Os autores não têm confirmações.

1. Concatemerization <ol><li> Ressuspender iniciadores Fw e Rv (ver Tabela de Materiais para as sequências de iniciadores) a uma concentração de 10 mg / mL em biologia molecular, grau de H 2 O. Em seguida, misturar 5 ul de Fw e 5 ul de iniciador Rv em um tubo de microcentrífuga de 1,5 ml. </li><li> Mistura de iniciadores de recozimento por meio de aquecimento para a temperatura de emparelhamento correcto (75 ° C para os iniciadores aqui descritos) para 15 min. Deixar no banco para esfriar em temperatura ambiente (RT). Prepare o PEG8000 60% durante esta incubação por dissolução em ddH 2 O. </li><li> Adicionar 50 ul de 60% ​​PEG8000 (para se conseguir uma concentração final de 30%), 10 ul de tampão 10x polinucleótido quinase (PNK), 27 ul de H2O e 3 mL de PNK para a mistura de iniciadores. Incubar a 37 ° C durante 2 horas. </li><li> Arrefecer à temperatura ambiente e adicionar 11 mL de tampão DNA ligase. Em seguida, adicionar 3 L de ligase de ADN e incubar a 37 ° C durante a noite. </li></ol> 2. DNA Purificatione Análise <ol><li> Adicionar 300 ul de H2O para aumentar o volume da mistura de ligação. Nota: Vá em um exaustor, devido à toxicidade do fenol: clorofórmio vapor. </li><li> Adicionar 1 volume (400 mL) de fenol: clorofórmio e misturar agitando vigorosamente. </li><li> Centrifugar a uma velocidade máxima durante 1 min numa microcentrífuga de mesa. As camadas aquosa e de solvente vai separar com a camada aquosa no topo e uma camada de proteína precipitada branco entre as duas camadas. </li><li> Transferir camada de topo para um novo tubo por pipetagem cuidadosa (evitar a transferência do meio, a camada de branco) </li><li> Repita os passos 2.2 e 2.3, pelo menos, duas vezes ou até não haver qualquer proteína precipitada, após a centrifugação. </li><li> Adicionar 1 volume (400 mL) de clorofórmio e repita os passos de 2,3-2,4. </li><li> Adicionam-se 2 volumes (800 uL) de 100% de etanol previamente arrefecido e incuba-se a -20 ° C durante pelo menos 1 hora ou durante a noite. Nota: Esta etapa precipita as concatemeros DNA. </li><li> Girar em velocidade máxima e aspirado supernatant. Lavar uma vez por adição de 1 ml de etanol a 70% e deixar secar ao ar no exaustor de fumos. </li><li> Ressuspender o ADN em 50 ul de endotoxina livre ddH 2 O. Nota: O uso de reagentes de endotoxina livre é essencial para a geração de uma resposta imune inata específicos de ADN em células e in vivo. </li><li> Retirar uma aliquota de 2 pi de DNA concatemerized para um novo tubo e adicionar 1 ml de tampão de carga do gel do ADN. </li><li> Dissolver 1% de agarose em tampão TAE por aquecimento em potência máxima em um forno de microondas por 2 min (ou o tempo que é apropriado para o poder do forno e volume). </li><li> Despeje em aparelho de vazamento de gel, adicionar 4 mL de corante fluorescente quelante de DNA, inserção de um pente, e deixar à temperatura ambiente durante aproximadamente 20 minutos para que o gel definido. </li><li> Uma vez definida, retire o gel pente e lugar dentro do tanque de eletroforese contendo tampão TAE. Carga 3 l de marcadores de amostra ou tamanho DNA nos poços. </li><li> Executar a electroforese em gel para 30-40 min a 90 V com uma corrente constante. Visualize o DNA sob luz ultra-violeta para observar concatemerization (Figura 1A). </li><li> Medir a concentração de ADN no restante da amostra por espectroscopia de absorção de UV. Vazio do espectrómetro com o mesmo ddH2O que foi usada para ressuspender o ADN e medir o espectro de absorvância entre 200-300 nm. NOTA: concentração de DNA pode ser calculada utilizando a lei de Beer-Lambert, A = e * c * l, onde A é a absorbância, E o coeficiente de extinção, e l a distância do caminho da luz. Para a medição de concentrações de ADN da absorvância a 260 nm deve ser medido e um coeficiente de extinção de 0,027 (ng / mL) -1 cm -1 utilizado. A distância do trajecto da luz, l, vai variar dependendo do espectrofotómetro. Enquanto a medição da concentração, tome nota da relação de absorbância 260/280 nm como uma indicação de pureza de DNA; Recomenda-se um valor para este rácio acima de 2,00. </li></ol> 3. transfecção de dsDNA concatemeros Em Vitro <ol><li> Células semente em um prato de cultura ou placa de tecido a ser 70% confluente no momento da estimulação. </li><li> Calcula-se a massa de ADN necessário para a estimulação das células, utilizando uma concentração final de 1-10 ug / ml. A massa necessária de DNA será notado por X abaixo. Por exemplo, se estimular as células num poço de uma placa de 6 poços, com 2 ml de meio a uma concentração de ADN de 5 ug / ml, em seguida, uma massa de 2 * 5 = 10 ug de DNA é necessária. </li><li> Adicionar 50 ul * X de meio isento de soro para um tubo esterilizado de tamanho adequado. Pipetar cuidadosamente no centro do meio, sem tocar no lado do tubo, * 2 X ul de reagente de transfecção de lípido catiónico e de deixar durante 5 min. </li><li> Adicionar X ug de ADN para o tubo e vortex brevemente. Deixar a temperatura ambiente durante pelo menos 20 min. Para transfecção in vitro, adicione essa mistura diretamente nas células para estimular citoplasmáticos vias sensoriais DNA. </li></ol> 4 Transfecção de dsDNA concatemeros In Vivo <ol><li> Preparar a mistura de transfecção, conforme descrito no 3,1-3,5 usando 1 mg de DNA, 2 mL de reagente de transfecção de lipídios e 18 mL meio sem soro por orelha de rato a ser estimulado. Prepare uma estéril de 20 mL Hamilton seringa, tampa com uma agulha estéril 30 G, e carregar com a mistura de transfecção de DNA. </li><li> Anestesiar um C57BL / 6 mouse usando 1-2% de isoflurano. Confirme anestesia por perda de movimento e ritmo respiratório constante e pelo teste do reflexo pitada se necessário. Monitorar os olhos do animal durante a anestesia e usar pomada conforme necessário para evitar o ressecamento excessivo. </li><li> Utilizando uma técnica asséptica, com cuidado para injectar o pavilhão auricular 10 ul da mistura de transfecção de modo a que um único &quot;bolha&quot; de líquido é formada entre as camadas dérmicas da orelha. Nota: Usar um dedal de borracha no seu polegar ou dedo indicador, esticar o ouvido sobre ele, e injectar a um ângulo agudo para assegurar que a agulha penetra apenas a primeira camada de pele do pavilhão auricular. </li><li> Reintroduzirem mouse de volta para a jaula e monitorizar regularmente a recuperação pós-anestésica. Use uma lâmpada de aquecimento para evitar arrefecimento excessivo dos ratos anestesiados. Não deixe os ratos sem vigilância até que tenham recuperado a consciência suficiente para manter decúbito esternal. </li><li> Flash congelar todo o pavilhão auricular num tubo de microcentrífuga por imersão em azoto líquido durante 2 min. </li></ol> 5 Processamento de amostras de DNA estimulada e Análise por PCR quantitativo (qPCR) <ol><li> A partir de cultura de células: médio aspirado com uma pipeta e descarte de resíduos. </li><li> Adicionar 1 ml de PBS estéril. Repita 5.1 e 5.2 duas vezes e vá para o passo 5.3 </li><li> De tecido da orelha: moer tecido sob nitrogênio líquido usando pilão de cerâmica estéreis e argamassa, transferir tecido terreno para um tubo de microcentrífuga com uma espátula estéril, e avançar para o passo 5.4 </li><li> Adicionar 350 ul de tampão de lise e prosseguir com ARN comercial protocolo do kit de extracção. Eluir RNA de extracção purificação kitcoluna em 40 ul ddH 2 O. Nota: O kit de extração de RNA comercial (ver materiais / equipamentos de mesa) funciona muito bem; outras técnicas foram testadas com resultados abaixo da média. </li><li> Quantificar RNA por espectroscopia de UV, como descrito acima para o ADN (secção 2.13). Nota: o coeficiente de extinção para o RNA é de 0,025 (ng / mL) -1 cm -1. </li><li> Adicionar a um tubo estéril de PCR 1 ul de oligo (dT), 1 ul de 10 mM de dNTP mix, e 250 ug de ARN. Completar o volume para 11 mL com DDH estéril 2 O. </li><li> Incubar durante 5 min a 65 ° C. Em seguida, adicionar 4 mL First Strand Buffer, 1 ul de 0,1 M ditiotreitol, 0,25 ul de transcriptase reversa e 1,75 ul ddH2O para o tubo. Incubar a 50 ° C durante 1 h seguido de 72 ° C durante 15 min. Opcionalmente, o produto de cDNA diluído 1: 5, utilizando DDQ 2 O. </li><li> Para a PCR quantitativa cDNA uso 2 l, 2 l DDH 2 O, 5 jul qPCR mistura principal, e 1ul de 10 uM de cada um para a frente e para trás os estoques de iniciadores para amplificar o gene (s) de escolha. Misturar em uma placa de 96 poços e analisar usando uma máquina de PCR quantitativa (Figuras 1B e 1C). </li></ol>

<ol>
	<li>Yoshida, H., Okabe, Y., Kawane, K., Fukuyama, H., Nagata, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Lethal+anemia+caused+by+interferon-beta+produced+in+mouse+embryos+carrying+undigested+DNA.">Lethal anemia caused by interferon-beta produced in mouse embryos carrying undigested DNA.</a> Nat. Immunol. 6, 49-56 (2005).</li><li>Ishikawa, H., Ma, Z., Barber, G. N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=STING+regulates+intracellular+DNA-mediated,+type+I+interferon-dependent+innate+immunity.">STING regulates intracellular DNA-mediated, type I interferon-dependent innate immunity.</a> Nature. 461, 788-792 (2009).</li><li>Ishii, K. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=TANK-binding+kinase-1+delineates+innate+and+adaptive+immune+responses+to+DNA+vaccines.">TANK-binding kinase-1 delineates innate and adaptive immune responses to DNA vaccines.</a> Nature. 451, 725-729 (2008).</li><li>Stetson, D. B., Medzhitov, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Recognition+of+cytosolic+DNA+activates+an+IRF3-dependent+innate+immune+response.">Recognition of cytosolic DNA activates an IRF3-dependent innate immune response.</a> Immunity. 24, 93-103 (2006).</li><li>Pichlmair, A., Reise Sousa, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Innate+recognition+of+viruses.">Innate recognition of viruses.</a> Immunity. 27, 370-383 (2007).</li><li>Unterholzner, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=IFI16+is+an+innate+immune+sensor+for+intracellular+DNA.">IFI16 is an innate immune sensor for intracellular DNA.</a> Nat. Immunol. 11, 997-1004 (2010).</li><li>Ferguson, B. J., Mansur, D. S., Peters, N. E., Ren, H., Smith, G. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=DNA-PK+is+a+DNA+sensor+for+IRF-3-dependent+innate+immunity.">DNA-PK is a DNA sensor for IRF-3-dependent innate immunity.</a> Elife. 1, e00047 (2012).</li><li>Sun, L., Wu, J., Du, F., Chen, X., Chen, Z. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cyclic+GMP-AMP+synthase+is+a+cytosolic+DNA+sensor+that+activates+the+type+I+interferon+pathway.">Cyclic GMP-AMP synthase is a cytosolic DNA sensor that activates the type I interferon pathway.</a> Science. 339, 786-791 (2013).</li><li>Honda, K., Taniguchi, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=IRFs:+master+regulators+of+signalling+by+Toll-like+receptors+and+cytosolic+pattern-recognition+receptors.">IRFs: master regulators of signalling by Toll-like receptors and cytosolic pattern-recognition receptors.</a> Nat. Rev. Immunol. 6, 644-658 (2006).</li><li>Karayel, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+TLR-independent+DNA+recognition+pathway+in+murine+macrophages:+Ligand+features+and+molecular+signature.">The TLR-independent DNA recognition pathway in murine macrophages: Ligand features and molecular signature.</a> Eur. J. Immunol. 39, 1929-1936 (2009).</li></ol>

The authors have nothing to disclose.

Os protocolos aqui descritos são utilizados para gerar dsDNA para estimular a resposta imune inata citosólica com resultados reprodutíveis em uma ampla gama de tipos de células e in vivo. Uma vez que o principal reagente de substrato utilizado é um oligonucleótido sintético, não há flexibilidade no presente sistema para a utilização de sequências de ADN alternativos ou modificações químicas. É possível, por exemplo, para substituir a cadeia de oligonucleótido descrito adiante neste protocolo c...

DNA é um componente vital de todos os organismos e células eucariontes, que manter em compartimentos específicos. Uma das funções do sistema imune inata é identificar quando tais compartimentalização quebra ou quando o material estranho é introduzido no organismo por meio de uma quebra de barreiras físicas externas. No corpo humano, há um certo número de proteínas que existem para ajudar a degradar pequenas quantidades de ADN, que pode escapar da compartimentação correcta; DNAse I, II, III e quebrar o DNA no plasma, endossoma, e citosol, respectivamente. No entanto, foi demonstrado que ratinhos que carecem de DNAse II morrem de anemia grave causada pela produção excessiva de uma interferões, sugerindo que o sistema imune inato responde ao ADN extra-nuclear. Esta resposta ocorre mesmo em ratinhos que são totalmente deficiente na capacidade de sinalização dos receptores do tipo Toll. Numerosos estudos têm mostrado agora que estimulador de genes interferon (STING) 2 e de ligação TANK quinase 1 (TBK1) 3 estão envolvidos na detecção de DNA no citoplasma e que esta via de sinalização activa o factor regulador de interferão (IRF) -3 4. A posterior transcrição dependente de IRF3 de citocinas, quimiocinas e genes interferon é característica de uma resposta imune inata, quer um patógeno ou perigo associado padrão molecular (PAMP ou DAMP) 5. O desejo de estudar intracelulares nucleicos vias sensoriais ácido levou à necessidade de desenvolver métodos consistentes e reprodutíveis para estimulação das células através da introdução de DNA ou RNA em células sem activar outras respostas imunitárias inatas. Um método pelo qual o aguilhão / TBK1 / via IRF3 pode ser estimulado é através da utilização de lípidos catiónicos os reagentes de transfecção para entregar ácidos nucleicos para o citoplasma, onde pode ser acedido por meio de sensores de ADN, tais como ADN-PK, IFI16, e cgas 6-8. As características de ADN que são correntemente considerados para permitir eficient activação da resposta imune inata citoplasmática sem estimulação de outras vias são o seu comprimento, de massa, pureza e falta de CpG motifs 4,7,9. Os oligonucleótidos sintéticos são altamente adequados para a finalidade de gerar uma resposta imune inata uma vez que permitem que a sequência de DNA a ser optimizado e preparado como uma espécie química pura. Um ADN (DSI) sequência de imuno-estimuladora 45 pares de bases foi identificado por Stetson et al. Quatro como sendo uma sequência adequada, CpG-livre para esse efeito. Esta seqüência dsDNA é outra forma aleatória e não tem características específicas para além de sua falta de motivos CpG. Verificou-se que o oligonucleótido por concatemerizing DSI em filamentos longos aumenta significativamente a magnitude da estimulação 7. Geração de ISD concatemerized é, portanto, útil para estimular uma resposta imune inata citoplasmática. Aqui apresenta-se os protocolos para a preparação deste reagente e como ela pode ser utilizada para activar a via de detecção de ADN emvitro, bem como in vivo. NOTA: Todos os estudos em animais são realizados no âmbito de protocolos institucionais aprovados e orientações de cuidados de animais.

<table border="0" cellpadding="0" cellspacing="0" width="1066">
	<tbody>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">Forward Primer</td>
			<td style="width:221px;">Integrated DNA technologies</td>
			<td style="width:144px;">n/a</td>
			<td style="width:407px;">TACAGATCTACTAGTGATCTATGACTGATCTGTACATGATCTACA</td>
		</tr>
		<tr height="19">
			<td height="19" style="height:19px;width:295px;">Reverse Primer</td>
			<td style="width:221px;">Integrated DNA technologies</td>
			<td style="width:144px;">n/a</td>
			<td>TGTAGATCATGTACAGATCAGTCATAGATCACTAGTAGATCTGTA</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">PEG8000</td>
			<td style="width:221px;">Sigma-Aldrich</td>
			<td style="width:144px;">P-4463</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">Molecular biology grade water</td>
			<td style="width:221px;">Sigma-Aldrich</td>
			<td style="width:144px;">W4502-1L</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">T4 Polynucleotide Kinase</td>
			<td style="width:221px;">Promega</td>
			<td style="width:144px;">M4101</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">T4 DNA Ligase</td>
			<td style="width:221px;">Promega</td>
			<td style="width:144px;">M1801</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">Phenol:Chloroform</td>
			<td style="width:221px;">Fisher Chemical</td>
			<td style="width:144px;">BPE1752p-400</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">Chloroform</td>
			<td style="width:221px;">Fisher Chemical</td>
			<td style="width:144px;">C/4960/PB08</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">Ethanol</td>
			<td style="width:221px;">Sigma-Aldrich</td>
			<td style="width:144px;">32221-2.5L</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">DNA gel loading buffer</td>
			<td style="width:221px;">New England biolabs</td>
			<td style="width:144px;">B7021S</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">Agarose</td>
			<td style="width:221px;">Bioline</td>
			<td style="width:144px;">BIO-41025</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">Optimem</td>
			<td style="width:221px;">Life Technologies</td>
			<td style="width:144px;">11058021</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">TransIT-LT1&#160;</td>
			<td style="width:221px;">Mirus Bioscience</td>
			<td style="width:144px;">MIR 2300</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">Hamilton Syringe</td>
			<td style="width:221px;">Hamilton</td>
			<td style="width:144px;">80901 Model 1705</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">30G needles&#160;</td>
			<td style="width:221px;">BD bioscience</td>
			<td style="width:144px;">304000</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">SYBR Safe DNA gel stain</td>
			<td style="width:221px;">Life Technologies</td>
			<td style="width:144px;">S33102</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">Rneasy Plus Mini Kit</td>
			<td style="width:221px;">Qiagen</td>
			<td style="width:144px;">74134</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">Oligo(dT) primer</td>
			<td style="width:221px;">Thermo Scientific</td>
			<td style="width:144px;">SO131</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">dNTP mix</td>
			<td style="width:221px;">Fermentas</td>
			<td style="width:144px;">R0192</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">Super Script III reverse transcriptase</td>
			<td style="width:221px;">Life Technologies</td>
			<td align="right" style="width:144px;">56575</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">First strand cDNA synthesis buffer</td>
			<td style="width:221px;">Life Technologies</td>
			<td style="width:144px;">y02321</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">SybrGreen qPCR Fast master mix</td>
			<td style="width:221px;">Applied Biosystems</td>
			<td align="right" style="width:144px;">4385612</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">cxcl10 murine forward primer&#160;</td>
			<td style="width:221px;">Integrated DNA technologies</td>
			<td style="width:144px;">n/a</td>
			<td>ACTGCATCCATATCGATGAC</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">cxcl10 murine reverse primer</td>
			<td style="width:221px;">Integrated DNA technologies</td>
			<td style="width:144px;">n/a</td>
			<td>TTCATCGTGGCAATGATCTC</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">il6 murine forward primer&#160;</td>
			<td style="width:221px;">Integrated DNA technologies</td>
			<td style="width:144px;">n/a</td>
			<td>GTAGCTATGGTACTCCAGAAGAC</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">il6 murine forward primer&#160;</td>
			<td style="width:221px;">Integrated DNA technologies</td>
			<td style="width:144px;">n/a</td>
			<td>GTAGCTATGGTACTCCAGAAGAC</td>
		</tr>
	</tbody>
</table>

stimulation of cytoplasmic dna sensing pathways in vitro and in vivo

A fim de estimular eficazmente uma resposta imune inata, o DNA tem de ser de comprimento e pureza suficientes. Apresenta-se um método em que o ADN de cadeia dupla (dsDNA), que possui as características necessárias para estimular o ADN citoplasmática vias sensoriais pode ser gerada de forma barata e com facilidade. Pelo concatemerization de oligonucleótidos curtos, sintéticos (que não têm motivos CpG), dsDNA pode ser gerado para ser de comprimento suficiente para activar a via citosólica detecção de ADN. Este protocolo envolve a ligação de extremidades rombas de oligonucleótidos na presença de polietileno glicol (PEG), que proporciona um ambiente eficaz para a ligação ocorra. Os concatemeros dsDNA pode ser usado, após purificação por extracção com fenol / clorofórmio, para simular a resposta imune inata in vitro por protocolos de transfecção convencionais. Este ADN pode também ser utilizada para estimular a imunidade inata in vivo por injecção intradérmica no pavilhão auricular de um rato, por exemplo. Porpadronizar o processo concatemerization e os protocolos de estimulação posterior, uma activação fiável e reprodutível do sistema imune inato pode ser produzido.

<html> Os resultados abaixo indicam que o DNA concatemerized pode ser gerado com relativa facilidade e é capaz de estimular uma resposta imune inata e robusto nas células em ratinhos. Com o uso de PEG8000, que pode ser claramente visto que o comprimento do ADN a ser gerado é significativamente mais longa e igualmente capazes de induzir a transcrição de CXCL10. Como se pode ver pela análise em gel de agarose, o concatemerization padrão tem comprimentos de ADN de mais de 800 pares de bases (pb), enquanto que para a ...

Watch this Scientific Journal Video about Stimulation of Cytoplasmic DNA Sensing Pathways In Vitro and In Vivo at JoVE.com

Stimulation of Cytoplasmic DNA Sensing Pathways In Vitro and In Vivo

O objectivo do protocolo é a utilização de métodos mais eficientes para estimular as vias sensoriais citoplasmáticos de ADN em células e in vivo. Isto é conseguido através da melhoria da geração de ADN de comprimento, de cadeia dupla, durante a ligação das extremidades cegas. As células ou os ratinhos são depois transfectadas utilizando um reagente de transfecção de lípidos.

Estimulação da Citoplasmáticas DNA Sensing Pathways<em&gt; In Vitro</em&gt; E<em&gt; In Vivo</em

In order to efficiently stimulate an innate immune response, DNA must be of sufficient length and purity. We present a method where double stranded DNA ...

stimulation-of-cytoplasmic-dna-sensing-pathways-in-vitro-and-in-vivo

Research

JoVE Journal

Biology

Stimulation of Cytoplasmic DNA Sensing Pathways In Vitro and In Vivo

8.8K visualizações.  University of Cambridge.  O objectivo do protocolo é a utilização de métodos mais eficientes para estimular as vias sensoriais citoplasmáticos de ADN em células e in vivo. Isto é conseguido através da melhoria da geração de ADN de comprimento, de cadeia dupla, durante a ligação das extremidades cegas. As células ou os ratinhos são depois transfectadas utilizando um reagente de transfecção de lípidos. 

Vídeo: Stimulation of Cytoplasmic DNA Sensing Pathways In Vitro and In Vivo

In vitro and in vivo Bioluminescence Reporter Gene Imaging of Human Embryonic Stem Cells

The discovery of human embryonic stem cells (hESCs) has dramatically increased the tools available to medical scientists interested in regenerative medicine. However, direct injection of hESCs, and cells differentiated from hESCs, into living organisms has thus far been hampered by significant cell death, teratoma formation, and host immune rejection. Understanding the in vivo hESC behavior after transplantation requires novel imaging techniques to longitudinally monitor hESC localization, proliferation, and viability. Molecular imaging has given investigators a high-throughput, inexpensive, and sensitive means for tracking in vivo cell proliferation over days, weeks, and even months. This advancement has significantly increased the understanding of the spatio-temporal kinetics of hESC engraftment, proliferation, and teratoma-formation in living subjects.

A major advance in molecular imaging has been the extension of noninvasive reporter gene assays from molecular and cellular biology into in vivo multi-modality imaging platforms. These reporter genes, under control of engineered promoters and enhancers that take advantage of the host cell s transcriptional machinery, are introduced into cells using a variety of vector and non-vector methods. Once in the cell, reporter genes can be transcribed either constitutively or only under specific biological or cellular conditions, depending on the type of promoter used. Transcription and translation of reporter genes into bioactive proteins is then detected with sensitive, noninvasive instrumentation (e.g., CCD cameras) using signal-generating probes such as D-luciferin.

To avoid the need for excitatory light to track stem cells in vivo as is required for fluorescence imaging, bioluminescence reporter gene imaging systems require only an exogenously administered probe to induce light emission. Firefly luciferase, derived from the firefly Photinus pyralis, encodes an enzyme that catalyzes D-luciferin to the optically active metabolite, oxyluciferin. Optical activity can then be monitored with an external CCD camera. Stably transduced cells that carry the reporter construct within their chromosomal DNA will pass the reporter construct DNA to daughter cells, allowing for longitudinal monitoring of hESC survival and proliferation in vivo. Furthermore, because expression of the reporter gene product is required for signal generation, only viable parent and daughter cells will create bioluminescence signal; apoptotic or dead cells will not. 

In this video, the specific materials and methods needed for tracking stem cell proliferation and teratoma formation with bioluminescence imaging will be described.

With the growing interest in stem cell therapies, molecular imaging techniques are ideal for monitoring stem cell behavior after transplantation. Luciferase reporter genes have enabled non-invasive, repetitive assessment of cell survival, location, and proliferation in vivo. This video will demonstrate how to track hESC proliferation in a living mouse.

In vitro e in vivo de imagens Gene Reporter bioluminescência de células estaminais embrionárias humanas

The discovery of human embryonic stem cells (hESCs) has dramatically increased the tools available to medical scientists interested in regenerative ...

Biologia

DNA Transfection of Mammalian Skeletal Muscles using In Vivo Electroporation

A growing interest in cell biology is to express transgenically modified forms of essential proteins (e.g. fluorescently tagged constructs and/or mutant variants) in order to investigate their endogenous distribution and functional relevance. An interesting approach that has been implemented to fulfill this objective in fully differentiated cells is the in vivo transfection of plasmids by various methods into specific tissues such as liver1, skeletal muscle2,3, and even the brain4. We present here a detailed description of the steps that must be followed in order to efficiently transfect genetic material into fibers of the flexor digitorum brevis (FDB) and interosseus (IO) muscles of adult mice using an in vivo electroporation approach. The experimental parameters have been optimized so as to maximize the number of muscle fibers transfected while minimizing tissue damages that may impair the quality and quantity of the proteins expressed in individual fibers. We have verified that the implementation of the methodology described in this paper results in a high yield of soluble proteins, i.e. EGFP and ECFP3, calpain, FKBP12, &beta;2a-DHPR, etc. ; structural proteins, i.e. minidystrophin and &alpha;-actinin; and membrane proteins, i.e. &alpha;1s-DHPR, RyR1, cardiac Na/Ca2+ exchanger , NaV1.4 Na channel, SERCA1, etc., when applied to FDB, IO and other muscles of mice and rats. The efficient expression of some of these proteins has been verified with biochemical3 and functional evidence5. However, by far the most common confirmatory approach used by us are standard fluorescent microscopy and 2-photon laser scanning microscopy (TPLSM), which permit to identify not only the overall expression, but also the detailed intracellular localization, of fluorescently tagged protein constructs. The method could be equally used to transfect plasmids encoding for the expression of proteins of physiological relevance (as shown here), or for interference RNA (siRNA) aiming to suppress the expression of normally expressed proteins (not tested by us yet). It should be noted that the transfection of FDB and IO muscle fibers is particularly relevant for the investigation of mammalian muscle physiology since fibers enzymatically dissociated from these muscles are currently one of the most suitable models to investigate basic mechanisms of excitability and excitation-contraction coupling under current or voltage clamp conditions2,6-8.

DNA Transfection of Mammalian Skeletal Muscles using In Vivo Electroporation

We describe detailed procedures for the efficient transfection of plasmid DNA into the fibers of foot muscles of live mice using electroporation and the subsequent visualization of protein expression using fluorescence microscopy.

Transfecção de DNA de mamíferos usando músculos esqueléticos In Vivo Eletroporação

 A growing interest in cell biology is to express transgenically modified forms of essential proteins (e.g. fluorescently tagged constructs and/or mutant ...

In vivo and in vitro Studies of Adaptor-clathrin Interaction

A major endocytic pathway initiates with the formation of clathrin-coated vesicles (CCVs) that transport cargo from the cell surface to endosomes1-6. CCVs are distinguished by a polyhedral lattice of clathrin that coats the vesicle membrane and serves as a mechanical scaffold. Clathrin coats are assembled during vesicle formation from individual clathrin triskelia , the soluble form of clathrin composed of three heavy and three light chain subunits7,8. Because the triskelion does not have the ability to bind to the membrane directly, clathrin-binding adaptors are critical to link the forming clathrin lattice to the membrane through association with lipids and/or membrane proteins9. Adaptors also package transmembrane protein cargo, such as receptors, and can interact with each other and with other components of the CCV formation machinery9.
Over twenty clathrin adaptors have been described, several are involved in clathrin mediated endocytosis and others localize to the trans Golgi network or endosomes9. With the exception of HIP1R (yeast Sla2p), all known clathrin adaptors bind to the N-terminal -propeller domain of the clathrin heavy chain9. Clathrin adaptors are modular proteins consisting of folded domains connected by unstructured flexible linkers. Within these linker regions, short binding motifs mediate interactions with the clathrin N-terminal domain or other components of the vesicle formation machinery9. Two distinct clathrin-binding motifs have been defined: the clathrin-box and the W-box9. The consensus clathrin-box sequence was originally defined as L[L/I][D/E/N][L/F][D/E]10 but variants have been subsequently discovered11. The W-box conforms to the sequence PWxxW (where x is any residue).
Sla1p (Synthetic Lethal with Actin binding protein-1) was originally identified as an actin associated protein and is necessary for normal actin cytoskeleton structure and dynamics at endocytic sites in yeast cells12. Sla1p also binds the NPFxD endocytic sorting signal and is critical for endocytosis of cargo bearing the NPFxD signal13,14. More recently, Sla1p was demonstrated to bind clathrin through a motif similar to the clathrin box, LLDLQ, termed a variant clathrin-box (vCB), and to function as an endocytic clathrin adaptor15. In addition, Sla1p has become a widely used marker for the endocytic coat in live cell fluorescence microscopy studies16. Here we use Sla1p as a model to describe approaches for adaptor-clathrin interaction studies. We focus on live cell fluorescence microscopy, GST-pull down, and co-immunoprecipitation methods.

In vivo and in vitro Studies of Adaptor-clathrin Interaction

Clathrin-mediated endocytosis depends on adaptor proteins that coordinate cargo selection and clathrin coat assembly. Here we describe procedures to study adaptor-clathrin physical interaction and live cell imaging approaches using as a model the yeast endocytic adaptor protein Sla1p.

In vivo e in vitro de Estudos Adaptor-clathrin Interação

A major endocytic pathway initiates with the formation of clathrin-coated vesicles (CCVs) that transport cargo from the cell surface to endosomes1-6. CCVs ...

Visualization of MG53-mediated Cell Membrane Repair Using in vivo and in vitro Systems

Repair of acute injury to the cell membrane is an elemental process of normal cellular physiology, and defective membrane repair has been linked to many degenerative human diseases. The recent discovery of MG53 as a key component of the membrane resealing machinery allows for a better molecular understanding of the basic biology of tissue repair, as well as for potential translational applications in regenerative medicine. Here we detail the experimental protocols for exploring the in vivo function of MG53 in repair of muscle injury using treadmill exercise protocols on mouse models, for testing the ex vivo membrane repair capacity by measuring dye entry into isolated muscle fibers, and for monitoring the dynamic process of MG53-mediated vesicle trafficking and cell membrane repair in cultured cells using live cell confocal microscopy.

Visualization of MG53-mediated Cell Membrane Repair Using in vivo and in vitro Systems

Described here are protocols used to visualize the dynamic process of MG53-mediated cell membrane repair in whole animals and at the cellular level. These methods can be applied to investigate the cell biology of plasma membrane resealing and regenerative medicine.

Visualização de MG53 mediada Repair Membrana Celular Usando In vivo E In vitro Sistemas

Repair of acute injury to the cell membrane is an elemental process of normal cellular physiology, and defective membrane repair has been linked to many ...

Activation of Apoptosis by Cytoplasmic Microinjection of Cytochrome c

Apoptosis, or programmed cell death, is a conserved and highly regulated pathway by which cells die1. Apoptosis can be triggered when cells encounter a wide range of cytotoxic stresses. These insults initiate signaling cascades that ultimately cause the release of cytochrome c from the mitochondrial intermembrane space to the cytoplasm2. The release of cytochrome c from mitochondria is a key event that triggers the rapid activation of caspases, the key cellular proteases which ultimately execute cell death3-4.
The pathway of apoptosis is regulated at points upstream and downstream of cytochrome c release from mitochondria5. In order to study the post-mitochondrial regulation of caspase activation, many investigators have turned to direct cytoplasmic microinjection of holocytochrome c (heme-attached) protein into cells6-9. Cytochrome c is normally localized to the mitochondria where attachment of a heme group is necessary to enable it to activate apoptosis10-11. Therefore, to directly activate caspases, it is necessary to inject the holocytochrome c protein instead of its cDNA, because while the expression of cytochrome c from cDNA constructs will result in mitochondrial targeting and heme attachment, it will be sequestered from cytosolic caspases. Thus, the direct cytosolic microinjection of purified heme-attached cytochrome c protein is a useful tool to mimic mitochondrial cytochrome c release and apoptosis without the use of toxic insults which cause cellular and mitochondrial damage.
In this article, we describe a method for the microinjection of cytochrome c protein into cells, using mouse embryonic fibroblasts (MEFs) and primary sympathetic neurons as examples. While this protocol focuses on the injection of cytochrome c for investigations of apoptosis, the techniques shown here can also be easily adapted for microinjection of other proteins of interest.

Activation of Apoptosis by Cytoplasmic Microinjection of Cytochrome c

In this protocol, we describe the direct cytoplasmic microinjection of cytochrome c protein into fibroblasts and primary sympathetic neurons. This technique allows for the introduction of cytochrome c protein into the cytoplasm of cells and mimics the release of cytochrome c from mitochondria, which occurs during apoptosis.

Ativação da apoptose por microinjeção citoplasmática de citocromo C</em

Apoptosis, or programmed cell death, is a conserved and highly regulated pathway by which cells die1.  Apoptosis can be triggered when cells encounter a ...

Isolation of Ribosome Bound Nascent Polypeptides in vitro to Identify Translational Pause Sites Along mRNA

The rate of translational elongation is non-uniform. mRNA secondary structure, codon usage and mRNA associated proteins may alter ribosome movement on the messagefor review see 1. However, it's now widely accepted that synonymous codon usage is the primary cause of non-uniform translational elongation rates1. Synonymous codons are not used with identical frequency. A bias exists in the use of synonymous codons with some codons used more frequently than others2. Codon bias is organism as well as tissue specific2,3. Moreover, frequency of codon usage is directly proportional to the concentrations of cognate tRNAs4. Thus, a frequently used codon will have higher multitude of corresponding tRNAs, which further implies that a frequent codon will be translated faster than an infrequent one. Thus, regions on mRNA enriched in rare codons (potential pause sites) will as a rule slow down ribosome movement on the message and cause accumulation of nascent peptides of the respective sizes5-8. These pause sites can have functional impact on the protein expression, mRNA stability and protein foldingfor review see 9. Indeed, it was shown that alleviation of such pause sites can alter ribosome movement on mRNA and subsequently may affect the efficiency of co-translational (in vivo) protein folding1,7,10,11. To understand the process of protein folding in vivo, in the cell, that is ultimately coupled to the process of protein synthesis it is essential to gain comprehensive insights into the impact of codon usage/tRNA content on the movement of ribosomes along mRNA during translational elongation.
Here we describe a simple technique that can be used to locate major translation pause sites for a given mRNA translated in various cell-free systems6-8. This procedure is based on isolation of nascent polypeptides accumulating on ribosomes during in vitro translation of a target mRNA. The rationale is that at low-frequency codons, the increase in the residence time of the ribosomes results in increased amounts of nascent peptides of the corresponding sizes. In vitro transcribed mRNA is used for in vitro translational reactions in the presence of radioactively labeled amino acids to allow the detection of the nascent chains. In order to isolate ribosome bound nascent polypeptide complexes the translation reaction is layered on top of 30% glycerol solution followed by centrifugation. Nascent polypeptides in polysomal pellet are further treated with ribonuclease A and resolved by SDS PAGE. This technique can be potentially used for any protein and allows analysis of ribosome movement along mRNA and the detection of the major pause sites. Additionally, this protocol can be adapted to study factors and conditions that can alter ribosome movement and thus potentially can also alter the function/conformation of the protein.

Isolation of Ribosome Bound Nascent Polypeptides in vitro to Identify Translational Pause Sites Along mRNA

A technique to identify translational pause sites on mRNA is described. This procedure is based on isolation of nascent polypeptides accumulating on ribosomes during in vitro translation of a target mRNA, followed by the size analysis of the nascent chains using a denaturing gel electrophoresis.

Isolamento de Ribossomos ligados a polipeptídeos nascentes<em&gt; In vitro</em&gt; Identificar Sites Pausa translacionais Junto mRNA

The rate of translational elongation is non-uniform. mRNA secondary structure, codon usage and mRNA associated proteins may alter ribosome movement on the ...

Visualizing Cytoplasmic Flow During Single-cell Wound Healing in Stentor coeruleus

Although wound-healing is often addressed at the level of whole tissues, in many cases individual cells are able to heal wounds within themselves, repairing broken cell membrane before the cellular contents leak out. The giant unicellular organism Stentor coeruleus, in which cells can be more than one millimeter in size, have been a classical model organism for studying wound healing in single cells. Stentor cells can be cut in half without loss of viability, and can even be cut and grafted together. But this high tolerance to cutting raises the question of why the cytoplasm does not simply flow out from the size of the cut. Here we present a method for cutting Stentor cells while simultaneously imaging the movement of cytoplasm in the vicinity of the cut at high spatial and temporal resolution. The key to our method is to use a &#34;double decker&#34; microscope configuration in which the surgery is performed under a dissecting microscope focused on a chamber that is simultaneously viewed from below at high resolution using an inverted microscope with a high NA lens. This setup allows a high level of control over the surgical procedure while still permitting high resolution tracking of cytoplasm.

Visualizing Cytoplasmic Flow During Single-cell Wound Healing in Stentor coeruleus

The giant ciliate Stentor coeruleus is a classical system for studying regeneration and wound healing in single cells.&#160;By imaging Stentor cells simultaneously at low and high magnification it is possible to measure cytoplasmic flows before, during, and after wounding.

Although wound-healing is often addressed at the level of whole tissues, in many cases individual cells are able to heal wounds within themselves, ...

Real-time Imaging of Single Engineered RNA Transcripts in Living Cells Using Ratiometric Bimolecular Beacons

The growing realization that both the temporal and spatial regulation of gene expression can have important consequences on cell function has led to the development of diverse techniques to visualize individual RNA transcripts in single living cells. One promising technique that has recently been described utilizes an oligonucleotide-based optical probe, ratiometric bimolecular beacon (RBMB), to detect RNA transcripts that were engineered to contain at least four tandem repeats of the RBMB target sequence in the 3&#8217;-untranslated region. RBMBs are specifically designed to emit a bright fluorescent signal upon hybridization to complementary RNA, but otherwise remain quenched. The use of a synthetic probe in this approach allows photostable, red-shifted, and highly emissive organic dyes to be used for imaging. Binding of multiple RBMBs to the engineered RNA transcripts results in discrete fluorescence spots when viewed under a wide-field fluorescent microscope. Consequently, the movement of individual RNA transcripts can be readily visualized in real-time by taking a time series of fluorescent images. Here we describe the preparation and purification of RBMBs, delivery into cells by microporation and live-cell imaging of single RNA transcripts.

Ratiometric bimolecular beacons (RBMBs) can be used to image single engineered RNA transcripts in living cells. Here, we describe the preparation and purification of RBMBs, delivery of RBMBs into cells by microporation and fluorescent imaging of single RNA transcripts in real-time.

Imagens em tempo real de uma única Engineered RNA transcritos em células vivas usando raciométrica Bimolecular Beacons

The growing realization that both the temporal and spatial regulation of gene expression can have important consequences on cell function has led to the ...

The c-FOS Protein Immunohistological Detection: A Useful Tool As a Marker of Central Pathways Involved in Specific Physiological Responses In Vivo and Ex Vivo

Many studies seek to identify and map the brain regions involved in specific physiological regulations. The proto-oncogene c-fos, an immediate early gene, is expressed in neurons in response to various stimuli. The protein product can be readily detected with immunohistochemical techniques leading to the use of c-FOS detection to map groups of neurons that display changes in their activity. In this article, we focused on the identification of brainstem neuronal populations involved in the ventilatory adaptation to hypoxia or hypercapnia. Two approaches were described to identify involved neuronal populations in vivo in animals and ex vivo in deafferented brainstem preparations. In vivo, animals were exposed to hypercapnic or hypoxic gas mixtures. Ex vivo, deafferented preparations were superfused with hypoxic or hypercapnic artificial cerebrospinal fluid. In both cases, either control in vivo animals or ex vivo preparations were maintained under normoxic and normocapnic conditions. The comparison of these two approaches allows the determination of the origin of the neuronal activation i.e., peripheral and/or central. In vivo and ex vivo, brainstems were collected, fixed, and sliced into sections. Once sections were prepared, immunohistochemical detection of the c-FOS protein was made in order to identify the brainstem groups of cells activated by hypoxic or hypercapnic stimulations. Labeled cells were counted in brainstem respiratory structures. In comparison to the control condition, hypoxia or hypercapnia increased the number of c-FOS labeled cells in several specific brainstem sites that are thus constitutive of the neuronal pathways involved in the adaptation of the central respiratory drive.

The c-FOS Protein Immunohistological Detection: A Useful Tool As a Marker of Central Pathways Involved in Specific Physiological Responses In Vivo and Ex Vivo

Here, we present a protocol based on c-FOS protein immunohistological detection, a classical technique used for the identification of neuronal populations involved in specific physiological responses in vivo and ex vivo.

A proteína c-Fos Detecção imuno: Uma ferramenta útil como um marcador de vias centrais envolvidos em respostas fisiológicas específicas<em&gt; In Vivo</em&gt; e<em&gt; Ex Vivo</em

Many studies seek to identify and map the brain regions involved in specific physiological regulations. The proto-oncogene c-fos, an immediate early gene, ...

Filtration Isolation of Nucleic Acids:  A Simple and Rapid DNA Extraction Method

FINA, filtration isolation of nucleic acids, is a novel extraction method which utilizes vertical filtration via a separation membrane and absorbent pad to extract cellular DNA from whole blood in less than 2 min. The blood specimen is treated with detergent, mixed briefly and applied by pipet to the separation membrane. The lysate wicks into the blotting pad due to capillary action, capturing the genomic DNA on the surface of the separation membrane. The extracted DNA is retained on the membrane during a simple wash step wherein PCR inhibitors are wicked into the absorbent blotting pad. The membrane containing the entrapped DNA is then added to the PCR reaction without further purification. This simple method does not require laboratory equipment and can be easily implemented with inexpensive laboratory supplies. Here we describe a protocol for highly sensitive detection and quantitation of HIV-1 proviral DNA from 100 &#181;l whole blood as a model for early infant diagnosis of HIV that could readily be adapted to other genetic targets.

We describe here a simple and rapid paper-based DNA extraction method of HIV proviral DNA from whole blood detected by quantitative PCR. This protocol can be extended for use in detecting other genetic markers or using alternative amplification methods.

Isolamento de filtração de Ácidos Nucleicos: Um Método de extracção de DNA simples e rápido

FINA, filtration isolation of nucleic acids, is a novel extraction method which utilizes vertical filtration via a separation membrane and absorbent pad ...