisher Scientific</td><td>22-032-601&amp;nbsp;</td><td></td></tr><tr><td>Histoclear</td><td>Fisher Scientific</td><td>50-899-90147</td><td></td></tr><tr><td>Permount Mounting Medium</td><td>Fisher Scientific</td><td>50-277-97</td><td></td></tr><tr><td>Epredia Nylon Biopsy Bags</td><td>Fisher Scientific</td><td>6774010</td><td></td></tr><tr><td>HistoGel Specimen Processing Gel</td><td>VWR</td><td>83009-992</td><td></td></tr><tr><td>Hematoxylin solution Premium</td><td>VWR</td><td>95057-844</td><td></td></tr><tr><td>Eosin Y (yellowish) solution Premium</td><td>VWR</td><td>95057-848</td><td></td></tr><tr><td>TBS Buffer, 20X, pH 7.4</td><td>GenDEPORT</td><td>T8054</td><td>1X</td></tr><tr><td>TBST (10X), pH 7.4</td><td>GenDEPORT</td><td>T8056</td><td>1X</td></tr><tr><td>Citric acid&amp;nbsp;</td><td>Sigma Aldrich</td><td>C0759-1KG</td><td></td></tr><tr><td>Sodium citrate tribasic dihydrate</td><td>Sigma Aldrich</td><td>S4641-500G</td><td></td></tr><tr><td>Tween20</td><td>Fisher Scientific</td><td>BP337-500&amp;nbsp;</td><td></td></tr><tr><td>Bovine Serum Albumin (BSA)</td><td>Sigma Aldrich</td><td>A2153-100G</td><td>3%</td></tr><tr><td>DAPI Solution (1 mg/mL)</td><td>ThermoFisher</td><td>62248</td><td>1:1000 dilution</td></tr><tr><td>VECTASHIELD Antifade Mounting Medium</td><td>Vector Labs</td><td>H-1000-10</td><td></td></tr><tr><td>Clear Nail Polish</td><td>Fisher Scientific</td><td>NC1849418</td><td></td></tr><tr><td>Fisherbrand Superfrost Plus Microscope Slides</td><td>Fisher Scientific</td><td>22037246</td><td></td></tr><tr><td>VWR Micro Cover Glasses</td><td>VWR</td><td>48393-106</td><td></td></tr><tr><td>SuperScript VILO Master Mix</td><td>ThermoFisher</td><td>11755050</td><td></td></tr><tr><td>SYBR Green PCR Master Mix</td><td>ThermoFisher</td><td>4364346</td><td></td></tr><tr><td>Krt8 Antibody (TROMA-I)&amp;nbsp;</td><td>DSHB</td><td>TROMA-I&amp;nbsp;</td><td>1:50 dilution</td></tr><tr><td>Vimentin Antobody</td><td>Cell Signaling</td><td>5741S</td><td>1:200 dilution</td></tr><tr><td>Donkey anti-Rat IgG (H+L) Highly Cross-Adsorbed Secondary&lt;br/&gt; Antibody, Alexa Fluor 594</td><td>ThermoFisher</td><td>A-21209</td><td>1:250 dilution</td></tr><tr><td>Donkey anti-Rabbin IgG (H+L) Highly Cross-Adsorbed Secondary&lt;br/&gt; Antibody, Alexa Fluor 488</td><td>ThermoFisher</td><td>A-21206</td><td>1:250 dilution</td></tr><tr><td>ZEISS Stemi 508 Stereo Microscope</td><td>ZEISS</td><td></td><td></td></tr><tr><td>ZEISS Axio Vert.A1 Inverted Routine Microscope with digital camera</td><td>ZEISS</td><td></td><td></td></tr><tr><td>&lt;strong&gt;Primer Sequence&lt;/strong&gt;</td><td>&lt;strong&gt;Forward (5&#039;-3&#039;)&lt;/strong&gt;</td><td>&lt;strong&gt;Reverse (5&#039;-3&#039;)&lt;/strong&gt;</td><td>_</td></tr><tr><td>Lipocalin 2 (Lcn2)</td><td>GCAGGTGGTACGTTGTGGG</td><td>CTCTTGTAGCTCATAGATGGTGC</td><td></td></tr><tr><td>Lactoferrin (Ltf)</td><td>TGAGGCCCTTGGACTCTGT</td><td>ACCCACTTTTCTCATCTCGTTC</td><td></td></tr><tr><td>Progesterone (Pgr)</td><td>CCCACAGGAGTTTGTCAAGCTC</td><td>TAACTTCAGACATCATTTCCGG</td><td></td></tr><tr><td>Glyceraldehyde 3 phosphate dehydrogenase (Gapdh)</td><td>CAATGTGTCCGTCGTGGATCT</td><td>GCCTGCTTCACCACCTTCTT</td><td></td></tr></tbody></table>

establishing 3d endometrial organoids from the mouse uterus

Endometrial tissue lines the inner cavity of the uterus and is under the cyclical control of estrogen and progesterone. It is a tissue that is composed of luminal and glandular epithelium, a stromal compartment, a vascular network, and a complex immune cell population. Mouse models have been a powerful tool to study the endometrium, revealing critical mechanisms that control implantation, placentation, and cancer. The recent development of 3D endometrial organoid cultures presents a state-of-the-art model to dissect the signaling pathways that underlie endometrial biology. Establishing endometrial organoids from genetically engineered mouse models, analyzing their transcriptomes, and visualizing their morphology at a single-cell resolution are crucial tools for the study of endometrial diseases. This paper outlines methods to establish 3D cultures of endometrial epithelium from mice and describes techniques to quantify gene expression and analyze the histology of the organoids. The goal is to provide a resource that can be used to establish, culture, and study the gene expression and morphological characteristics of endometrial epithelial organoids.

Phase contrast images of mouse endometrial organoids 
We established organoids from WT mouse endometrial epithelium, as described in the attached protocol (see diagram in Figure 1). Following enzymatic dissociation of the mouse endometrial epithelium, epithelial sheets were mechanically separated from the uterine stromal cells and further dissociated with collagenase to generate a single-cell suspension. If performed correctly, this method of epithelial and stromal cell...

Watch this Scientific Journal Video about Establishing 3D Endometrial Organoids from the Mouse Uterus at JoVE.com

Establishing 3D Endometrial Organoids from the Mouse Uterus

This protocol describes methodologies to establish mouse endometrial epithelial organoids for gene expression and histological analyses.

Endometrial tissue lines the inner cavity of the uterus and is under the cyclical control of estrogen and progesterone. It is a tissue that is composed of ...

establishing-3d-endometrial-organoids-from-the-mouse-uterus

Research

JoVE Journal

Biology

5.9K Views.  Baylor College of Medicine. This protocol describes methodologies to establish mouse endometrial epithelial organoids for gene expression and histological analyses.

Video: Establishing 3D Endometrial Organoids from the Mouse Uterus

Mouse Model of Surgically-induced Endometriosis by Auto-transplantation of Uterine Tissue

Endometriosis is a chronic, painful disease whose etiology remains unknown. Furthermore, treatment of endometriosis can require laparoscopic removal of lesions, and/or chronic pharmaceutical management of pain and infertility symptoms. The cost associated with endometriosis has been estimated at 22 billion dollars per year in the United States1. To further our understanding of mechanisms underlying this enigmatic disease, animal models have been employed. Primates spontaneously develop endometriosis and therefore primate models most closely resemble the disease in women. Rodent models, however, are more cost effective and readily available2. The model that we describe here involves an autologous transfer of uterine tissue to the intestinal mesentery (Figure 1) and was first developed in the rat3 and later transferred to the mouse4. The goal of the autologous rodent model of surgically-induced endometriosis is to mimic the disease in women. We and others have previously shown that the altered gene expression pattern observed in endometriotic lesions from mice or rats mirrors that observed in women with the disease5,6. One advantage of performing the surgery in the mouse is that the abundance of transgenic mouse strains available can aid researchers in determining the role of specific components important in the establishment and growth of endometriosis. An alternative model in which excised human endometrial fragments are introduced to the peritoneum of immunocompromised mice is also widely used but is limited by the lack of a normal immune system which is thought to be important in endometriosis2,7. Importantly, the mouse model of surgically induced endometriosis is a versatile model that has been used to study how the immune system8, hormones9,10 and environmental factors11,12 affect endometriosis as well as the effects of endometriosis on fertility13 and pain14.

A description of the surgical induction of endometriosis in mice and rats by auto-transplantation of uterine tissue to the arterial cascade of the intestinal mesentery.

Endometriosis is a chronic, painful disease whose etiology remains unknown. Furthermore, treatment of endometriosis can require laparoscopic removal of ...

Medicine

Isolation of Mouse Endometrial Epithelial and Stromal Cells for In Vitro Decidualization

Decidualization is a progesterone-dependent differentiation process of endometrial stromal cells and is a prerequisite for successful embryo implantation. Although many efforts have been made to reveal the underlying mechanisms of decidualization, the exact signaling between the epithelial cells that are in contact with the embryo and the underlying stromal cells remains poorly understood. Therefore, studying decidualization in a way that takes both the epithelial and stromal cells into account could improve our knowledge about the molecular details of decidualization. For this purpose, in vivo models of artificial decidualization are physiologically the most relevant; however, manipulation of intercellular communication is limited. Currently, in vitro cultures of endometrial stromal cells are being used to investigate the modulation of decidualization by several signaling molecules. Conventionally, human or mouse endometrial stromal cells are used. However, the availability of human samples is very often limited. Furthermore, the use of murine tissues is accompanied with variety in the method of culturing. This study presents a validated and standardized method to obtain pure Endometrial Epithelial Cell (EEC) and Stromal Cell (ESC) cultures using adult intact mice treated with estrogen for three consecutive days. The protocol is optimized to improve the yield, viability, and purity of the cells and was further extended in order to study decidualization in a coculture of EEC and ESC. This model may be suitable to exploit the importance of both cell types in decidualization and to evaluate the contribution of significant signaling molecules secreted by EEC or ESC during the intercellular communication.

Isolation of Mouse Endometrial Epithelial and Stromal Cells for In Vitro Decidualization

This study presents a standardized and validated method for the isolation and culture of primary mouse endometrial stromal and epithelial cells, which can be used in a coculture system to study in vitro decidualization.

Decidualization is a progesterone-dependent differentiation process of endometrial stromal cells and is a prerequisite for successful embryo implantation. ...

Developmental Biology

Establishment and Analysis of Three-Dimensional (3D) Organoids Derived from Patient Prostate Cancer Bone Metastasis Specimens and their Xenografts

Three-dimensional (3D) culture of organoids from tumor specimens of human patients and patient-derived xenograft (PDX) models of prostate cancer, referred to as patient-derived organoids (PDO), are an invaluable resource for studying the mechanism of tumorigenesis and metastasis of prostate cancer. Their main advantage is that they maintain the distinctive genomic and functional heterogeneity of the original tissue compared to conventional cell lines that do not. Furthermore, 3D cultures of PDO can be used to predict the effects of drug treatment on individual patients and are a step towards personalized medicine. Despite these advantages, few groups routinely use this method in part because of the extensive optimization of PDO culture conditions that may be required for different patient samples. We previously demonstrated that our prostate cancer bone metastasis PDX model, PCSD1, recapitulated the resistance of the donor patient&rsquo;s bone metastasis to anti-androgen therapy. We used PCSD1 3D organoids to characterize further the mechanisms of anti-androgen resistance. Following an overview of currently published studies of PDX and PDO models, we describe a step-by-step protocol for 3D culture of PDO using domed or floating basement membrane (e.g., Matrigel) spheres in optimized culture conditions. In vivo stitch imaging and cell processing for histology are also described. This protocol can be further optimized for other applications including western blot, co-culture, etc. and can be used to explore characteristics of 3D cultured PDO pertaining to drug resistance, tumorigenesis, metastasis and therapeutics.

Establishment and Analysis of Three-Dimensional 3D Organoids Derived from Patient Prostate Cancer Bone Metastasis Specimens and their Xenografts

Three-dimensional cultures of patient BMPC specimens and xenografts of bone metastatic prostate cancer maintain the functional heterogeneity of their original tumors resulting in cysts, spheroids and complex, tumor-like organoids. This manuscript provides an optimization strategy and protocol for 3D culture of heterogeneous patient derived samples and their analysis using IFC.

Three-dimensional (3D) culture of organoids from tumor specimens of human patients and patient-derived xenograft (PDX) models of prostate cancer, referred ...

Cancer Research

Three-Dimensional Imaging of Organoids to Study Primary Ciliogenesis During ex vivo Organogenesis

Organoids are stem cell-derived three-dimensional structures that reproduce ex vivo the complex architecture and physiology of organs. Thus, organoids represent useful models to study the mechanisms that control stem cell self-renewal and differentiation in mammals, including primary ciliogenesis and ciliary signaling. Primary ciliogenesis is the dynamic process of assembling the primary cilium, a key cell signaling center that controls stem cell self-renewal and/or differentiation in various tissues. Here we present a comprehensive protocol for the immunofluorescence staining of cell lineage and primary cilia markers, in whole-mount mouse mammary organoids, for light sheet microscopy. We describe the microscopy imaging method and an image processing technique for the quantitative analysis of primary cilium assembly and length in organoids. This protocol enables a precise analysis of primary cilia in complex three-dimensional structures at the single cell level. This method is applicable for immunofluorescence staining and imaging of primary cilia and ciliary signaling in mammary organoids derived from normal and genetically modified stem cells, from healthy and pathological tissues, to study the biology of the primary cilium in health and disease.

Three-Dimensional Imaging of Organoids to Study Primary Ciliogenesis During ex vivo Organogenesis

Stem cell-derived organoids facilitate the analysis of molecular and cellular processes that regulate stem cell self-renewal and differentiation during organogenesis in mammalian tissues. Here we present a protocol for the analysis of the biology of the primary cilium in mouse mammary organoids.

Organoids are stem cell-derived three-dimensional structures that reproduce ex vivo the complex architecture and physiology of organs. Thus, organoids ...

Genetics

Generating and Imaging Mouse and Human Epithelial Organoids from Normal and Tumor Mammary Tissue Without Passaging

Organoids are a reliable method for modeling organ tissue due to their self-organizing properties and retention of function and architecture after propagation from primary tissue or stem cells. This method of organoid generation forgoes single-cell differentiation through multiple passages and instead uses differential centrifugation to isolate mammary epithelial organoids from mechanically and enzymatically dissociated tissues. This protocol provides a streamlined technique for rapidly producing small and large epithelial organoids from both mouse and human mammary tissue in addition to techniques for organoid embedding in collagen and basement extracellular matrix. Furthermore, instructions for in-gel fixation and immunofluorescent staining are provided for the purpose of visualizing organoid morphology and density. These methodologies are suitable for myriad downstream analyses, such as co-culturing with immune cells and ex vivo metastasis modeling via collagen invasion assay. These analyses serve to better elucidate cell-cell behavior and create a more complete understanding of interactions within the tumor microenvironment.

This protocol discusses an approach for generating epithelial organoids from primary normal and tumor mammary tissue through differential centrifugation. Furthermore, instructions are included for three-dimensional culturing as well as immunofluorescent imaging of embedded organoids.

Organoids are a reliable method for modeling organ tissue due to their self-organizing properties and retention of function and architecture after ...

Generation of Multicellular Human Primary Endometrial Organoids

The human endometrium is one of the most hormonally responsive tissues in the body and is essential for the establishment of pregnancy. This tissue can also become diseased and cause morbidity and even death. Model systems to study human endometrial biology have been limited to in vitro culture systems of single cell types. In addition, the epithelial cells, one of the major cell types of the endometrium, do not propagate well or retain their physiological traits in culture, and thus our understanding of endometrial biology remains limited. We have generated, for the first time, endometrial organoids that consist of both epithelial and stromal cells of the human endometrium. These organoids do not require any exogenous scaffold materials and specifically organize so that epithelial cells encompass the spheroid-like structure and become polarized with stromal cells in the center that produce and secrete collagen. Estrogen, progesterone and androgen receptors are expressed in the epithelial and stromal cells and treatment with physiological levels of estrogen and testosterone promote the organization of the organoids. This new model system can be used to study normal endometrial biology and disease in ways that were not possible before.

A protocol to generate human primary endometrial organoids that consist of epithelial and stromal cells and retain characteristics of the native endometrial tissue is presented. This protocol describes methods from uterine tissue acquisition to the histologic processing of endometrial organoids.

The human endometrium is one of the most hormonally responsive tissues in the body and is essential for the establishment of pregnancy. This tissue can ...

A Syngeneic Murine Model of Endometriosis using Naturally Cycling Mice

Endometriosis is a leading cause of pelvic pain and infertility. It is defined by the presence of endometrial tissue in extrauterine locations. The development of novel therapies and diagnostic tools for endometriosis has been limited due in part to challenges in studying the disease. Outside of primates, few mammals menstruate, and none develop spontaneous endometriosis. Rodent models are popular but require artificial induction of endometriosis, with many utilizing either immunocompromised mice or surgically induced disease. Recently, more attention has been given to models involving intraperitoneal injection. We present a murine model of endometriosis that integrates several features of existing endometriosis models into a novel, simplified system that relies on microscopic quantification in lieu of subjective grading. In this model, we perform hormonal stimulation of donor mice, intraperitoneal injection, systematic abdominal survey and tissue harvest, and histologic quantification that can be performed and verified at any time after necropsy. This model requires minimal resources and training; does not require expertise by lab technicians in murine survival surgery or in the identification of gross endometriotic lesions; can be used in immunocompromised, immunocompetent, and/or mutant mice; and reliably creates endometriotic lesions that are histologically consistent with human endometriotic disease.

Many rodent models of endometriosis are limited by technical complexity, reproducibility, and/or need for immunocompromised animals or special reporter mice. We present a simplified system of lesion induction using any experimental mouse with an independently verifiable, objective scoring system and with no requirement for ovariectomy or survival surgery.

Endometriosis is a leading cause of pelvic pain and infertility. It is defined by the presence of endometrial tissue in extrauterine locations. The ...

Development of a Novel Endometrioma-Simulating Mouse Model

Establishment of an Experimental Mouse Model of Endometrioma to Study its Related Infertility

Endometrioma (OMA), a subtype of endometriosis characterized by the formation of endometriotic cysts in the ovaries, affects 17-44% of individuals diagnosed with endometriosis. Women with OMA often experience compromised fertility, yet the exact mechanisms underlying OMA-associated infertility remain unclear. Notably, existing animal models simulate superficial peritoneal endometriosis (SUP) and deep infiltrating endometriosis (DIE), leaving a notable gap in research focused on OMA. In response to the gap of knowledge, this paper introduces a pioneering OMA-simulating mouse model and provides a comprehensive description of the techniques and procedures employed in the model. With a high success rate of 83% and ovarian lesion specificity, this model holds significant promise for advancing our understanding of OMA, particularly in the context of infertility. It offers a valuable platform for conducting targeted research into OMA-associated fertility challenges, potentially paving the way for improved diagnostic and therapeutic strategies in the field of reproductive medicine.

This study introduces a novel mouse model specifically designed to simulate endometrioma, a clinically significant subtype of endometriosis. By utilizing C57BL/6J mice, the model aims to elucidate the pathophysiological mechanisms underlying endometrioma-related infertility, offering a refined tool to bridge the current knowledge gap in reproductive medicine.

Endometrioma (OMA), a subtype of endometriosis characterized by the formation of endometriotic cysts in the ovaries, affects 17-44% of individuals ...

Evaluating Embryo Adhesion in an In Vitro Co-Culture Model with Ishikawa Cells

Establishment of an Embryo Implantation Model In Vitro

Embryo implantation is the first step in the establishment of a successful pregnancy. An in vitro model for embryo implantation is critical for basic biological research, drug development, and screening. This paper presents a simple, rapid, and highly efficient in vitro model for embryo implantation. In this protocol, we first introduce mouse blastocyst acquisition and human endometrial adenocarcinoma cells (Ishikawa)&#160;preparation for implantation, followed by the co-culture method for mouse embryos and Ishikawa cells. Finally, we conducted a study to assess the impact of varying concentrations of 17-&#946;-estradiol (E2) and progesterone (P4) on embryo adhesion rates based on this model. Our findings revealed that high concentrations of E2 significantly reduced embryo adhesion, whereas the addition of progesterone could restore the adhesion rate. This model offers a simple and fast platform for evaluating and screening molecules involved in the adhesion process, such as cytokines, drugs, and transcription factors controlling implantation and endometrial receptivity.

Author Spotlight: Advancing Therapeutic Strategies for Improving Pregnancy Rates by Analyzing Embryo-Endometrium Interactions

This protocol describes methodologies to establish simple and efficient embryo implantation in vitro model for evaluating the relevant molecules affecting the embryo implantation process.

Embryo implantation is the first step in the establishment of a successful pregnancy. An in vitro model for embryo implantation is critical for basic ...

Generation and Characterization of Rat Uterus Organoids from Rat Endometrial Epithelial Stem Cells

Endometrial organoids offer valuable insights into the development and pathophysiology of endometrial diseases and serve as platforms for drug testing. While human and mouse endometrial organoids have been developed, research on rat endometrial organoids remains limited. Given that rats can better simulate certain endometrial pathologies, such as intrauterine adhesions, this study aimed to establish rat endometrial organoids. We present a detailed protocol for the isolation and culture of rat endometrial epithelial stem cells (reESCs) and the generation of rat endometrial organoids. Using a refined reESCs expansion medium, we successfully isolated and stably expanded reESCs, demonstrating their long-term culture potential. The reESC-generated organoids exhibited typical structural and functional characteristics of the endometrium, including hormone responsiveness. Our results showed that rat endometrial organoids could be cultured over a long term with stable proliferation, maintaining the glandular structure, cell polarity, and functional characteristics of the endometrial epithelium. This novel rat-derived endometrial organoid model provides a valuable platform for studying endometrial diseases and testing therapeutic interventions, with potential applications across various mammalian species.

Here, we present a protocol to isolate and culture rat endometrial epithelial stem cells (reESCs), generating rat endometrial organoids. This method facilitates in vitro studies of endometrial diseases, enabling gene editing and other cellular manipulations.

Endometrial organoids offer valuable insights into the development and pathophysiology of endometrial diseases and serve as platforms for drug testing. ...

Establishing 3D Endometrial Organoids from the Mouse Uterus

Podsumowanie

Przeglądaj więcej filmów

Rozdziały w tym wideo

Mouse Model of Surgically-induced Endometriosis by Auto-transplantation of Uterine Tissue

Isolation of Mouse Endometrial Epithelial and Stromal Cells for In Vitro Decidualization

Establishment and Analysis of Three-Dimensional (3D) Organoids Derived from Patient Prostate Cancer Bone Metastasis Specimens and their Xenografts

Three-Dimensional Imaging of Organoids to Study Primary Ciliogenesis During ex vivo Organogenesis

Generating and Imaging Mouse and Human Epithelial Organoids from Normal and Tumor Mammary Tissue Without Passaging

Generation of Multicellular Human Primary Endometrial Organoids

A Syngeneic Murine Model of Endometriosis using Naturally Cycling Mice

Establishment of an Experimental Mouse Model of Endometrioma to Study its Related Infertility

Establishment of an Embryo Implantation Model In Vitro

Generation and Characterization of Rat Uterus Organoids from Rat Endometrial Epithelial Stem Cells