We acknowledge Dou Liu, Dongliang Xu, and Pinpin Hou from the core facility of the Shanghai Immune Therapy Institute for their support in utilizing the instruments. This work was supported by National Natural Science Foundation of China Grants 31930038, U21A20199, 32100718, and 32350007(to Linrong Lu); 32100718 (to Xuexiao Jin); Innovative research team of high-level local universities in Shanghai SHSMU-ZLCX 20211600 (to Linrong Lu); Internal Incubation Program RJTJ24-QN-076(to Zejin Cui).&#160;Figure 2&#160;was prepared with Figdraw.

&#8203;All procedures were approved by the Experimental Animal Welfare Ethics Committee, Renji Hospital, Shanghai Jiao Tong University School of Medicine and are in compliance with institutional guidelines.
1. Retroviral production
<ol>
	<li>&#160;Preparation of retroviral construct
	<ol>
		<li>Use the CRISPick tool (https://portals.broadinstitute.org/gppx/crispick/public) to design the sgRNA for ROR&#947;t knockout8. Specify the reference genome as Mouse GRCm38, and choose the PAM sequence as NGG (for SpyoCas9, Hsu (2013) tracrRNA) based on CRISPRko guide system. Validate the target gene&#39;s name or other target gene formats and submit the valid input to obtain sgRNA candidates. Setting other parameters to default values, set sgRNA target to ROR&#947;t (Rorc, Gene ID: 19885) to disturb the differentiation of Th17 and select non-targeting sgRNA (abbr. sgNT, sequence: GCGAGGTATTCGGCTCCGCG) from the mouse GeCKO v2 libraries. 
		NOTE: This tool offers a range of clickable options for designing guide RNAs, allowing for convenient customization to meet specific requirements.
		<ol>
			<li>Enter the target gene name in the search box under the Quick Gene Lookup column. The system will display the gene ID and the full name of the target gene to ensure accurate selection. 
			NOTE: Additional options are available for validating different target gene formats.</li>
		</ol>
		</li>
		<li>Choose one sgRNA targeted on Rorc (abbr. sgRorc) sequence according to the high combined rank and pick order to avoid off-target matches and increase on-target efficacy (sgRorc sequence: GTCATCTGGGATCCACTACG). Synthesize two oligonucleotides for sgRorc and sgNT: for the forward oligo, append the sequence &#34;gttttagagctagaaatagcaagttaaaat&#34; to the 5&#39; end of each guide sequence; for the reverse oligo, append the sequence &#34;tttcgtcctttccacaagatatataaagc&#34; to the 3&#39; end of each guide sequence. 
		NOTE: Typically, multiple options exist for sgRNA sequences. It is essential to select 2 or 3 sgRNA sequences targeting the same genotype to assess their knockout efficiency. In our preliminary experiments, two gRNAs target to Rorc were selected for comparison (sgRNA sequence1: GTCATCTGGGATCCACTACG; sgRNA sequence2: CTTGAGTATAGTCCAGAACG). Experimental results indicated that the gRNA presented in the current method (sgRNA sequence1) exhibits higher knockout efficiency between the two.</li>
		<li>Amplify the sgRorc and sgNT coding sequences using DNA polymerase in PCR with the above primers and clone them into pMX-U6-MCS vector (between the regions of U6 promoter and the gRNA scaffold) in frame with mCherry fluorescent protein, respectively9. Set up the reaction system (50 &#181;L) as Table 1. Those primers consist of sgRNA sequence (3&#39;), which can insert the sgRNA into the vector, and a segment of vector sequence (5&#39;), which can amplify the full-length vector fragment. Additionally, design the forward and reverse primers with an overlap of approximately 18 bp within the sgRNA region (but not fully overlapping), facilitating the assembly of the linearized cloning vector during the ligation process. 
		NOTE: A linearized vector fragment at the site of sgRNA sequence with primers by PCR of approximately 5,551 kd should be obtained.</li>
		<li>Purify the construct using a gel extraction kit and circularize it using a cloning kit. Use the recombination products for transformation assays.</li>
		<li>Pick the single clones from plates and verify sgRorc or sgNT-coding sequences via first-generation sequencing, using U6 promoter primer (sequence: ATGGACTATCATATGCTTACCGTA).</li>
		<li>Select the desired single clone for amplification in the LB broth. Extract high-quality plasmid DNA from bacterial cells by using an endotoxin-free plasmid kit. 
		NOTE: Make sure that plasmid solution has a high quality. We recommend that the concentration of plasmid solution should be at least 1 &#181;g/&#181;L.</li>
	</ol>
	</li>
	<li>Preparation of packaging cells
	<ol>
		<li>Prepare Platinum-E (Plat-E) cells using the following procedure: culture Plat-E cells with Dulbecco&#39;s Modified Eagle&#39;s Medium (DMEM medium) containing 10% fetal bovine serum (FBS), 100 units/mL penicillin, and 0.1 mg/mL streptomycin in a 10 cm culture dish. It will be referred to as the cell culture medium in the following. 
		NOTE: To obtain the proper transfection efficiency, we recommend using cells in the logarithmic growth phase with less than 15 passage numbers.</li>
		<li>Split a full plate of 10 cm Plat-E cells (~2.6 &#215; 107 cells) at a proper ratio into a new 10 cm dish 1 day before transfection to achieve a cell confluency of approximately 80% the next day, which is the optimal condition for transfection. Perform cell passaging for a new 10 cm dish at a 1:3 ratio (seed ~8 &#215; 106 cells in a new 10 cm dish the day before transfection). 
		NOTE: The split ratio is contingent upon the growth condition of the cells, with higher transfection efficiency achievable in cells exhibiting robust growth. We perform cell passaging for a 10 cm dish at a 1:3 ratio. For different cell culture dishes, such as a 6 cm dish, we recommend that 1.5 &#215; 106 Plat-E cells should be seeded the day before transfection.</li>
	</ol>
	</li>
	<li>Transfection
	<ol>
		<li>One hour before transfection, substitute the cell culture medium with 8 mL of reduced serum medium without phenol red with 5% FBS, but without penicillin-streptomycin, as it may interfere with the transfection reagent. Warm the reduced serum medium to 37 &#176;C&#160;before use.</li>
		<li>Prepare the transfection mixture containing mix 1 and mix 2: mix 1 includes 18 &#181;g of plasmid DNA (pMXs-U6-MCS-sgNT-mCherry/pMXs-U6-MCS-sgRorc-mCherry) and 6 &#181;g of pCL-Ecotropic Retroviral Vector (pCL-Eco) in 1,000 &#181;L of reduced serum medium. Mix 2 contains 48 &#181;L of transfection reagent in 1,000 &#181;L of reduced serum medium. Add mix 2 drop by drop into mix 1 and mix gently and thoroughly. Incubate the complex for 15-20 min at 20-25 &#176;C.</li>
		<li>Carefully drip the mixture into the Plat-E cells, swirling the plate gently to ensure even distribution. Incubate the cells at 37 &#176;C&#160;under 5% CO2 for 6-12 h.</li>
		<li>Replace the medium with 10 mL of fresh cell culture medium and continue incubating the cells at 37 &#176;C, 5% CO2 for 48 h.</li>
		<li>Assess the transfection efficiency in Plat-E cells by detecting the retroviral vector tag, serving as a proxy, via fluorescence microscopy or flow cytometry. 
		NOTE: A strong mCherry fluorescence (the fluorescence positive exceeds 80%) signal was detected in a considerable proportion of Plat-E cells transfected with the pMX-U6-MCS vector, indicating successful transfection.</li>
		<li>Harvest the virus-containing culture supernatant and centrifuge at 1,500 &#215; g for 10 min to remove cell fragments. Aliquot the virus supernatant 1 mL per vial and store at -80 &#176;C. 
		NOTE: Filtration is an alternative method for removing cell debris. We recommend using a syringe filter with a 0.45 &#181;m pore size and a polyethersulfone (PES) membrane to minimize the retention of viral particles on the filter membrane.</li>
	</ol>
	</li>
</ol>
2. Retroviral infection of activated CD4 + T cells and Th17 differentiation
<ol>
	<li>Prepare and activate primary na&#239;ve CD4+ T cells
	<ol>
		<li>Coat each well of a 24-well cell culture plate with 2 &#181;g/mL of anti-CD3e and 4 &#181;g/mL of anti-CD28 in sterile 500 &#181;L PBS, wrap the plate in parafilm to prevent evaporation and contamination, and then incubate plate at 4 &#176;C overnight (or 37 &#176;C&#160;for 1-2 hours before plating CD4+ T cells) at the day before isolating na&#239;ve CD4+ T cells. 
		NOTE: This step is needed to perform plate-bound stimulation for the mouse T cells before performing viral transduction.</li>
		<li>On the next day, euthanize 6-8-week-old Cas9-expressing mice (R26-CAG-Cas9 mice) by CO2 asphyxiation and sterilize them with 70% ethanol.</li>
		<li>Harvest the mouse spleen and place it in PBS with 2% FBS and 100 &#181;M EDTA (FACS buffer).</li>
		<li>Grind the spleen with sterilized ground glass (matte side) in the FACS buffer, homogenize the tissue into a single-cell suspension, and filter the cell suspension through a 70 &#181;m cell strainer into a 50 mL tube. 
		NOTE: Be sure to grind the tissue gently and consistently to keep the tissue moist. Violently grinding the tissue can affect cell survival dramatically.</li>
		<li>Spin the splenic cell suspension at 800 &#215; g for 5 min. Remove the supernatant and resuspend the cell pellet in 2 mL of red cell lysis buffer. Let it sit at room temperature for 5 min, then add FACS buffer to reach a total volume of 15 mL. Centrifuge the splenocytes at 800 &#215; g for 5 min.</li>
		<li>Resuspend the splenocytes and filter them through a 40 &#181;m cell strainer. Adjust the final volume to 1 mL for the CD4+ T cell isolation.</li>
		<li>Isolate CD4+ T cells using commercial reagent kits by following the instructions in the manual.</li>
		<li>Label the CD4+ T cells with fluorescent antibodies mixture (CD4, CD25, CD44, and CD62L) at 4 &#176;C for 30 min, wash the cells with FACS buffer, and isolate the na&#239;ve CD4+ T cells using a flow cell sorter. This will result in obtaining CD4+CD25-CD62LhighCD44low na&#239;ve T cells.</li>
		<li>Remove the plate-bound stimulation supernatant from the 24-well cell culture plate (prepared in step 2.1.1) and rinse each well twice with 500 &#181;L of PBS. Plate 1 x&#160;106 na&#239;ve CD4+ T cells in 1 mL of lymphocyte culture medium in a well of the 24-well cell culture plate. Incubate the cells in the cell incubator. 
		NOTE: Lymphocyte culture medium contains 10% FBS, 100 units/mL penicillin, and 0.1 mg/mL streptomycin, 1 mM sodium pyruvate, 10 mM HEPES, and 50 &#181;M &#946;-ME in RPMI 1640 medium.</li>
	</ol>
	</li>
	<li>Retroviral infection
	<ol>
		<li>After 18-24 h, collect each well of activated cells into the 1.5 mL tube. Centrifuge at 800 &#215; g for 5 min, and discard the supernatant.</li>
		<li>Resuspend the cell pellet in 1 mL of infection mixture (10 &#181;g/mL hexadimethrine bromide, 10 mM HEPES in virus supernatant) and add 1 mL of the mixture to a new well of a 48-well cell culture plate. In the meanwhile, save enough cells as negative (un-transduced) control. 
		NOTE: It is feasible to have fewer than 1 x&#160;106 activated na&#239;ve CD4+ T cells per well, but it is not recommended to use less than 0.5 x&#160;106 cells per well. Additionally, no cells should be seeded in the peripheral wells of the 48-well culture plate.</li>
		<li>Wrap the plate with parafilm, and centrifuge at 800 x&#160;g for 90 min at 32 &#176;C. Set accelerate and decelerate at 3. After centrifugation, remove the parafilm, incubate the cells in the incubator for 4 h, and proceed with the differentiation steps.</li>
	</ol>
	</li>
	<li>Differentiation of infected cells into Th17 cells
	<ol>
		<li>Prepare the antigen-presenting cells (APC) during retroviral infection. First, obtain splenocytes from wild-type mice following the instructions from steps 2.1.2 to 2.1.4. Resuspend the splenocytes with 1 mL of lymphocyte culture medium with 50 &#181;g/mL mitomycin in a 15 mL tube. Incubate the splenocytes at 37 &#176;C&#160;under 5% CO2 for 1 h.</li>
		<li>One hour later, add PBS up to the 15 mL mark to wash the splenocytes, centrifuge at 800 x&#160;g for 5 min, discard the supernatant, resuspend the splenocytes with 1 mL of lymphocyte culture medium, and count the cell number. APC cells have been successfully prepared.</li>
		<li>After the 4 h of cell incubation (as in step 2.2.3), collect transduced CD4+ T cells in 1.5 mL tubes and centrifuge at 800 x&#160;g for 5 min. Discard the supernatant and resuspend infected cells in 600 &#181;L of PBS to wash. Centrifuge at 800 x&#160;g for 5 min and discard the supernatant.</li>
		<li>Place 0.5 &#215; 106 transduced CD4+ T cells in 1 mL of lymphocyte culture medium with 1.5 x&#160;106 APC cells in a well of a 24-well cell culture plate. Supplement with 2 &#181;g/mL of anti-CD3e, 2 &#181;g/mL of anti-CD28, and Th17 cell differentiation cocktail, which contains 10 &#181;g/mL anti-IFN&#947;, 10 &#181;g/mL anti-IL-12/IL23 p40, 10 &#181;g/mL anti-IL4, 2.5-3 ng/mL hTGF-&#946;, and 20-30 ng/mL IL-6. Culture cells for 2 days.</li>
		<li>Collect each well of cells into the 1.5 mL tubes, centrifuge at 800 x&#160;g for 5 min, and discard the supernatant. Refresh new 1 mL of the lymphocyte culture medium only with 3 ng/mL TGF-&#946; and 30 ng/mL IL-6. Place the cells in a new well of 24-well cell culture plate for an extended culture period. Analyze the cells 2 days after the medium change.</li>
	</ol>
	</li>
</ol>
3. Evaluation of transduction efficiency and differentiation results
<ol>
	<li>After two days of medium change, collect cells and centrifuge at 800 &#215; g for 5 min and discard the supernatant. Treat differentiated cells with 50 ng/mL phorbol 12-myristate 13-acetate (PMA), 500 ng/mL ionomycin and 5 &#181;g/mL brefeldin A in 500 &#181;L of lymphocyte culture medium in a new well of 24-well cell culture plate at 37 &#176;C incubator for 4 h. Harvest half of the cells for flow cytometry analysis and lyse the other half of the cells with RNA extraction buffer for qPCR analysis.</li>
	<li>For flow cytometry analysis
	<ol>
		<li>Collect the cells into 1.5 mL tubes. Add 1 mL of FACS buffer into tubes and centrifuge at 800 &#215; g for 5 min to wash the cells.</li>
		<li>Resuspend the cell pellet with fluorescent antibodies mixture (CD4 and Fixable Viability Dye in 100 &#181;L of PBS) and stain the cells at 4 &#176;C for 30 min.</li>
		<li>Wash the cells with 300 &#181;L of PBS and fix them with 300 &#181;L of 2% phosphate-buffered formaldehyde (FA) at 4 &#176;C for at least 60 min.</li>
		<li>One hour later, wash the cells with PBS, resuspend them with 600 &#181;L of 1x permeabilization buffer, and centrifuge at 800 &#215; g for 5 min.</li>
		<li>Discard the supernatant and stain with anti-IL-17A in 100 &#181;L of 1x permeabilization buffer for 60 min at room temperature or 4 &#176;C overnight.</li>
		<li>The next day, wash the cells with 1x permeabilization buffer and resuspend them in 200 &#181;L of PBS. Analyze the cells by flow cytometry10. See the Representative Results section.</li>
	</ol>
	</li>
	<li>For qPCR analysis, extract RNA following the instructions of the RNA extraction kit. Reverse-transcribe the RNA into cDNA for storage or subsequent qPCR analysis. The design of these primers should adhere to general qPCR primer design principles while also specifically targeting the region spanning the expected indel site, where gRNA-mediated cleavage has occurred. Any reduction in amplification efficiency or loss of signal at this site may serve as an indicator of successful knockout. The qPCR primers are as follows: 
	Rorc F: TCCACTACGGGGTTATCACCT; R: AGTAGGCCACATTACACTGCT. 
	IL17a F: TCAGCGTGTCCAAACACTGAG; R: CGCCAAGGGAGTTAAAGACTT.</li>
</ol>

Retroviral Transduction of Guide RNA for Gene Editing in Th17 Differentiation

<ol>
	<li>Wu, B., Wan, Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Molecular+control+of+pathogenic+th17+cells+in+autoimmune+diseases.">Molecular control of pathogenic th17 cells in autoimmune diseases.</a> Int Immunopharmacol. 80, 106187 (2020).</li><li>Dong, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Th+17+cells+in+development::+An+updated+view+of+their+molecular+identity+and+genetic+programming.">Th 17 cells in development:: An updated view of their molecular identity and genetic programming.</a> Nat Rev Immunol. 8 (5), 337-348 (2008).</li><li>Patel, D. D., Kuchroo, V. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Th17+cell+pathway+in+human+immunity:+Lessons+from+genetics+and+therapeutic+interventions.">Th17 cell pathway in human immunity: Lessons from genetics and therapeutic interventions.</a> Immunity. 43 (6), 1040-1051 (2015).</li><li>Ghoreschi, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Generation+of+pathogenic+Th17+cells+in+the+absence+of+TGF-&#946;+signalling.">Generation of pathogenic Th17 cells in the absence of TGF-&#946; signalling.</a> Nature. 467 (7318), 967-U144 (2010).</li><li>Lee, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Induction+and+molecular+signature+of+pathogenic+th17+cells.">Induction and molecular signature of pathogenic th17 cells.</a> Nat Immunol. 13 (10), 991-999 (2012).</li><li>Yang, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=One-step+generation+of+mice+carrying+reporter+and+conditional+alleles+by+CRISPR/Cas-mediated+genome+engineering.">One-step generation of mice carrying reporter and conditional alleles by CRISPR/Cas-mediated genome engineering.</a> Cell. 154 (6), 1370-1379 (2013).</li><li>Yang, H., Wang, H., Jaenisch, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Generating+genetically+modified+mice+using+CRISPR/Cas-mediated+genome+engineering.">Generating genetically modified mice using CRISPR/Cas-mediated genome engineering.</a> Nat Protoc. 9 (8), 1956-1968 (2014).</li><li>Doench, J. G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Optimized+sgrna+design+to+maximize+activity+and+minimize+off-target+effects+of+crispr-cas9.">Optimized sgrna design to maximize activity and minimize off-target effects of crispr-cas9.</a> Nat Biotechnol. 34 (2), 184-191 (2016).</li><li>Holst, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Generation+of+t-cell+receptor+retrogenic+mice.">Generation of t-cell receptor retrogenic mice.</a> Nat Protoc. 1 (1), 406-417 (2006).</li><li>Ordonez, P., Bishop, K. N., Stoye, J. P., Groom, H. C. T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Analysis+of+SAMHD1+restriction+by+flow+cytometry+in+human+myeloid+U937+cells.">Analysis of SAMHD1 restriction by flow cytometry in human myeloid U937 cells.</a> J Vis Exp. (172), (2021).</li><li>Akcakaya, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=In+vivo+CRISPR+editing+with+no+detectable+genome-wide+off-target+mutations.">In vivo CRISPR editing with no detectable genome-wide off-target mutations.</a> Nature. 561 (7723), 416-419 (2018).</li><li>Bae, S., Park, J., Kim, J. -. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cas-OFFinder:+A+fast+and+versatile+algorithm+that+searches+for+potential+off-target+sites+of+cas9+rna-guided+endonucleases.">Cas-OFFinder: A fast and versatile algorithm that searches for potential off-target sites of cas9 rna-guided endonucleases.</a> Bioinformatics. 30 (10), 1473-1475 (2014).</li><li>Singh, Y., Garden, O. A., Lang, F., Cobb, B. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Retroviral+transduction+of+helper+T+cells+as+a+genetic+approach+to+study+mechanisms+controlling+their+differentiation+and+function.">Retroviral transduction of helper T cells as a genetic approach to study mechanisms controlling their differentiation and function.</a> J Vis Exp. (117), e54698 (2016).</li><li>Naviaux, R. K., Costanzi, E., Haas, M., Verma, I. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+pCL+vector+system:+Rapid+production+of+helper-free,+high-titer,+recombinant+retroviruses.">The pCL vector system: Rapid production of helper-free, high-titer, recombinant retroviruses.</a> J Virol. 70 (8), 5701-5705 (1996).</li><li>Cante-Barrett, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Lentiviral+gene+transfer+into+human+and+murine+hematopoietic+stem+cells:+Size+matters.">Lentiviral gene transfer into human and murine hematopoietic stem cells: Size matters.</a> BMC Res Notes. 9, 312-312 (2016).</li><li>Zhong, S., Malecek, K., Perez-Garcia, A., Krogsgaard, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Retroviral+transduction+of+T-cell+receptors+in+mouse+T-cells.">Retroviral transduction of T-cell receptors in mouse T-cells.</a> J Vis Exp. (44), 2307 (2010).</li></ol>

The authors state that there are no conflicts of interest.

CRISPR/Cas9 genome editing via retroviral delivery is a robust method for exploring the roles of helper T cells. This protocol offers a rapid and effective approach to examining specific genes involved in Th17 differentiation and function. Several critical steps must be carefully followed to achieve optimal results. First, for enhanced gene knockout efficiency, gRNAs should be carefully selected. Given the risk of off-target effects in CRISPR/Cas9 gene editing, it is prudent to choose 2-3 gRNAs with high scores, as ident...

Th17 cells, a unique subset of CD4+ T helper cells, are vital for eradicating extracellular bacteria and fungi and play a significant role in various autoimmune diseases1,2,3. Emerging evidence suggests that Th17 cells exhibit heterogeneity, functioning in both pathogenic and non-pathogenic conditions, influenced by environmental and genetic factors. Elucidating the regulatory processes that control the differentiation of Th17 cells, plasticity, and heterogeneity is crucial for the advancement of more effective immunotherapeutic strategies.
Genetically modified animals have been widely used to unveil the key regulators of Th17 cell differentiation and functions. Using genetically modified animals involves complete manipulation in vivo, providing authenticity and systematic study of its role in physiological conditions or disease models. Nevertheless, high-throughput screening with this approach is largely impractical. In vitro polarization assays provide an alternative for studying Th17 cell differentiation. Interleukin 6 (IL-6) in combination with transforming growth factor &#946;1 (TGF&#946;1) has been shown to promote the development of non-pathogenic Th17 cells, while IL-6, IL-1&#946;, and IL-23 are implicated in driving the differentiation of pathogenic Th17 cells (pTh17)4,5.
The emergence of CRISPR/Cas9 technology has facilitated precise genome editing at specific bases. When combined with retroviral transduction, this approach provides a potent, efficient, and economical genetic method for screening and functionally studying potential regulators in Th17 cells6,7. In this study, we improved the procedure for retroviral transduction within Th17 polarization system. Using a retroviral system, we infected pre-established Cas9-expressing activated na&#239;ve T cells from mice. The cells were transduced with guide RNA (gRNA) constructs driven by the U6 promoter, along with genes encoding fluorescent reporter proteins under the control of the EF1a promoter to facilitate the knockout of the target gene. Then, the transduced T cells were cultured under specific cytokine conditions to induce differentiation into Th17 cells. Notably, knocking out RoR&#947;t significantly reduced IL-17A production compared to the control group. The effectiveness of this system depends on optimized retrovirus production and transduction conditions for activated primary T cells, providing a rapid and practical approach for studying specific genes in Th17 differentiation and function.

<table><tbody><tr><td>0.5 M EDTA (pH 8.0)</td><td>Solarbio</td><td>E1170</td><td></td></tr><tr><td>100 mm cell and tissue Culture Dish</td><td>BIOFIL</td><td>TCD010100</td><td></td></tr><tr><td>1 M Hepes (Free Acid, sterile)</td><td>Solarbio</td><td>H1090</td><td></td></tr><tr><td>24-well cell and tissue culture plate</td><td>NEST</td><td>702002</td><td></td></tr><tr><td>48-well cell and tissue culture plate</td><td>NEST</td><td>748002</td><td></td></tr><tr><td>Brefeldin A Solution (1,000x)</td><td>BioLegend</td><td>420601</td><td></td></tr><tr><td>Brilliant Violet 650 anti-mouse CD4 Antibody (RM4-5)</td><td>BioLegend</td><td>100546</td><td></td></tr><tr><td>CD3e Monoclonal Antibody (145-2C11), Functional Grade, eBioscience</td><td>Invitrogen</td><td>16-0031-82</td><td></td></tr><tr><td>CD44 Monoclonal Antibody (IM7), PE, eBioscience</td><td>Invitrogen</td><td>12-0441-83</td><td></td></tr><tr><td>CD62L (L-Selectin) Monoclonal Antibody (MEL-14), APC, eBioscience</td><td>Invitrogen</td><td>17-0621-82&amp;nbsp;</td><td></td></tr><tr><td>Cell counter</td><td>Nexcelom Bioscience</td><td>Cellometer Auto 2000</td><td></td></tr><tr><td>Cell Strainer (40 &amp;mu;m)</td><td>biosharp</td><td>BS-40-CS</td><td></td></tr><tr><td>Cell Strainer (70 &amp;mu;m)</td><td>&lt;a name=&quot;RANGE!B14&quot;&gt;biosharp&lt;/a&gt;</td><td>BS-70-CS</td><td></td></tr><tr><td>Centrifuge&amp;nbsp;</td><td>eppendorf</td><td>5425&amp;nbsp;R</td><td></td></tr><tr><td>Centrifuge&amp;nbsp;</td><td>eppendorf</td><td>5810 R</td><td></td></tr><tr><td>ChamQ SYBR Color qPCR Master Mix</td><td>Vazyme</td><td>Q411-02</td><td></td></tr><tr><td>ClonExpress II One Step Cloning Kit</td><td>Vazyme</td><td>C112</td><td></td></tr><tr><td>DH5&amp;alpha; Competent Cells</td><td>Sangon Biotech</td><td>B528413</td><td></td></tr><tr><td>Direct-zol RNA Miniprep</td><td>ZYMO RESEARCH</td><td>R2050</td><td></td></tr><tr><td>DMEM Medium</td><td>BasalMedia</td><td>L110KJ</td><td></td></tr><tr><td>EasySep Mouse CD4+ T Cell Isolation Kit</td><td>STEMCELL</td><td>19852</td><td></td></tr><tr><td>eBioscience Fixable Viability Dye eFluor 660</td><td>Invitrogen</td><td>65-0864-18</td><td></td></tr><tr><td>EndoFree Mini Plasmid Kit II</td><td>TIANGEN</td><td>DP118-02</td><td></td></tr><tr><td>ExFect Transfection Reagent</td><td>Vazyme</td><td>T101-01</td><td></td></tr><tr><td>Fetal Bovine Serum, Premium Plus</td><td>Gibco</td><td>A5669701</td><td></td></tr><tr><td>FITC anti-mouse IL-17A Antibody (TC11-18H10.1)</td><td>BioLegend</td><td>506907</td><td></td></tr><tr><td>Formaldehyde solution</td><td>Macklin</td><td>F864792</td><td></td></tr><tr><td>HiScript IV RT SuperMix for qPCR?+gDNA wiper?</td><td>Vazyme</td><td>R423-01</td><td></td></tr><tr><td>Ionomycin</td><td>Beyotime</td><td>S1672</td><td></td></tr><tr><td>Mitomycin C</td><td>Maokang Biotechnology</td><td>7/7/1950</td><td></td></tr><tr><td>Mouse GRCm38</td><td>NCBI</td><td>RefSeq v.108.20200622</td><td></td></tr><tr><td>OPTI-MEM Reduced Serum Medium</td><td>Gibco</td><td>31985070</td><td>reduced serum medium</td></tr><tr><td>Pacific Blue anti-mouse CD4 Antibody (RM4-5)</td><td>BioLegend</td><td>100531</td><td></td></tr><tr><td>PE/Cyanine7 anti-mouse CD25 Antibody (PC61)</td><td>BioLegend</td><td>102015</td><td></td></tr><tr><td>PE/Cyanine7 anti-mouse CD4 Antibody (GK1.5)</td><td>BioLegend</td><td>100422</td><td></td></tr><tr><td>Penicillin-Streptomycin (10,000 U/mL)</td><td>Gibco</td><td>15140122</td><td></td></tr><tr><td>PMA/TPA&amp;nbsp;</td><td>Beyotime</td><td>S1819</td><td></td></tr><tr><td>R26-CAG-Cas9 mice&amp;nbsp;</td><td>Shanghai Model Organisms Center</td><td>Cat. NO. NM-KI-00120</td><td></td></tr><tr><td>Recombinant Human TGF-beta 1 (CHO-Expressed) Protein, CF</td><td>R&amp;amp;D Systems</td><td>11409-BH</td><td></td></tr><tr><td>Recombinant Murine IL-6</td><td>PeproTech</td><td>216-16</td><td></td></tr><tr><td>Research Cell Analyzer</td><td>BD Biosciences</td><td>BD LSRFortessa</td><td></td></tr><tr><td>Research Cell Sorter</td><td>SONY</td><td>MA900</td><td></td></tr><tr><td>RPMI 1640 Medium</td><td>BasalMedia</td><td>L210KJ</td><td></td></tr><tr><td>SimpliAmp Thermal Cycler PCR System</td><td>Applied Biosystems</td><td>A24811</td><td></td></tr><tr><td>Sodium pyruvate solution (100 mM)</td><td>Sigma-Aldrich</td><td>S8636</td><td></td></tr><tr><td>Ultra-LEAF Purified anti-mouse CD28 Antibody (37.51)</td><td>BioLegend</td><td>102121</td><td></td></tr><tr><td>Ultra-LEAF Purified anti-mouse IFN-&amp;gamma; Antibody (XMG1.2)</td><td>BioLegend</td><td>505847</td><td></td></tr><tr><td>Ultra-LEAF Purified anti-mouse IL-4 Antibody (11B11)</td><td>BioLegend</td><td>504135</td><td></td></tr><tr><td>Ultra-LEAF Purified anti-mouse IL-12/IL-23 p40 Antibody (C17.8)</td><td>BioLegend</td><td>505309</td><td></td></tr><tr><td>&amp;beta;-Mercaptoethanol (50 mM)</td><td>Solarbio</td><td>M8211</td><td></td></tr></tbody></table>

retroviral crispr/cas9-mediated gene targeting for the study of th17 differentiation in vitro

T helper cells that produce IL-17A, known as Th17 cells, play a critical role in immune defense and are implicated in autoimmune disorders. CD4 T cells can be stimulated with antigens and well-defined cytokine cocktails in vitro to mimic Th17 cell differentiation in vivo. Research has been conducted extensively on the Th17 differentiation regulation mechanisms using the in vitro Th17 polarization assay.
Conventional Th17 polarization methods typically involve obtaining na&#239;ve CD4 T cells from genetically modified mice to study the effects of specific genes on Th17 differentiation and function. These methods can be time-consuming and costly and may be influenced by cell-extrinsic factors from the knockout animals. Thus, a protocol using retroviral transduction of guide RNA to introduce gene knockout in CRISPR/Cas9 knockin primary mouse T cells serves as a very useful alternative approach. This paper presents a protocol to differentiate na&#239;ve primary T cells into Th17 cells following retroviral-mediated gene targeting, as well as the subsequent flow cytometry analysis methods for assaying infection and differentiation efficiency.

In the study, we cloned the sgRNA target to Rorc and sgRNA-non-targeting coding sequences into pMX-U6-MCS vector with mCherry fluorescent protein (Figure 1A,B). Retrovirus production was carried out according to the protocol outlined in Figure 2. The transfection was initiated on day 0, and the retroviral harvest occurred on day 2. Transfection efficiency can be tested by the mCherry fluorescence intensi...

Retroviral CRISPR/Cas9-Mediated Gene Targeting for the Study of Th17 Differentiation in Vitro

We present a protocol for retroviral transduction of guide RNA into primary T cells from Cas9 transgenic mice, providing an efficient alternative for gene editing in studying Th17 differentiation.

T helper cells that produce IL-17A, known as Th17 cells, play a critical role in immune defense and are implicated in autoimmune disorders. CD4 T cells ...

retroviral-crisprcas9-mediated-gene-targeting-for-study-th17

Research

JoVE Journal

Immunology and Infection

382 Views.  Renji Hospital, Shanghai Jiao Tong University School of Medicine. We present a protocol for retroviral transduction of guide RNA into primary T cells from Cas9 transgenic mice, providing an efficient alternative for gene editing in studying Th17 differentiation.

Video: Retroviral CRISPR/Cas9-Mediated Gene Targeting for the Study of Th17 Differentiation in Vitro

Generation of Induced Regulatory T Cells from Primary Human Na&iuml;ve and Memory T Cells

The development and maintenance of immunosuppressive CD4+ regulatory T cells (Tregs) contribute to the peripheral tolerance needed to remain in immunologic homeostasis with the vast amount of self and commensal antigens in and on the human body. Perturbations in the balance between Tregs and inflammatory conventional T cells can result in immunopathology or cancer. Although therapeutic injection of Tregs has been shown to be efficacious in murine models of colitis1 , type I diabetes2 , rheumatoid arthritis and graft versus host disease,4 several fundamental differences in human versus mouse Treg biology5 has thus far precluded clinical use. The lack of sufficient number, purity, stability and homing specificity of therapeutic Tregs necessitated a dynamic platform of human Treg development on which to optimize conditions for their ex vivo expansion6.
Here we describe a method for the differentiation of induced Tregs (iTregs) from a single human peripheral blood donor which can be broken down into four stages: isolation of peripheral blood mononuclear cells, magnetic selection of CD4+ T cells, in vitro cell culture and fluorescence activated cell sorting (FACS) of T cell subsets. Since the Treg signature transcription factor forkhead box P3 (FoxP3) is an activation-induced transcription factor in humans7 and no other unique marker exists, a combinatorial panel of markers must be used to identify T cells with suppressor activity. After six days in culture, cells in our system can be demarcated into na&iuml;ve T cells, memory T cells or iTregs based on their relative expression of CD25 and CD45RA. As memory and na&iuml;ve T cells have different reported polarization requirements and plasticities8 , pre-sorting of the initial T cell population into CD45RA+ and CD45RO+ subsets can be used to examine these discrepancies. Consistent with others, our CD25HiCD45RA- iTregs express high levels of FoxP39 , GITR and CTLA-411 and low levels of CD12712 . Following FACS of each population, resultant cells can be used in a suppressor assay which evaluates the relative ability to retard the proliferation of carboxyfluorescein succinimidyl ester (CFSE)-labeled autologous T cells.

Generation of Induced Regulatory T Cells from Primary Human Na&#239;ve and Memory T Cells

We describe a method for generating regulatory, memory and na&#239;ve T cells from a single human blood donor. Polarized Tregs can be then compared to other subsets in a variety of genetic and functional applications with genetic homogeneity, including a suppression assay also detailed here.

The development and maintenance of immunosuppressive CD4+ regulatory T cells (Tregs) contribute to the peripheral tolerance needed to remain in ...

Adenoviral Transduction of Naive CD4 T Cells to Study Treg Differentiation

Regulatory T cells (Tregs) are essential to provide immune tolerance to self as well as to certain foreign antigens. Tregs can be generated from naive CD4 T cells in vitro with TCR- and co-stimulation in the presence of TGF&beta; and IL-2. This bears enormous potential for future therapies, however, the molecules and signaling pathways that control differentiation are largely unknown.
Primary T cells can be manipulated through ectopic gene expression, but common methods fail to target the most important naive state of the T cell prior to primary antigen recognition. Here, we provide a protocol to express ectopic genes in naive CD4 T cells in vitro before inducing Treg differentiation. It applies transduction with the replication-deficient adenovirus and explains its generation and production. The adenovirus can take up large inserts (up to 7 kb) and can be equipped with promoters to achieve high and transient overexpression in T cells. It effectively transduces naive mouse T cells if they express a transgenic Coxsackie adenovirus receptor (CAR). Importantly, after infection the T cells remain naive (CD44low, CD62Lhigh) and resting (CD25-, CD69-) and can be activated and differentiated into Tregs similar to non-infected cells. Thus, this method enables manipulation of CD4 T cell differentiation from its very beginning. It ensures that ectopic gene expression is already in place when early signaling events of the initial TCR stimulation induces cellular changes that eventually lead into Treg differentiation.

Adenoviral gene transfer into naive CD4 T cells with transgenic expression of the Coxsackie adenovirus receptor enables the molecular analysis of regulatory T cell differentiation in vitro.

Regulatory T cells (Tregs) are essential to provide immune tolerance to self as well as to certain foreign antigens. Tregs can be generated from naive CD4 ...

Mouse Na&#239;ve CD4+ T Cell Isolation and In vitro Differentiation into T Cell Subsets

Antigen inexperienced (na&#239;ve) CD4+ T cells undergo expansion and differentiation to effector subsets at the time of T cell receptor (TCR) recognition of cognate antigen presented on MHC class II. The cytokine signals present in the environment at the time of TCR activation are a major factor in determining the effector fate of a na&#239;ve CD4+ T cell. Although the cytokine environment during na&#239;ve T cell activation may be complex and involve both redundant and opposing signals in vivo, the addition of various cytokine combinations during naive CD4+ T cell activation in vitro can readily promote the establishment of effector T helper lineages with hallmark cytokine and transcription factor expression. Such differentiation experiments are commonly used as a first step for the evaluation of targets believed to promote or inhibit the development of certain CD4+ T helper subsets. The addition of mediators, such as signaling agonists, antagonists, or other cytokines, during the differentiation process can also be used to study the influence of a particular target on T cell differentiation. Here, we describe a basic protocol for the isolation of na&#239;ve T cells from mouse and the subsequent steps necessary for polarizing na&#239;ve cells to various T helper effector lineages in vitro.

Mouse Na&#239;ve CD4+ T Cell Isolation and In vitro Differentiation into T Cell Subsets

Na&#239;ve CD4+ T cells polarize to various subsets depending on the environment at the time of activation. The differentiation of na&#239;ve CD4+ T cells to various effector subsets can be achieved in vitro through the addition of T cell receptor stimuli and specific cytokine signals.

Antigen inexperienced (na&#239;ve) CD4+ T cells undergo expansion and differentiation to effector subsets at the time of T cell receptor (TCR) recognition ...

Retroviral Transduction of Helper T Cells as a Genetic Approach to Study Mechanisms Controlling their Differentiation and Function

Helper T cell development and function must be tightly regulated to induce an appropriate immune response that eliminates specific pathogens yet prevents autoimmunity. Many approaches involving different model organisms have been utilized to understand the mechanisms controlling helper T cell development and function. However, studies using mouse models have proven to be highly informative due to the availability of genetic, cellular, and biochemical systems. One genetic approach in mice used by many labs involves retroviral transduction of primary helper T cells. This is a powerful approach due to its relative ease, making it accessible to almost any laboratory with basic skills in molecular biology and immunology. Therefore, multiple genes in wild type or mutant forms can readily be tested for function in helper T cells to understand their importance and mechanisms of action. We have optimized this approach and describe here the protocols for production of high titer retroviruses, isolation of primary murine helper T cells, and their transduction by retroviruses and differentiation toward the different helper subsets. Finally, the use of this approach is described in uncovering mechanisms utilized by microRNAs (miRNAs) to regulate pathways controlling helper T cell development and function.

Many experimental systems have been utilized to understand the mechanisms regulating T cell development and function in an immune response. Here a genetic approach using retroviral transduction is described, which is economic, time efficient, and most importantly, highly informative in identifying regulatory pathways.

Helper T cell development and function must be tightly regulated to induce an appropriate immune response that eliminates specific pathogens yet prevents ...

Streamlined Single Cell TCR Isolation and Generation of Retroviral Vectors for In Vitro and In Vivo Expression of Human TCRs

Although, several methods for sequencing of paired T cell receptor (TCR) alpha and beta chains from single T cells have been developed, none so far have been conducive to downstream in vivo functional analysis of TCR heterodimers. We have developed an improved protocol based on a two-step multiplex-nested PCR, which results in a PCR product that spans entire variable regions of a human TCR alpha and beta chains. By identifying unique restriction sites and incorporating them into the PCR primers, we have made the PCR product compatible with direct sub-cloning into the template retroviral vector. The resulting retroviral construct encodes a chimeric human/mouse TCR with a mouse intracellular domain, which is functional in mouse cells or in in vivo mouse models. Overall, the protocol described here combines human single cell paired TCR alpha and beta chain identification with streamlined generation of retroviral vectors readily adaptable for in vitro and in vivo TCR expression. The video and the accompanying material are designed to give a highly detailed description of the single cell PCR, so that the critical steps can be followed and potential pitfalls avoided. Additionally, we provide a detailed description of the cloning steps necessary to generate the expression vector. Once mastered, the whole procedure from single cell sorting to TCR expression could be performed in a short two-week period.

Streamlined Single Cell TCR Isolation and Generation of Retroviral Vectors for In Vitro and In Vivo Expression of Human TCRs

The current protocol combines single cell paired human TCR alpha and beta chain sequencing with streamlined generation of retroviral vectors compatible with in vitro and in vivo TCR expression.

Although, several methods for sequencing of paired T cell receptor (TCR) alpha and beta chains from single T cells have been developed, none so far have ...

Small RNA Transfection in Primary Human Th17 Cells by Next Generation Electroporation

CD4+ T cells can differentiate into several subsets of effector T helper cells depending on the surrounding cytokine milieu. Th17 cells can be generated from na&#239;ve CD4+ T cells in vitro by activating them in the presence of the polarizing cytokines IL-1&#946;, IL-6, IL-23, and TGF&#946;. Th17 cells orchestrate immunity against extracellular bacteria and fungi, but their aberrant activity has also been associated with several autoimmune and inflammatory diseases. Th17 cells are identified by the chemokine receptor CCR6 and defined by their master transcription factor, ROR&#947;t, and characteristic effector cytokine, IL-17A. Optimized culture conditions for Th17 cell differentiation facilitate mechanistic studies of human T cell biology in a controlled environment. They also provide a setting for studying the importance of specific genes and gene expression programs through RNA interference or the introduction of microRNA (miRNA) mimics or inhibitors. This protocol provides an easy to use, reproducible, and highly efficient method for transient transfection of differentiating primary human Th17 cells with small RNAs using a next generation electroporation device.

Next generation electroporation is an efficient method for transfecting human Th17 cells with small RNAs to alter gene expression and cell behavior.

CD4+ T cells can differentiate into several subsets of effector T helper cells depending on the surrounding cytokine milieu. Th17 cells can be generated ...

Lentiviral CRISPR/Cas9-Mediated Genome Editing for the Study of Hematopoietic Cells in Disease Models

Manipulating genes in hematopoietic stem cells using conventional transgenesis approaches can be time-consuming, expensive, and challenging. Benefiting from advances in genome editing technology and lentivirus-mediated transgene delivery systems, an efficient and economical method is described here that establishes mice in which genes are manipulated specifically in hematopoietic stem cells. Lentiviruses are used to transduce Cas9-expressing lineage-negative bone marrow cells with a guide RNA (gRNA) targeting specific genes and a red fluorescence reporter gene (RFP), then these cells are transplanted into lethally-irradiated C57BL/6 mice. Mice transplanted with lentivirus expressing non-targeting gRNA are used as controls. Engraftment of transduced hematopoietic stem cells are evaluated by flow cytometric analysis of RFP-positive leukocytes of peripheral blood. Using this method, ~90% transduction of myeloid cells and ~70% of lymphoid cells at 4 weeks after transplantation can be achieved. Genomic DNA is isolated from RFP-positive blood cells, and portions of the targeted site DNA are amplified by PCR to validate the genome editing. This protocol provides a high-throughput evaluation of hematopoiesis-regulatory genes and can be extended to a variety of mouse disease models with hematopoietic cell involvement.

Described are protocols for the highly efficient genome editing of murine hematopoietic stem and progenitor cells (HSPC) by the CRISPR/Cas9 system to rapidly develop mouse model systems with hematopoietic system-specific gene modifications.

Manipulating genes in hematopoietic stem cells using conventional transgenesis approaches can be time-consuming, expensive, and challenging. Benefiting ...

Investigating Target Gene Function in a CD40 Agonistic Antibody-induced Colitis Model using CRISPR/Cas9-based Technologies

The immune system functions to defend humans against foreign invaders such as bacteria and viruses. However, disorders of the immune system may lead to autoimmunity, inflammatory disease, and cancer. The inflammatory bowel diseases (IBD)-Crohn's disease (CD) and ulcerative colitis (UC)-are chronic diseases marked by relapsing intestinal inflammation. Although IBD is most prevalent in Western countries (1 in 1,000), incident rates are increasing around the world. Through association studies, researchers have linked hundreds of genes to the pathology of IBD. However, the elaborate pathology behind IBD and the high number of potential genes pose significant challenges in finding the best therapeutic targets. Additionally, the tools needed to functionally characterize each genetic association introduce many rate-limiting factors such as the generation of genetically modified mice for each gene. To investigate the therapeutic potential of target genes, a model system has been developed using clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated endonuclease (Cas9)-based technologies and a cluster of differentiation 40 (CD40) agonistic antibody. The present study shows that CRISPR/Cas9-mediated editing in the immune system can be used to investigate the impact of genes in vivo. Limited to the hematopoietic compartment, this approach reliably edits the resulting reconstituted immune system. CRISPR/Cas9-edited mice are generated faster and are far less expensive than traditional genetically modified mice. Furthermore, CRISPR/Cas9 editing of mice has significant scientific advantages compared to generating and breeding genetically modified mice such as the ability to evaluate targets that are embryonic lethal. Using CD40 as a model target in the CD40 agonistic antibody-induced colitis model, this study demonstrates the feasibility of this approach.

Here, we describe the methodology to knock out a gene of interest in the immune system using clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated endonuclease (Cas9)-based technologies and the evaluation of these mice in a cluster of differentiation 40 (CD40) agonistic antibody-induced colitis model.

The immune system functions to defend humans against foreign invaders such as bacteria and viruses. However, disorders of the immune system may lead to ...

Th17 Cell Differentiation from Naive CD4+ T-Cells Using Flow Cytometry

In Vitro Differentiation of Naive CD4+ T Cells into Pathogenic Th17 Cells in Mouse

In vitro T cell differentiation techniques are essential for both functional and mechanistic investigations of CD4+ T cells. Pathogenic Th17 cells have been linked to a wide range of diseases in recent times, including multiple sclerosis (MS), rheumatoid arthritis, acute respiratory distress syndrome (ARDS), sepsis, and other autoimmune disorders. However, the currently known in vitro differentiation protocols have difficulty achieving high purity of pathogenic Th17 cells, with the induction efficiency often below 50%, which is a key challenge in in vitro experiments. In this protocol, we propose an enhanced in vitro culture and differentiation protocol for pathogenic Th17 cells, which is used to directly differentiate naive CD4+ T cells isolated from mouse spleens into pathogenic Th17 cells. This protocol provides detailed instructions on splenocyte isolation, purification of naive CD4+ T cells, and differentiation of pathogenic Th17 cells. Through this protocol, we can achieve a differentiation purity of approximately 90% for pathogenic Th17 cells, which meets the basic needs of many cellular experiments.

Author Spotlight: Achieving High-Purity In Vitro Differentiation of Th17 Cells Using Cytokine Concentration Modulation

This protocol describes the differentiation of na&#239;ve CD4+ T cells into pathogenic Th17 cells in vitro. Specifically, when combined with a multi-parameter flow cytometry-based approach, 90% purity of pathogenic Th17 cells can be obtained from na&#239;ve CD4+ T cells using this differentiation method.

In vitro T cell differentiation techniques are essential for both functional and mechanistic investigations of CD4+ T cells. Pathogenic Th17 cells have ...

Engineering and Expansion of Human CAR Tregs for Immune Regulation Therapies

Generation of Human Chimeric Antigen Receptor Regulatory T Cells

Chimeric antigen receptor (CAR) T-cell therapy has reshaped the face of cancer treatment, leading to record remission rates in previously incurable hematological cancers. These successes have spurred interest in adapting the CAR platform to a small yet pivotal subset of CD4+ T cells primarily responsible for regulating and inhibiting the immune response, regulatory T cells (Tregs). The ability to redirect Tregs&#39; immunosuppressive activity to any extracellular target has enormous implications for creating cell therapies for autoimmune disease, organ transplant rejection, and graft-versus-host disease. Here, we describe in detail methodologies for bona fide Treg isolation from human peripheral blood, genetic modification of human Tregs utilizing either lentivirus or CRISPR/Cas9-aided knock-in using adeno-associated virus-mediated homologous directed repair (HDR) template delivery, and ex vivo expansion of stable human CAR Tregs. Lastly, we describe the assessment of human CAR Treg phenotypic stability and in vitro suppressive function, which provides insights into how the human CAR Tregs will behave in preclinical and clinical applications.

This protocol provides a streamlined workflow to generate and test human chimeric antigen receptor regulatory T cells (CAR Tregs).

Chimeric antigen receptor (CAR) T-cell therapy has reshaped the face of cancer treatment, leading to record remission rates in previously incurable ...

Retroviral CRISPR/Cas9-Mediated Gene Targeting for the Study of Th17 Differentiation in Vitro

Podsumowanie

Przeglądaj więcej filmów

Rozdziały w tym wideo

Generation of Induced Regulatory T Cells from Primary Human Naïve and Memory T Cells

Adenoviral Transduction of Naive CD4 T Cells to Study Treg Differentiation

Mouse Naïve CD4⁺ T Cell Isolation and In vitro Differentiation into T Cell Subsets

Retroviral Transduction of Helper T Cells as a Genetic Approach to Study Mechanisms Controlling their Differentiation and Function

Streamlined Single Cell TCR Isolation and Generation of Retroviral Vectors for In Vitro and In Vivo Expression of Human TCRs

Small RNA Transfection in Primary Human Th17 Cells by Next Generation Electroporation

Lentiviral CRISPR/Cas9-Mediated Genome Editing for the Study of Hematopoietic Cells in Disease Models

Investigating Target Gene Function in a CD40 Agonistic Antibody-induced Colitis Model using CRISPR/Cas9-based Technologies

In Vitro Differentiation of Naive CD4⁺ T Cells into Pathogenic Th17 Cells in Mouse

Generation of Human Chimeric Antigen Receptor Regulatory T Cells