We thank Dr. Stephanie Pangas and Dr. Martin M. Matzuk (M.M.M.) for critical reading and editing of our manuscript. Studies were supported by Eunice Kennedy Shriver National Institute of Child Health and Human Development grants R00-HD096057 (D.M.), R01-HD105800 (D.M.), R01-HD032067 (M.M.M.), and R01-HD110038 (M.M.M.), and by NCI- P30 Cancer Center Support Grant (NCI-CA125123). Diana Monsivais, Ph.D. holds&#160;a Next Gen Pregnancy Award from the Burroughs Wellcome Fund.

Mouse handling and experimental studies were performed under protocols approved by the Institutional Animal Care and Use Committee (IACUC) of Baylor College of Medicine and guidelines established by the NIH Guide for the Care and Use of Laboratory Animals.
1. Isolation of uterine epithelium from mice using enzymatic and mechanical methods
NOTE: This section describes the steps required to establish, passage, freeze, and thaw epithelial endometrial org...

Here, we describe methods to generate endometrial epithelial organoids from mouse endometrium and the protocols routinely used for their downstream analysis. Endometrial organoids are a powerful tool to study the mechanisms that control endometrial-related diseases, such as endometriosis, endometrial cancer, and implantation failure. Landmark studies published in 2017 reported the conditions to culture long-term and renewable cultures of endometrial organoids from mouse and human epithelium4,...

The endometrium - the inner lining mucosal tissue of the uterine cavity - is a unique and highly dynamic tissue that plays critical roles in a woman&#39;s reproductive health. During the reproductive lifespan, the endometrium holds the potential to undergo hundreds of cycles of proliferation, differentiation, and breakdown, coordinated by the concerted action of the ovarian hormones - estrogen and progesterone. Studies of genetically engineered mice have uncovered basic biological mechanisms underpinning the endometrial response to hormones and control of embryo implantation, stromal cell decidualization, and pregnancy1. In vitro studies, however, have been limited due to difficulties in maintaining non-transformed primary mouse endometrial tissues in traditional 2D cell cultures2,3. Recent advances in the culture of endometrial tissues as 3D organ systems, or organoids, present a novel opportunity to investigate biological pathways that control endometrial cell regeneration and differentiation. Mouse and human endometrial organoid systems have been developed from pure endometrial epithelium encapsulated in various matrices4,5, while human endometrium has been cultured as scaffold-free epithelial/stromal co-cultures6,7, and more recently as collagen-encapsulated epithelial/stromal assembloids8. The growth and regenerative potential of epithelial organoid cultures is supported by a defined cocktail of growth factors and small molecule inhibitors that have been empirically determined to maximize growth and regeneration of the organoids4,5,9. Furthermore, the ability to freeze and thaw endometrial organoids permits the long-term banking of endometrial organoids from mice and humans for future studies.
Genetically engineered mice have revealed the complex signaling pathways that control early pregnancy and decidualization, and have been used as models of pregnancy loss, endometrial cancer, and endometriosis. These genetic studies have been largely achieved with cell-specific deletion of loxP flanked alleles (&#34;floxed&#34;) using cre recombinases that are specifically active in female reproductive tissues. These mouse models include the widely used progesterone receptor-cre10, which has strong recombinase activity in the endometrial epithelial and stromal tissues, lactoferrin i-cre, which induces endometrial epithelial recombination in adult mice11, or Wnt7a-cre, which triggers epithelial-specific deletion in M&#252;llerian-derived tissues12. Culturing endometrial tissues from genetically engineered mouse models as 3D organoids has provided an excellent opportunity to investigate endometrial biology and facilitate the identification of growth factors and signaling pathways that control endometrial cell renewal and differentiation13,14. Methods for the isolation and culture of mouse endometrial tissue are described in the literature and report the use of various enzymatic strategies for the isolation of uterine epithelium for subsequent culturing of endometrial epithelial organoids4. While previous literature provides a critical framework for endometrial epithelial organoid culture protocols4,5,6, this paper provides a clear, comprehensive method for generating, maintaining, processing, and analyzing these organoids. Standardization of these techniques is important for accelerating advancements in the field of women&#39;s reproductive biology. Here, we report a detailed methodology for the enzymatic and mechanical purification of mouse endometrial epithelial tissue for the subsequent culture of endometrial organoids in a gel matrix scaffold. We also describe the methodologies for downstream histological and molecular analyses of the gel matrix-encapsulated mouse endometrial epithelial organoids.

<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td colspan="4">Organoid Media Formulation</td>
		</tr>
		<tr>
			<td>Name</td>
			<td>Company</td>
			<td>Catalog Number</td>
			<td>Final concentration</td>
		</tr>
		<tr>
			<td>Corning Matrigel Growth Factor Reduced (GFR) Basement Membrane Matrix, *LDEV-free</td>
			<td>Corning</td>
			<td>354230</td>
			<td>100%</td>
		</tr>
		<tr>
			<td>Trypsin from Bovine Pancreas</td>
			<td>Sigma Aldrich</td>
			<td>T1426-1G</td>
			<td>1%</td>
		</tr>
		<tr>
			<td>Advanced DMEM/F12</td>
			<td>Life Technologies</td>
			<td>12634010</td>
			<td>1X</td>
		</tr>
		<tr>
			<td>N2 supplement</td>
			<td>Life Technologies</td>
			<td>17502048</td>
			<td>1X</td>
		</tr>
		<tr>
			<td>B-27&#8482; Supplement (50X), minus vitamin A</td>
			<td>Life Technologies</td>
			<td>12587010</td>
			<td>1X</td>
		</tr>
		<tr>
			<td>Primocin</td>
			<td>Invivogen</td>
			<td>ant-pm-1</td>
			<td>100 &#181;g/mL</td>
		</tr>
		<tr>
			<td>N-Acetyl-L-cysteine</td>
			<td>Sigma Aldrich</td>
			<td>A9165-5G</td>
			<td>1.25 mM</td>
		</tr>
		<tr>
			<td>L-glutamine</td>
			<td>Life Technologies</td>
			<td>25030024</td>
			<td>2 mM</td>
		</tr>
		<tr>
			<td>Nicotinamide</td>
			<td>Sigma Aldrich</td>
			<td>N0636-100G</td>
			<td>10 nM</td>
		</tr>
		<tr>
			<td>ALK-4, -5, -7 inhibitor, A83-01</td>
			<td>Tocris</td>
			<td>2939</td>
			<td>500 nM</td>
		</tr>
		<tr>
			<td>Recombinant human EGF</td>
			<td>Peprotech</td>
			<td>AF-100-15</td>
			<td>50 ng/mL</td>
		</tr>
		<tr>
			<td>Recombinant human Noggin</td>
			<td>Peprotech</td>
			<td>120-10C</td>
			<td>100 ng/mL</td>
		</tr>
		<tr>
			<td>Recombinant human Rspondin-1</td>
			<td>Peprotech</td>
			<td>120-38</td>
			<td>500 ng/mL</td>
		</tr>
		<tr>
			<td>Recombinant human FGF-10</td>
			<td>Peprotech</td>
			<td>100-26</td>
			<td>100 ng/mL</td>
		</tr>
		<tr>
			<td>Recombinant human HGF</td>
			<td>Peprotech</td>
			<td>100-39</td>
			<td>50 ng/mL</td>
		</tr>
		<tr>
			<td>WNT3a</td>
			<td>R&#38;D systems</td>
			<td>5036-WN</td>
			<td>200 ng/mL</td>
		</tr>
		<tr>
			<td>Other supplies and reagents</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Name</td>
			<td>Company</td>
			<td>Catalog Number</td>
			<td>Final concentration</td>
		</tr>
		<tr>
			<td>Collagenase from Clostridium histolyticum</td>
			<td>Sigma Aldrich</td>
			<td>C0130-1G</td>
			<td>5 mg/mL</td>
		</tr>
		<tr>
			<td>Deoxyribonuclease I from bovine pancreas</td>
			<td>Sigma Aldrich</td>
			<td>DN25-100MG</td>
			<td>2 mg/mL</td>
		</tr>
		<tr>
			<td>DPBS, no calcium, no magnesium</td>
			<td>ThermoFisher</td>
			<td>14190-250</td>
			<td>1X</td>
		</tr>
		<tr>
			<td>HBSS, no calcium, no magnesium</td>
			<td>ThermoFisher</td>
			<td>14170112</td>
			<td>1X</td>
		</tr>
		<tr>
			<td>Falcon&#160;Polystyrene Microplates (24-Well)</td>
			<td>Fisher Scientific</td>
			<td>#08-772-51</td>
			<td></td>
		</tr>
		<tr>
			<td>Falcon&#160;Polystyrene Microplates (12-Well)</td>
			<td>Fisher Scientific</td>
			<td>#0877229</td>
			<td></td>
		</tr>
		<tr>
			<td>Falcon Cell Strainers, 40 &#181;m</td>
			<td>Fisher Scientific</td>
			<td>#08-771-1</td>
			<td></td>
		</tr>
		<tr>
			<td>Direct-zol RNA MiniPrep (50 &#181;g)</td>
			<td>Genesee Scientific</td>
			<td>11-331</td>
			<td></td>
		</tr>
		<tr>
			<td>Trizol reagent</td>
			<td>Invitrogen</td>
			<td>15596026</td>
			<td></td>
		</tr>
		<tr>
			<td>DMEM/F-12, HEPES, no phenol red</td>
			<td>ThermoFisher</td>
			<td>11039021</td>
			<td></td>
		</tr>
		<tr>
			<td>Fetal Bovine Serum, Charcoal stripped</td>
			<td>Sigma Aldrich</td>
			<td>F6765-500ML</td>
			<td>2%</td>
		</tr>
		<tr>
			<td>Estratiol (E2)</td>
			<td>Sigma Aldrich</td>
			<td>E1024-1G</td>
			<td>10 nM</td>
		</tr>
		<tr>
			<td>Formaldehyde 16% in aqueous solution, EM Grade</td>
			<td>VWR</td>
			<td>15710</td>
			<td>4%</td>
		</tr>
		<tr>
			<td>Epredia Cassette 1 Slotted Tissue Cassettes</td>
			<td>Fisher Scientific</td>
			<td>1000961</td>
			<td></td>
		</tr>
		<tr>
			<td>Epredia Stainless-Steel Embedding Base Molds</td>
			<td>Fisher Scientific</td>
			<td>64-010-15&#160;</td>
			<td></td>
		</tr>
		<tr>
			<td>Ethanol, 200 proof (100%)</td>
			<td>Fisher Scientific</td>
			<td>22-032-601&#160;</td>
			<td></td>
		</tr>
		<tr>
			<td>Histoclear</td>
			<td>Fisher Scientific</td>
			<td>50-899-90147</td>
			<td></td>
		</tr>
		<tr>
			<td>Permount Mounting Medium</td>
			<td>Fisher Scientific</td>
			<td>50-277-97</td>
			<td></td>
		</tr>
		<tr>
			<td>Epredia Nylon Biopsy Bags</td>
			<td>Fisher Scientific</td>
			<td>6774010</td>
			<td></td>
		</tr>
		<tr>
			<td>HistoGel Specimen Processing Gel</td>
			<td>VWR</td>
			<td>83009-992</td>
			<td></td>
		</tr>
		<tr>
			<td>Hematoxylin solution Premium</td>
			<td>VWR</td>
			<td>95057-844</td>
			<td></td>
		</tr>
		<tr>
			<td>Eosin Y (yellowish) solution Premium</td>
			<td>VWR</td>
			<td>95057-848</td>
			<td></td>
		</tr>
		<tr>
			<td>TBS Buffer, 20X, pH 7.4</td>
			<td>GenDEPORT</td>
			<td>T8054</td>
			<td>1X</td>
		</tr>
		<tr>
			<td>TBST (10X), pH 7.4</td>
			<td>GenDEPORT</td>
			<td>T8056</td>
			<td>1X</td>
		</tr>
		<tr>
			<td>Citric acid&#160;</td>
			<td>Sigma Aldrich</td>
			<td>C0759-1KG</td>
			<td></td>
		</tr>
		<tr>
			<td>Sodium citrate tribasic dihydrate</td>
			<td>Sigma Aldrich</td>
			<td>S4641-500G</td>
			<td></td>
		</tr>
		<tr>
			<td>Tween20</td>
			<td>Fisher Scientific</td>
			<td>BP337-500&#160;</td>
			<td></td>
		</tr>
		<tr>
			<td>Bovine Serum Albumin (BSA)</td>
			<td>Sigma Aldrich</td>
			<td>A2153-100G</td>
			<td>3%</td>
		</tr>
		<tr>
			<td>DAPI Solution (1 mg/mL)</td>
			<td>ThermoFisher</td>
			<td>62248</td>
			<td>1:1000 dilution</td>
		</tr>
		<tr>
			<td>VECTASHIELD Antifade Mounting Medium</td>
			<td>Vector Labs</td>
			<td>H-1000-10</td>
			<td></td>
		</tr>
		<tr>
			<td>Clear Nail Polish</td>
			<td>Fisher Scientific</td>
			<td>NC1849418</td>
			<td></td>
		</tr>
		<tr>
			<td>Fisherbrand Superfrost Plus Microscope Slides</td>
			<td>Fisher Scientific</td>
			<td>22037246</td>
			<td></td>
		</tr>
		<tr>
			<td>VWR Micro Cover Glasses</td>
			<td>VWR</td>
			<td>48393-106</td>
			<td></td>
		</tr>
		<tr>
			<td>SuperScript VILO Master Mix</td>
			<td>ThermoFisher</td>
			<td>11755050</td>
			<td></td>
		</tr>
		<tr>
			<td>SYBR Green PCR Master Mix</td>
			<td>ThermoFisher</td>
			<td>4364346</td>
			<td></td>
		</tr>
		<tr>
			<td>Krt8 Antibody (TROMA-I)&#160;</td>
			<td>DSHB</td>
			<td>TROMA-I&#160;</td>
			<td>1:50 dilution</td>
		</tr>
		<tr>
			<td>Vimentin Antobody</td>
			<td>Cell Signaling</td>
			<td>5741S</td>
			<td>1:200 dilution</td>
		</tr>
		<tr>
			<td>Donkey anti-Rat IgG (H+L) Highly Cross-Adsorbed Secondary 
			Antibody, Alexa Fluor 594</td>
			<td>ThermoFisher</td>
			<td>A-21209</td>
			<td>1:250 dilution</td>
		</tr>
		<tr>
			<td>Donkey anti-Rabbin IgG (H+L) Highly Cross-Adsorbed Secondary 
			Antibody, Alexa Fluor 488</td>
			<td>ThermoFisher</td>
			<td>A-21206</td>
			<td>1:250 dilution</td>
		</tr>
		<tr>
			<td>ZEISS Stemi 508 Stereo Microscope</td>
			<td>ZEISS</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>ZEISS Axio Vert.A1 Inverted Routine Microscope with digital camera</td>
			<td>ZEISS</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Primer Sequence</td>
			<td>Forward (5&#39;-3&#39;)</td>
			<td>Reverse (5&#39;-3&#39;)</td>
			<td>_</td>
		</tr>
		<tr>
			<td>Lipocalin 2 (Lcn2)</td>
			<td>GCAGGTGGTACGTTGTGGG</td>
			<td>CTCTTGTAGCTCATAGATGGTGC</td>
			<td></td>
		</tr>
		<tr>
			<td>Lactoferrin (Ltf)</td>
			<td>TGAGGCCCTTGGACTCTGT</td>
			<td>ACCCACTTTTCTCATCTCGTTC</td>
			<td></td>
		</tr>
		<tr>
			<td>Progesterone (Pgr)</td>
			<td>CCCACAGGAGTTTGTCAAGCTC</td>
			<td>TAACTTCAGACATCATTTCCGG</td>
			<td></td>
		</tr>
		<tr>
			<td>Glyceraldehyde 3 phosphate dehydrogenase (Gapdh)</td>
			<td>CAATGTGTCCGTCGTGGATCT</td>
			<td>GCCTGCTTCACCACCTTCTT</td>
			<td></td>
		</tr>
	</tbody>
</table>

establishing 3d endometrial organoids from the mouse uterus

Endometrial tissue lines the inner cavity of the uterus and is under the cyclical control of estrogen and progesterone. It is a tissue that is composed of luminal and glandular epithelium, a stromal compartment, a vascular network, and a complex immune cell population. Mouse models have been a powerful tool to study the endometrium, revealing critical mechanisms that control implantation, placentation, and cancer. The recent development of 3D endometrial organoid cultures presents a state-of-the-art model to dissect the signaling pathways that underlie endometrial biology. Establishing endometrial organoids from genetically engineered mouse models, analyzing their transcriptomes, and visualizing their morphology at a single-cell resolution are crucial tools for the study of endometrial diseases. This paper outlines methods to establish 3D cultures of endometrial epithelium from mice and describes techniques to quantify gene expression and analyze the histology of the organoids. The goal is to provide a resource that can be used to establish, culture, and study the gene expression and morphological characteristics of endometrial epithelial organoids.

Phase contrast images of mouse endometrial organoids 
We established organoids from WT mouse endometrial epithelium, as described in the attached protocol (see diagram in Figure 1). Following enzymatic dissociation of the mouse endometrial epithelium, epithelial sheets were mechanically separated from the uterine stromal cells and further dissociated with collagenase to generate a single-cell suspension. If performed correctly, this method of epithelial and stromal cell...

Watch this Scientific Journal Video about Establishing 3D Endometrial Organoids from the Mouse Uterus at JoVE.com

Establishing 3D Endometrial Organoids from the Mouse Uterus

This protocol describes methodologies to establish mouse endometrial epithelial organoids for gene expression and histological analyses.

Endometrial tissue lines the inner cavity of the uterus and is under the cyclical control of estrogen and progesterone. It is a tissue that is composed of ...

This protocol is significant as it shows a step-by-step methodology for isolating highly pure uterine epithelium from the mouse uterus for the culture of endometrial organoids. This method efficiently utilizes enzymatic and mechanical dissociation to isolate uterine epithelium. The techniques were streamlined to establish, treat, and analyze endometrial epithelium organoids derived from the isolated epithelium.Begin by thawing the gel matrix on ice for approximately one to two hours before use. Then dissect the euthanized mouse by making a midline incision on the abdomen using scissors, and gently peeling back the skin to expose the underlying peritoneal layer. Locate the uterine horns by gently moving the abdominal fat pads aside and hold the uterine horns at the cervical junction before cutting them along the mesenteric fat.Following the dissection of the mouse uterus, thoroughly remove fat tissue from the uterine horn with small scissors. Once done, cut each uterine horn into small fragments, each measuring approximately four to five millimeters. Place all the uterine fragments from one uterus into one well of a 24 well plate containing 0.5 milliliters of 1%trypsin.Then incubate the 24 well plate in a 37 degree Celsius humidified tissue culture incubator for approximately one hour for enzymatic separation of the endometrial epithelium from the underlying stroma. After the incubation, transfer the uterine fragments to a 35 millimeter tissue culture plate containing one milliliter of Dulbecco's phosphate buffered solution or DPBS. Next, separate the uterine epithelium from the uterine tube under a dissection microscope by holding one end of a uterine fragment with the forceps and gently running the pipette tip longitudinally across the fragment, squeezing the epithelium out of the other end of the uterine tube.Then observe the separated epithelial sheets from the uterine fragment under the dissection microscope. Next, gently transfer all the epithelial sheets into the same 1.5 milliliter tube using the one milliliter pipette. And pellet the dissociated epithelial sheets by centrifugation at 375 x g for five minutes.Carefully remove the supernatant without disturbing the cell pellet and resuspend the cell pellet in 0.5 milliliters of 2.5 milligrams per milliliter collagenase plus two milligrams per milliliter of DNA solution. Pipette up and down approximately 10 times or until a single cell suspension is achieved. Next, add 0.5 milliliters of DMEM F/12 plus 10%fetal bovine serum or FBS plus antibiotics and centrifuge the cells for five minutes at 375 x g.Remove the supernatant, resuspend the cells in one milliliter DMEM/F12 plus 10%FBS plus antibiotics and centrifuge the cells. Place the gel matrix on ice until it is ready. Next, remove the supernatant from the centrifuge cells and resuspend the cell pellet using 20 times the volume of the gel matrix without introducing the bubbles.Allow the gel matrix cell suspension to settle at room temperature for approximately 10 minutes. Once the gel matrix cell suspension becomes a semi-solid gel, use a P200 micropipette with a wide bore 200 microliter tip and gently aspirate 25 microliters of the gel matrix cell suspension. Dispense three separate 25 microliter domes per well of a 12 well plate and allow the gel matrix to cure for 15 minutes and a 37 degree Celsius humidified tissue culture incubator.After the gel matrix is cured, add 750 microliters of organoid medium to each well containing gel matrix dome, and incubator at 37 degrees Celsius in a humidified tissue culture incubator. Phase contrast images of mouse endometrial organoids showed that the epithelial and stromal cell separation yielded samples with no more than 10%to 15%contamination of the opposite cell type. The endometrial epithelial cells were assembled into organoids within three to four days.The sectioned formalin fixed paraffin embedded endometrial organoids were visualized by hematoxylin and eosin stains, which displayed the single layer of epithelium and hollow centers, the lumens of the organoids. The fluorescence microscope imaging showed that all the cells in the organoids were Cytokeratin 8-positive and contained DAPI, indicating that fixation, embedding, and processing of the endometrial organoids is compatible with antibody-based immunostaining. The realtime quantitative PCR showed that the stimulation with 10 nanomolar estradiol increased the expression of lipocalin 2, lactoferrin, and progesterone receptor in the epithelial organoids, indicating that endometrial epithelial organoids can be successfully used to measure the gene expression changes in response to estradiol.It's important to ensure that clear separation of the endometrial epithelium is obtained during the mechanical dissociation step. One should be able to observe epithelium emerging from the uterine tube. Other methods include establishing the epithelial organoids by encapsulation into a gel matrix.If desired, the stromal compartment can be further digested to create 3D epithelial stromal co-cultures. The method can help answer questions about the signals controlling the renewal of the endometrium. It could help treat disease in women, such as endometriosis, pregnancy loss, and cancer.

establishing-3d-endometrial-organoids-from-the-mouse-uterus

Research

JoVE Journal

Biology

5.4K visualizações.  Baylor College of Medicine. Este protocolo é significativo, pois mostra uma metodologia passo-a-passo para isolar o epitélio uterino altamente puro do útero de camundongo para a cultura de organoides endometriais. Este método utiliza eficientemente dissociação enzimática e mecânica para isolar o epitélio uterino. As técnicas foram simplificadas para estabelecer, tratar e analisar organoides do epitélio endometrial derivados do epitélio isolado.Comece descongelando a matriz de gel no gelo por aproximad...