The authors have no acknowledgments.

1. Concatemerization
<ol>
	<li>Resuspend primers Fw and Rv (see Table of Materials for primer sequences) to a concentration of 10 &#181;g/&#181;l in molecular biology grade H2O. Then, mix 5 &#181;l of Fw and 5 &#181;l of Rv primer in a 1.5 ml microcentrifuge tube.</li>
	<li>Anneal primer mix by heating to the correct annealing temperature (75 &#176;C for the primers described here) for 15 min. Leave on bench to cool down at room temperature (RT). Prepare the 60% PEG8000 during this incubation by dissolving i...

<ol>
	<li>Yoshida, H., Okabe, Y., Kawane, K., Fukuyama, H., Nagata, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Lethal+anemia+caused+by+interferon-beta+produced+in+mouse+embryos+carrying+undigested+DNA.">Lethal anemia caused by interferon-beta produced in mouse embryos carrying undigested DNA.</a> Nat. Immunol. 6, 49-56 (2005).</li><li>Ishikawa, H., Ma, Z., Barber, G. N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=STING+regulates+intracellular+DNA-mediated,+type+I+interferon-dependent+innate+immunity.">STING regulates intracellular DNA-mediated, type I interferon-dependent innate immunity.</a> Nature. 461, 788-792 (2009).</li><li>Ishii, K. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=TANK-binding+kinase-1+delineates+innate+and+adaptive+immune+responses+to+DNA+vaccines.">TANK-binding kinase-1 delineates innate and adaptive immune responses to DNA vaccines.</a> Nature. 451, 725-729 (2008).</li><li>Stetson, D. B., Medzhitov, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Recognition+of+cytosolic+DNA+activates+an+IRF3-dependent+innate+immune+response.">Recognition of cytosolic DNA activates an IRF3-dependent innate immune response.</a> Immunity. 24, 93-103 (2006).</li><li>Pichlmair, A., Reise Sousa, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Innate+recognition+of+viruses.">Innate recognition of viruses.</a> Immunity. 27, 370-383 (2007).</li><li>Unterholzner, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=IFI16+is+an+innate+immune+sensor+for+intracellular+DNA.">IFI16 is an innate immune sensor for intracellular DNA.</a> Nat. Immunol. 11, 997-1004 (2010).</li><li>Ferguson, B. J., Mansur, D. S., Peters, N. E., Ren, H., Smith, G. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=DNA-PK+is+a+DNA+sensor+for+IRF-3-dependent+innate+immunity.">DNA-PK is a DNA sensor for IRF-3-dependent innate immunity.</a> Elife. 1, e00047 (2012).</li><li>Sun, L., Wu, J., Du, F., Chen, X., Chen, Z. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cyclic+GMP-AMP+synthase+is+a+cytosolic+DNA+sensor+that+activates+the+type+I+interferon+pathway.">Cyclic GMP-AMP synthase is a cytosolic DNA sensor that activates the type I interferon pathway.</a> Science. 339, 786-791 (2013).</li><li>Honda, K., Taniguchi, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=IRFs:+master+regulators+of+signalling+by+Toll-like+receptors+and+cytosolic+pattern-recognition+receptors.">IRFs: master regulators of signalling by Toll-like receptors and cytosolic pattern-recognition receptors.</a> Nat. Rev. Immunol. 6, 644-658 (2006).</li><li>Karayel, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+TLR-independent+DNA+recognition+pathway+in+murine+macrophages:+Ligand+features+and+molecular+signature.">The TLR-independent DNA recognition pathway in murine macrophages: Ligand features and molecular signature.</a> Eur. J. Immunol. 39, 1929-1936 (2009).</li></ol>

The authors have nothing to disclose.

The protocols described here are used to generate dsDNA to stimulate the cytosolic innate immune response with reproducible results in a wide range of cell types and in vivo. Since the main substrate reagent used is a synthetic oligonucleotide, there is flexibility in this system for using alternative DNA sequences or chemical modifications. It is possible, for instance, to replace the forward strand oligonucleotide described in this protocol with one that contains a fluorescent label or a biotin moiety to track...

DNA is a vital component of all organisms and cells, which eukaryotes keep in specific compartments. One function of the innate immune system is to identify when such compartmentalization breaks down or when foreign material is introduced into the organism via a breach of physical, external barriers. In the human body there are a number of proteins that exist to help degrade small amounts of DNA which may escape the correct compartmentalization; DNAse I, II, and III break down DNA in the plasma, endosome, and cytosol, respectively. However, it has been shown that mice lacking DNAse II die from severe anemia caused by excessive production of interferons1 suggesting that the innate immune system responds to extra-nuclear DNA. This response occurs even in mice which are entirely deficient in toll-like receptor signaling capacity. Numerous studies have now shown that stimulator of interferon genes (STING)2 and TANK-binding kinase 1 (TBK1)3 are involved in the detection of DNA in the cytoplasm and that this signaling pathway activates interferon regulatory factor (IRF)-34. The subsequent IRF3-dependent transcription of cytokine, chemokine, and interferon genes is characteristic of an innate immune response to either a pathogen or danger associated molecular pattern (PAMP or DAMP)5.
The desire to study intracellular nucleic acid sensing pathways has led to the requirement to develop robust and reproducible methods for stimulating cells by introducing DNA or RNA into cells without activating other innate immune responses. One method by which the STING/TBK1/IRF3 pathway can be stimulated is by using cationic lipid transfection reagents to deliver nucleic acid into the cytoplasm where it can be accessed by DNA sensors such as DNA-PK, IFI16, and cGAS6-8.
The characteristics of DNA which are currently understood to allow efficient activation of the cytoplasmic innate immune response without stimulation of other pathways are its length, mass, purity, and lack of CpG motifs4,7,9. Synthetic oligonucleotides are highly suitable for the purpose of generating an innate immune response as they allow the DNA sequence to be optimized and prepared as a pure chemical species. A 45 base pair immuno-stimulatory DNA (ISD) sequence was identified by Stetson et al.4 as being a suitable, CpG-free sequence for this purpose. This dsDNA sequence is otherwise random and has no specific features beyond its lack of CpG motifs. We have found that by concatemerizing the ISD oligonucleotide into significantly longer strands increases the magnitude of the stimulation7. Generation of concatemerized ISD is therefore useful for stimulating a cytoplasmic innate immune response. Here we present protocols for preparing this reagent and how it can be used to activate the DNA sensing pathway in vitro as well as in vivo.
NOTE: All animal studies are performed under approved institutional protocols and animal care guidelines.

<table border="0" cellpadding="0" cellspacing="0" width="1066">
	<tbody>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">Forward Primer</td>
			<td style="width:221px;">Integrated DNA technologies</td>
			<td style="width:144px;">n/a</td>
			<td style="width:407px;">TACAGATCTACTAGTGATCTATGACTGATCTGTACATGATCTACA</td>
		</tr>
		<tr height="19">
			<td height="19" style="height:19px;width:295px;">Reverse Primer</td>
			<td style="width:221px;">Integrated DNA technologies</td>
			<td style="width:144px;">n/a</td>
			<td>TGTAGATCATGTACAGATCAGTCATAGATCACTAGTAGATCTGTA</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">PEG8000</td>
			<td style="width:221px;">Sigma-Aldrich</td>
			<td style="width:144px;">P-4463</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">Molecular biology grade water</td>
			<td style="width:221px;">Sigma-Aldrich</td>
			<td style="width:144px;">W4502-1L</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">T4 Polynucleotide Kinase</td>
			<td style="width:221px;">Promega</td>
			<td style="width:144px;">M4101</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">T4 DNA Ligase</td>
			<td style="width:221px;">Promega</td>
			<td style="width:144px;">M1801</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">Phenol:Chloroform</td>
			<td style="width:221px;">Fisher Chemical</td>
			<td style="width:144px;">BPE1752p-400</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">Chloroform</td>
			<td style="width:221px;">Fisher Chemical</td>
			<td style="width:144px;">C/4960/PB08</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">Ethanol</td>
			<td style="width:221px;">Sigma-Aldrich</td>
			<td style="width:144px;">32221-2.5L</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">DNA gel loading buffer</td>
			<td style="width:221px;">New England biolabs</td>
			<td style="width:144px;">B7021S</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">Agarose</td>
			<td style="width:221px;">Bioline</td>
			<td style="width:144px;">BIO-41025</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">Optimem</td>
			<td style="width:221px;">Life Technologies</td>
			<td style="width:144px;">11058021</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">TransIT-LT1&#160;</td>
			<td style="width:221px;">Mirus Bioscience</td>
			<td style="width:144px;">MIR 2300</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">Hamilton Syringe</td>
			<td style="width:221px;">Hamilton</td>
			<td style="width:144px;">80901 Model 1705</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">30G needles&#160;</td>
			<td style="width:221px;">BD bioscience</td>
			<td style="width:144px;">304000</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">SYBR Safe DNA gel stain</td>
			<td style="width:221px;">Life Technologies</td>
			<td style="width:144px;">S33102</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">Rneasy Plus Mini Kit</td>
			<td style="width:221px;">Qiagen</td>
			<td style="width:144px;">74134</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">Oligo(dT) primer</td>
			<td style="width:221px;">Thermo Scientific</td>
			<td style="width:144px;">SO131</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">dNTP mix</td>
			<td style="width:221px;">Fermentas</td>
			<td style="width:144px;">R0192</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">Super Script III reverse transcriptase</td>
			<td style="width:221px;">Life Technologies</td>
			<td align="right" style="width:144px;">56575</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">First strand cDNA synthesis buffer</td>
			<td style="width:221px;">Life Technologies</td>
			<td style="width:144px;">y02321</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">SybrGreen qPCR Fast master mix</td>
			<td style="width:221px;">Applied Biosystems</td>
			<td align="right" style="width:144px;">4385612</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">cxcl10 murine forward primer&#160;</td>
			<td style="width:221px;">Integrated DNA technologies</td>
			<td style="width:144px;">n/a</td>
			<td>ACTGCATCCATATCGATGAC</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">cxcl10 murine reverse primer</td>
			<td style="width:221px;">Integrated DNA technologies</td>
			<td style="width:144px;">n/a</td>
			<td>TTCATCGTGGCAATGATCTC</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">il6 murine forward primer&#160;</td>
			<td style="width:221px;">Integrated DNA technologies</td>
			<td style="width:144px;">n/a</td>
			<td>GTAGCTATGGTACTCCAGAAGAC</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">il6 murine forward primer&#160;</td>
			<td style="width:221px;">Integrated DNA technologies</td>
			<td style="width:144px;">n/a</td>
			<td>GTAGCTATGGTACTCCAGAAGAC</td>
		</tr>
	</tbody>
</table>

stimulation of cytoplasmic dna sensing pathways in vitro and in vivo

In order to efficiently stimulate an innate immune response, DNA must be of sufficient length and purity. We present a method where double stranded DNA (dsDNA) which has the requisite characteristics to stimulate the cytoplasmic DNA sensing pathways can be generated cheaply and with ease. By the concatemerization of short, synthetic oligonucleotides (which lack CpG motifs), dsDNA can be generated to be of sufficient length to activate the cytosolic DNA sensing pathway. This protocol involves blunt end ligation of the oligonucleotides in the presence of polyethylene glycol (PEG), which provides an environment for efficient ligation to occur. The dsDNA concatemers can be used, following purification by phenol/chloroform extraction, to simulate the innate immune response in vitro by standard transfection protocols. This DNA can also be used to stimulate innate immunity in vivo by intradermal injection into the ear pinna of a mouse, for example. By standardizing the concatemerization process and the subsequent stimulation protocols, a reliable and reproducible activation of the innate immune system can be produced.

The results below indicate that concatemerized DNA can be generated with relative ease and is capable of stimulating a robust innate immune response in cells and in mice. With the use of PEG8000, it can be clearly seen that the length of DNA being generated is significantly longer and equally capable of inducing transcription of Cxcl10. As seen by agarose gel analysis, the standard concatemerization has lengths of DNA of up to 800 base pairs (bp), whereas for the sample with PEG8000, the length of DNA includes strands in...

Watch this Scientific Journal Video about Stimulation of Cytoplasmic DNA Sensing Pathways In Vitro and In Vivo at JoVE.com

Stimulation of Cytoplasmic DNA Sensing Pathways In Vitro and In Vivo

The aim of the protocol is to use optimal methods for stimulating the cytoplasmic DNA sensing pathways in cells and in vivo. This is achieved by improving the generation of long, double-stranded DNA during blunt-end ligation. Cells or mice are then transfected using a lipid transfection reagent.

Stimulation of Cytoplasmic DNA Sensing Pathways In Vitro and In Vivo

In order to efficiently stimulate an innate immune response, DNA must be of sufficient length and purity. We present a method where double stranded DNA ...

stimulation-of-cytoplasmic-dna-sensing-pathways-in-vitro-and-in-vivo

Research

JoVE Journal

Biology

8.8K visualizações.  University of Cambridge.  O objectivo do protocolo é a utilização de métodos mais eficientes para estimular as vias sensoriais citoplasmáticos de ADN em células e in vivo. Isto é conseguido através da melhoria da geração de ADN de comprimento, de cadeia dupla, durante a ligação das extremidades cegas. As células ou os ratinhos são depois transfectadas utilizando um reagente de transfecção de lípidos. 