אי לנו תודות.

.1 Concatemerization <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> פריימרים Resuspend Fw וRv (ראו טבלה של חומרים לרצפי פריימר) לריכוז של 10 מיקרוגרם / μl בH הכיתה ביולוגיה מולקולרית 2 O. לאחר מכן, לערבב 5 μl של Fw ו5 μl של פריימר Rv בצינור 1.5 מ&quot;ל microcentrifuge. </li><li style=";text-align:right;direction:rtl"> תמהיל לחשל פריימר על ידי חימום לטמפרטורה הנכונה חישול (75 מעלות צלזיוס במשך פריימרים שתוארו כאן) ל15 דקות. השאר על ספסל להתקרר בטמפרטורת חדר (RT). הכן את PEG8000 60% במהלך דגירה זה על ידי ההמסה בDDH 2 O. </li><li style=";text-align:right;direction:rtl"> הוסף 50 μl של 60% PEG8000 (כדי להשיג ריכוז סופי של 30%), 10 μl של 10x קינאז polynucleotide חיץ (PNK), 27 μl של H 2 O, ו3 μl של PNK לתערובת פריימר. לדגור על 37 מעלות צלזיוס למשך 2 שעות. </li><li style=";text-align:right;direction:rtl"> להתקרר ב RT ולהוסיף 11 μl של חיץ האנזים DNA. לאחר מכן להוסיף 3 U של האנזים DNA ולדגור על 37 מעלות צלזיוס למשך לילה. </li></ol> .2 DNA טיהורוניתוח <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> הוסף 300 μl של H 2 O כדי להגדיל את הנפח של תערובת קשירה. הערה: המשך במנדף בשל רעילות של פנול: אדי כלורופורם. </li><li style=";text-align:right;direction:rtl"> הוסף 1 נפח (400 μl) של פנול: כלורופורם ומערבבים על ידי ניעור נמרץ. </li><li style=";text-align:right;direction:rtl"> צנטריפוגה במהירות מרבית דקות 1 בmicrocentrifuge שולחן. השכבות מימיות וממס יפרידו עם השכבה המימית על גבי ושכבה לבנה של חלבון זירז בין שתי השכבות. </li><li style=";text-align:right;direction:rtl"> העבר את השכבה עליונה לצינור חדש על ידי pipetting זהיר (להימנע מהעברת אמצע, שכבה לבנה) </li><li style=";text-align:right;direction:rtl"> חזור על שלבים 2.2 ו2.3 לפחות פעמיים או עד שאין חלבון זירז לאחר צנטריפוגה. </li><li style=";text-align:right;direction:rtl"> הוסף 1 נפח (400 μl) של כלורופורם וחזור על שלבים 2.3-2.4. </li><li style=";text-align:right;direction:rtl"> הוסף 2 כרכים (800 μl) של אתנול 100% prechilled ולדגור על -20 מעלות צלזיוס במשך שעה לפחות 1 או לילה. הערה: בשלב זה משקעים concatemers DNA. </li><li style=";text-align:right;direction:rtl"> ספין למטה במהירות מקסימלית וSupe לשאובrnatant. לשטוף פעם אחת על ידי הוספת 1 מ&quot;ל של אתנול 70% ולאפשר לאוויר יבש במנדף. </li><li style=";text-align:right;direction:rtl"> DNA הגלול ב50 μl של רעלן הפנימי DDH החופשי 2 O. הערה: השימוש בחומרים כימי רעלן פנימי חופשי הוא קריטי ליצירת תגובה חיסונית מולדת DNA הספציפי בתאי in vivo. </li><li style=";text-align:right;direction:rtl"> הסר aliquot 2 μl של DNA concatemerized לתוך צינור טרי ולהוסיף למאגר טעינת ג&#39;ל DNA 1 מ&quot;ל. </li><li style=";text-align:right;direction:rtl"> לפזר 1% agarose במאגר טה על ידי חימום במלוא העצמה במיקרוגל למשך 2 דקות (או זמן שהוא מתאים לכוחו של התנור והנפח). </li><li style=";text-align:right;direction:rtl"> יוצקים ג&#39;ל למנגנון ליהוק, להוסיף 4 μl של צבע chelating DNA ניאון, להכניס מסרק, ומשאיר בטמפ &#39;החדר למשך כ 20 דקות לג&#39;ל להגדיר. </li><li style=";text-align:right;direction:rtl"> ברגע שקבוצה, להסיר את הג&#39;ל מסרק ומקום לטנק אלקטרופורזה המכיל חיץ טה. טען 3 μl של סמני דגימת DNA או גודל לתוך בארות. </li><li style=";text-align:right;direction:rtl"> הפעל ג&#39;ל אלקטרופורזה ל30-40 דקות ב90 V עם זרם קבוע. Visualize DNA תחת אור אולטרה הסגול להתבונן concatemerization (איור 1 א). </li><li style=";text-align:right;direction:rtl"> למדוד את ריכוז DNA בשאר המדגם ידי ספקטרוסקופיה ספיגת UV. בלנק ספקטרומטר עם אותו O DDH 2 ששימש לresuspend DNA ולמדוד את ספקטרום הספיגה 200-300 ננומטר. הערה: ריכוז DNA יכול להיות מחושב באמצעות חוק באר למברט, l * = e * ג, שבו הוא הספיגה, דואר מקדם הכחדה, ואני המרחק של נתיב האור. למדידת DNA ריכוזי הספיגה ב 260 ננומטר יש למדוד ומקדם הכחדה של 0.027 (מיקרוגרם / מ&quot;ל) -1 סנטימטר -1 בשימוש. מרחק נתיב האור, l, ישתנה בהתאם לספקטרופוטומטר. תוך מדידת הריכוז, לרשום את יחס ספיגת 260/280 ננומטר כאינדיקציה לטוהר DNA; ערך עבור יחס זה של 2.00 מעל מומלץ. </li></ol> .3 Transfection של dsDNA Concatemers בVitro <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> תאי זרע בצלחת תרבית רקמה או צלחת להיות מחוברות 70% בשעת הגירוי. </li><li style=";text-align:right;direction:rtl"> לחשב את המסה של DNA דרושה לגירוי של תאים באמצעות ריכוז סופי של 1-10 מיקרוגרם / מ&quot;ל. המסה הנדרשת של DNA תצוין כX להלן. לדוגמא, אם מגרה תאים בבאר אחד של צלחת 6 היטב עם 2 מ&quot;ל של מדיום בריכוז של DNA של 5 מיקרוגרם / מ&quot;ל ​​אז מסה של 2 * 5 = 10 מיקרוגרם של DNA נדרש. </li><li style=";text-align:right;direction:rtl"> הוסף 50 μl * X של מדיום סרום ללא לתוך צינור סטרילי בגודל מתאים. פיפטה בזהירות למרכז של המדיום, בלי לגעת בצד של הצינור, 2 * X μl של מגיב transfection שומנים בדם קטיוני ולהשאיר למשך 5 דקות. </li><li style=";text-align:right;direction:rtl"> הוספת מיקרוגרם X של DNA לזמן קצר צינור ומערבולת. השאר בRT לפחות 20 דקות. עבור transfection במבחנה להוסיף את התערובת ישירות לתאים כדי לעורר מסלולי חישת DNA cytoplasmic. </li></ol> .4 Transfection של dsDNA Concatemers אניn Vivo <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> הכן תערובת transfection כמתואר ב3.1-3.5 באמצעות DNA 1 מיקרוגרם, מגיב transfection השומנים 2 μl, ו18 סרום μl מדיום חופשי לאוזן עכבר כדי להיות מגורה. הכן מזרק סטרילי 20 μl המילטון, כובע עם מחט G 30 סטרילי, ולטעון עם תערובת transfection DNA. </li><li style=";text-align:right;direction:rtl"> הרדימי C57BL / 6 עכבר באמצעות 1-2 isoflurane%. לאשר הרדמה על ידי אובדן של תנועה וקצב נשימה קבועה ועל ידי בדיקת רפלקס קמצוץ במידת צורך. לפקח את עיניו של בעל החיים במהלך ההרדמה ולהשתמש במשחה כנדרש כדי למנוע יובש מוגזם. </li><li style=";text-align:right;direction:rtl"> באמצעות טכניקה סטרילית, להזריק בזהירות לתוך אפרכסת האוזן 10 μl של תמהיל transfection כך ש&#39;בועה &#39;אחת של נוזל נוצר בין שכבות העור של האוזן. הערה: השתמש באצבעון גומי באצבע האגודל או מדד שלך, למתוח את האוזן על זה, ולהזריק בזווית חדה, כדי להבטיח את המחט חודרת את השכבה הראשונה בלבד של עור של אפרכסת האוזן. </li><li style=";text-align:right;direction:rtl"> רייןtroduce עכבר חזרה לכלוב ובאופן קבוע לפקח על התאוששות לאחר הרדמה. השתמש במנורת חימום, כדי למנוע קירור יתר של העכברים המורדמים. אל תשאירו עכברים ללא השגחה עד שהם חזרו להכרה מספיק כדי לשמור על כיבה sternal. </li><li style=";text-align:right;direction:rtl"> פלאש להקפיא את כל אפרכסת האוזן בצינור microcentrifuge על ידי טבילה בחנקן נוזלי למשך 2 דקות. </li></ol> .5 עיבוד דגימת DNA מאולצת וניתוח על ידי PCR (qPCR) <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> מתרבית תאים: בינוני לשאוב עם טפטפת וזורקי פסולת. </li><li style=";text-align:right;direction:rtl"> הוסף 1 מ&quot;ל של PBS סטרילית. חזור על 5.1 ו5.2 פעמיים והמשיכו לשלב 5.3 </li><li style=";text-align:right;direction:rtl"> מרקמת אוזן: לטחון רקמה תחת חנקן נוזלי באמצעות העלי הקרמיקה סטרילי ומרגמה, להעביר רקמת קרקע לצינור microcentrifuge בעזרת מרית סטרילי, והמשך לשלב 5.4 </li><li style=";text-align:right;direction:rtl"> הוסף חוצץ תמוגה 350 μl ולהמשיך עם פרוטוקול ערכת חילוץ RNA המסחרי. Elute RNA מטיהור ערכת חילוץטור ב40 μl DDH 2 O. הערה: ערכת חילוץ RNA המסחרית (ראה חומרים / שולחן ציוד) עובד טוב מאוד; טכניקות אחרות נבדקו עם תוצאות subpar. </li><li style=";text-align:right;direction:rtl"> לכמת RNA על ידי ספקטרוסקופיה UV כפי שתואר עבור DNA לעיל (סעיף 2.13). הערה: מקדם ההכחדה לRNA הוא 0.025 (מיקרוגרם / מ&quot;ל) -1 -1 סנטימטר. </li><li style=";text-align:right;direction:rtl"> הוסף לμl PCR צינור 1 סטרילי של אוליגו פריימר (DT), ul 1 של 10 מ&quot;מ dNTP לערבב, ו250 RNA מיקרוגרם. הפוך את הווליום ל11 μl עם DDH סטרילי 2 O. </li><li style=";text-align:right;direction:rtl"> דגירה של 5 דקות על 65 מעלות צלזיוס. ואז להוסיף 4 μl הראשונה סטרנד הצפת, 1 μl 0.1 M dithiothreitol, 0.25 μl הפוך transcriptase ו1.75 μl DDH 2 O לצינור. לדגור על 50 מעלות צלזיוס במשך שעה 1 ואחריו 72 מעלות צלזיוס במשך 15 דקות. לחלופין, לדלל מוצר cDNA 1: 5 באמצעות DDH 2 O. </li><li style=";text-align:right;direction:rtl"> לPCR כמו cDNA שימוש 2 μl, DDH 2 O, תערובת אב qPCR 5 μl 2 μl, ו1μl כל אחד מ10 אום קדימה לאחור מניות פריימר כדי להגביר גן (ים) על פי בחירה. מערבבים בצלחת 96 היטב ולנתח באמצעות מכונה PCR (1B דמויות ו1C). </li></ol>

<ol>
	<li>Yoshida, H., Okabe, Y., Kawane, K., Fukuyama, H., Nagata, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Lethal+anemia+caused+by+interferon-beta+produced+in+mouse+embryos+carrying+undigested+DNA.">Lethal anemia caused by interferon-beta produced in mouse embryos carrying undigested DNA.</a> Nat. Immunol. 6, 49-56 (2005).</li><li>Ishikawa, H., Ma, Z., Barber, G. N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=STING+regulates+intracellular+DNA-mediated,+type+I+interferon-dependent+innate+immunity.">STING regulates intracellular DNA-mediated, type I interferon-dependent innate immunity.</a> Nature. 461, 788-792 (2009).</li><li>Ishii, K. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=TANK-binding+kinase-1+delineates+innate+and+adaptive+immune+responses+to+DNA+vaccines.">TANK-binding kinase-1 delineates innate and adaptive immune responses to DNA vaccines.</a> Nature. 451, 725-729 (2008).</li><li>Stetson, D. B., Medzhitov, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Recognition+of+cytosolic+DNA+activates+an+IRF3-dependent+innate+immune+response.">Recognition of cytosolic DNA activates an IRF3-dependent innate immune response.</a> Immunity. 24, 93-103 (2006).</li><li>Pichlmair, A., Reise Sousa, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Innate+recognition+of+viruses.">Innate recognition of viruses.</a> Immunity. 27, 370-383 (2007).</li><li>Unterholzner, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=IFI16+is+an+innate+immune+sensor+for+intracellular+DNA.">IFI16 is an innate immune sensor for intracellular DNA.</a> Nat. Immunol. 11, 997-1004 (2010).</li><li>Ferguson, B. J., Mansur, D. S., Peters, N. E., Ren, H., Smith, G. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=DNA-PK+is+a+DNA+sensor+for+IRF-3-dependent+innate+immunity.">DNA-PK is a DNA sensor for IRF-3-dependent innate immunity.</a> Elife. 1, e00047 (2012).</li><li>Sun, L., Wu, J., Du, F., Chen, X., Chen, Z. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cyclic+GMP-AMP+synthase+is+a+cytosolic+DNA+sensor+that+activates+the+type+I+interferon+pathway.">Cyclic GMP-AMP synthase is a cytosolic DNA sensor that activates the type I interferon pathway.</a> Science. 339, 786-791 (2013).</li><li>Honda, K., Taniguchi, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=IRFs:+master+regulators+of+signalling+by+Toll-like+receptors+and+cytosolic+pattern-recognition+receptors.">IRFs: master regulators of signalling by Toll-like receptors and cytosolic pattern-recognition receptors.</a> Nat. Rev. Immunol. 6, 644-658 (2006).</li><li>Karayel, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+TLR-independent+DNA+recognition+pathway+in+murine+macrophages:+Ligand+features+and+molecular+signature.">The TLR-independent DNA recognition pathway in murine macrophages: Ligand features and molecular signature.</a> Eur. J. Immunol. 39, 1929-1936 (2009).</li></ol>

The authors have nothing to disclose.

הפרוטוקולים המתוארים כאן משמשים ליצירת dsDNA כדי לעורר את התגובה החיסונית המולדת cytosolic עם תוצאות לשחזור במגוון רחב של סוגי התאים וin vivo. מאז מגיב המצע העיקרי המשמשים הוא oligonucleotide סינטטי, יש גמישות במערכת זו לשימוש ברצפי DNA חלופיים או שינויים כימיים. זה אפשרי, למשל, לה...

DNA הוא מרכיב חיוני של כל היצורים והתאים, שאאוקריוטים לשמור בתאים ספציפיים. פונקציה אחת של מערכת החיסון המולדת היא לזהות כאשר מידור כזה מתקלקל או כאשר חומר זר מוחדר האורגניזם באמצעות הפרת מחסומים פיזיים, חיצוניים. בגוף האדם יש מספר החלבונים שקיימים כדי לעזור לבזות כמויות קטנות של DNA שעשויה לברוח המידור הנכון; DNAse I, II, III ולשבור DNA בפלזמה, endosome, וcytosol, בהתאמה. עם זאת, זה כבר הראה כי עכברים חסרי DNAse השני למות מאנמיה קשה שנגרמה על ידי ייצור מוגבר של האינטרפרונים 1 מצביעים על כך שמערכת החיסון המולדת מגיבה לDNA במיוחד גרעיני. תגובה זו מתרחשת גם בעכברים שהם לגמרי חסרי יכולת איתות קולט חיוג כמו. מחקרים רבים כעת מוצגים ממריץ שגני אינטרפרון (סטינג) 2 וקינאז מחייב TANK 1 (TBK1) 3 מעורבים בזיהוי של DNA בציטופלסמה ושמסלול איתות זה מפעיל גורם אינטרפרון רגולציה (IRF) -3 4. שעתוק IRF3 תלוי הבא של ציטוקין, chemokine, וגני אינטרפרון הוא אופייני לתגובה חיסונית מולדת או פתוגן או סכנה הקשורים דפוס מולקולרי (PAMP או לח) 5. הרצון ללמוד מסלולי חישת חומצות גרעין תאיים הוביל לדרישה לפתח שיטות חזקות ושחזור לגירוי תאים על ידי החדרת דנ&quot;א או רנ&quot;א לתוך תאים ללא הפעלת תגובה חיסונית מולדת אחרת. שיטה אחת שבאמצעותו יכול להיות מגורה את העוקץ / TBK1 / מסלול IRF3 היא באמצעות חומרים כימיים transfection שומנים בדם קטיוני כדי לספק חומצות גרעין לתוך הציטופלסמה שבו ניתן להגיע על ידי חיישני DNA כגון DNA-PK, IFI16, וcGAS 6-8. המאפיינים של DNA שהם הבינו כעת כדי לאפשר effהפעלת icient של תגובת החיסון המולדת cytoplasmic ללא גירוי של מסלולים אחרים שלה אורך, מסה, טוהר, וחוסר CPG מוטיבי 4,7,9. oligonucleotides סינטטי מתאים ביותר לצורך הפקת תגובה חיסונית מולדת מאחר שהם מאפשרים את רצף DNA להיות מותאמים ומוכן כמו לתרכובות כימיות טהורות. רצף חיסוני גירוי 45 זוג בסיס DNA (ISD) זוהה על ידי et al כובע רחב שולי. 4 כרצף מתאים, CPG ללא למטרה זו. רצף dsDNA זה אחרת אקראי ואין לו תכונות ספציפיות מעבר לחוסר המוטיבים CPG. מצאנו כי על ידי concatemerizing oligonucleotide ISD לגדילים ארוכים יותר מגביר באופן משמעותי את גודל הגירוי 7. דור של ISD concatemerized לכן הוא שימושי עבור גירוי תגובה חיסונית מולדת cytoplasmic. כאן אנו מציגים פרוטוקולים להכנה מגיב זה וכיצד ניתן להשתמש בו כדי להפעיל את מסלול חישת DNA במבחנה, כמו גם in vivo. הערה: כל המחקרים בבעלי החיים מתבצעים תחת פרוטוקולים מוסדיים אושרו והנחיות טיפול בבעלי החיים.

<table border="0" cellpadding="0" cellspacing="0" width="1066">
	<tbody>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">Forward Primer</td>
			<td style="width:221px;">Integrated DNA technologies</td>
			<td style="width:144px;">n/a</td>
			<td style="width:407px;">TACAGATCTACTAGTGATCTATGACTGATCTGTACATGATCTACA</td>
		</tr>
		<tr height="19">
			<td height="19" style="height:19px;width:295px;">Reverse Primer</td>
			<td style="width:221px;">Integrated DNA technologies</td>
			<td style="width:144px;">n/a</td>
			<td>TGTAGATCATGTACAGATCAGTCATAGATCACTAGTAGATCTGTA</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">PEG8000</td>
			<td style="width:221px;">Sigma-Aldrich</td>
			<td style="width:144px;">P-4463</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">Molecular biology grade water</td>
			<td style="width:221px;">Sigma-Aldrich</td>
			<td style="width:144px;">W4502-1L</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">T4 Polynucleotide Kinase</td>
			<td style="width:221px;">Promega</td>
			<td style="width:144px;">M4101</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">T4 DNA Ligase</td>
			<td style="width:221px;">Promega</td>
			<td style="width:144px;">M1801</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">Phenol:Chloroform</td>
			<td style="width:221px;">Fisher Chemical</td>
			<td style="width:144px;">BPE1752p-400</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">Chloroform</td>
			<td style="width:221px;">Fisher Chemical</td>
			<td style="width:144px;">C/4960/PB08</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">Ethanol</td>
			<td style="width:221px;">Sigma-Aldrich</td>
			<td style="width:144px;">32221-2.5L</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">DNA gel loading buffer</td>
			<td style="width:221px;">New England biolabs</td>
			<td style="width:144px;">B7021S</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">Agarose</td>
			<td style="width:221px;">Bioline</td>
			<td style="width:144px;">BIO-41025</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">Optimem</td>
			<td style="width:221px;">Life Technologies</td>
			<td style="width:144px;">11058021</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">TransIT-LT1&#160;</td>
			<td style="width:221px;">Mirus Bioscience</td>
			<td style="width:144px;">MIR 2300</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">Hamilton Syringe</td>
			<td style="width:221px;">Hamilton</td>
			<td style="width:144px;">80901 Model 1705</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">30G needles&#160;</td>
			<td style="width:221px;">BD bioscience</td>
			<td style="width:144px;">304000</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">SYBR Safe DNA gel stain</td>
			<td style="width:221px;">Life Technologies</td>
			<td style="width:144px;">S33102</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">Rneasy Plus Mini Kit</td>
			<td style="width:221px;">Qiagen</td>
			<td style="width:144px;">74134</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">Oligo(dT) primer</td>
			<td style="width:221px;">Thermo Scientific</td>
			<td style="width:144px;">SO131</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">dNTP mix</td>
			<td style="width:221px;">Fermentas</td>
			<td style="width:144px;">R0192</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">Super Script III reverse transcriptase</td>
			<td style="width:221px;">Life Technologies</td>
			<td align="right" style="width:144px;">56575</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">First strand cDNA synthesis buffer</td>
			<td style="width:221px;">Life Technologies</td>
			<td style="width:144px;">y02321</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">SybrGreen qPCR Fast master mix</td>
			<td style="width:221px;">Applied Biosystems</td>
			<td align="right" style="width:144px;">4385612</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">cxcl10 murine forward primer&#160;</td>
			<td style="width:221px;">Integrated DNA technologies</td>
			<td style="width:144px;">n/a</td>
			<td>ACTGCATCCATATCGATGAC</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">cxcl10 murine reverse primer</td>
			<td style="width:221px;">Integrated DNA technologies</td>
			<td style="width:144px;">n/a</td>
			<td>TTCATCGTGGCAATGATCTC</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">il6 murine forward primer&#160;</td>
			<td style="width:221px;">Integrated DNA technologies</td>
			<td style="width:144px;">n/a</td>
			<td>GTAGCTATGGTACTCCAGAAGAC</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">il6 murine forward primer&#160;</td>
			<td style="width:221px;">Integrated DNA technologies</td>
			<td style="width:144px;">n/a</td>
			<td>GTAGCTATGGTACTCCAGAAGAC</td>
		</tr>
	</tbody>
</table>

stimulation of cytoplasmic dna sensing pathways in vitro and in vivo

כדי לעורר תגובה חיסונית מולדת ביעילות, DNA חייב להיות באורך ובטהרה מספיק. אנו מציגים שיטה בי גדילי הדנ&quot;א כפול (dsDNA) שבו יש את המאפיינים הדרושים כדי לעורר את DNA cytoplasmic יכולים להיות שנוצר מסלולי חישה במחיר זול ובקלות. על ידי concatemerization של oligonucleotides הקצר, סינטטי (אשר חסרים מוטיבים CPG), יכול להיות שנוצר dsDNA להיות באורך מספיק כדי להפעיל את מסלול חישת DNA cytosolic. פרוטוקול זה כרוך קשירת קצה קהה של oligonucleotides בנוכחות פוליאתילן גליקול (PEG), המספקת סביבה לקשירה יעילה להתרחש. ניתן להשתמש concatemers dsDNA, הבא לטיהור על ידי מיצוי פנול / כלורופורם, כדי לדמות את התגובה החיסונית המולדת במבחנה על ידי פרוטוקולי transfection סטנדרטיים. גם DNA זה יכול לשמש כדי לעורר חסינות מולדת in vivo על ידי הזרקת intradermal לתוך אפרכסת אוזנו של עכבר, למשל. על ידיתקנון תהליך concatemerization ופרוטוקולי גירוי שלאחר מכן, הפעלה אמינה ושחזור של מערכת החיסון המולדת יכולה להיות מיוצר.

<html> התוצאות להלן מצביעות על כך שDNA concatemerized יכול להיות שנוצר בקלות יחסית, והוא מסוגל גירוי תגובה חיסונית מולדת חזקה בתאים ובעכברים. עם השימוש בPEG8000, זה ניתן לראות בבירור כי אורך DNA שנוצר הוא באופן משמעותי יותר ומסוגל גרימת שעתוק של Cxcl10 באותה מידה. כפי שניתן לראות על ידי נ...

Watch this Scientific Journal Video about Stimulation of Cytoplasmic DNA Sensing Pathways In Vitro and In Vivo at JoVE.com

Stimulation of Cytoplasmic DNA Sensing Pathways In Vitro and In Vivo

מטרת הפרוטוקול היא להשתמש בשיטות אופטימליות לגירוי מסלולי חישת DNA cytoplasmic בתאי in vivo. זו מושגת על ידי שיפור הדור של DNA הארוך, פעמיים תקועים בקשירה בוטה סוף. תאים או עכברים אז transfected באמצעות מגיב transfection שומנים בדם.

גירוי של cytoplasmic מסלולי חישה DNA<em&gt; במבחנה</em&gt; ו<em&gt; בVivo</em

In order to efficiently stimulate an innate immune response, DNA must be of sufficient length and purity. We present a method where double stranded DNA ...

stimulation-of-cytoplasmic-dna-sensing-pathways-in-vitro-and-in-vivo

Research

JoVE Journal

Biology

Stimulation of Cytoplasmic DNA Sensing Pathways In Vitro and In Vivo

8.8K Views.  University of Cambridge.  מטרת הפרוטוקול היא להשתמש בשיטות אופטימליות לגירוי מסלולי חישת DNA cytoplasmic בתאי in vivo. זו מושגת על ידי שיפור הדור של DNA הארוך, פעמיים תקועים בקשירה בוטה סוף. תאים או עכברים אז transfected באמצעות מגיב transfection שומנים בדם. 

Video: Stimulation of Cytoplasmic DNA Sensing Pathways In Vitro and In Vivo

In vitro and in vivo Bioluminescence Reporter Gene Imaging of Human Embryonic Stem Cells

The discovery of human embryonic stem cells (hESCs) has dramatically increased the tools available to medical scientists interested in regenerative medicine. However, direct injection of hESCs, and cells differentiated from hESCs, into living organisms has thus far been hampered by significant cell death, teratoma formation, and host immune rejection. Understanding the in vivo hESC behavior after transplantation requires novel imaging techniques to longitudinally monitor hESC localization, proliferation, and viability. Molecular imaging has given investigators a high-throughput, inexpensive, and sensitive means for tracking in vivo cell proliferation over days, weeks, and even months. This advancement has significantly increased the understanding of the spatio-temporal kinetics of hESC engraftment, proliferation, and teratoma-formation in living subjects.

A major advance in molecular imaging has been the extension of noninvasive reporter gene assays from molecular and cellular biology into in vivo multi-modality imaging platforms. These reporter genes, under control of engineered promoters and enhancers that take advantage of the host cell s transcriptional machinery, are introduced into cells using a variety of vector and non-vector methods. Once in the cell, reporter genes can be transcribed either constitutively or only under specific biological or cellular conditions, depending on the type of promoter used. Transcription and translation of reporter genes into bioactive proteins is then detected with sensitive, noninvasive instrumentation (e.g., CCD cameras) using signal-generating probes such as D-luciferin.

To avoid the need for excitatory light to track stem cells in vivo as is required for fluorescence imaging, bioluminescence reporter gene imaging systems require only an exogenously administered probe to induce light emission. Firefly luciferase, derived from the firefly Photinus pyralis, encodes an enzyme that catalyzes D-luciferin to the optically active metabolite, oxyluciferin. Optical activity can then be monitored with an external CCD camera. Stably transduced cells that carry the reporter construct within their chromosomal DNA will pass the reporter construct DNA to daughter cells, allowing for longitudinal monitoring of hESC survival and proliferation in vivo. Furthermore, because expression of the reporter gene product is required for signal generation, only viable parent and daughter cells will create bioluminescence signal; apoptotic or dead cells will not. 

In this video, the specific materials and methods needed for tracking stem cell proliferation and teratoma formation with bioluminescence imaging will be described.

With the growing interest in stem cell therapies, molecular imaging techniques are ideal for monitoring stem cell behavior after transplantation. Luciferase reporter genes have enabled non-invasive, repetitive assessment of cell survival, location, and proliferation in vivo. This video will demonstrate how to track hESC proliferation in a living mouse.

במבחנה פליטת אור הדמיה vivo ג&#39;ין הכתב של בתאי גזע עובריים אנושיים

The discovery of human embryonic stem cells (hESCs) has dramatically increased the tools available to medical scientists interested in regenerative ...

In vivo and in vitro Studies of Adaptor-clathrin Interaction

A major endocytic pathway initiates with the formation of clathrin-coated vesicles (CCVs) that transport cargo from the cell surface to endosomes1-6. CCVs are distinguished by a polyhedral lattice of clathrin that coats the vesicle membrane and serves as a mechanical scaffold. Clathrin coats are assembled during vesicle formation from individual clathrin triskelia , the soluble form of clathrin composed of three heavy and three light chain subunits7,8. Because the triskelion does not have the ability to bind to the membrane directly, clathrin-binding adaptors are critical to link the forming clathrin lattice to the membrane through association with lipids and/or membrane proteins9. Adaptors also package transmembrane protein cargo, such as receptors, and can interact with each other and with other components of the CCV formation machinery9.
Over twenty clathrin adaptors have been described, several are involved in clathrin mediated endocytosis and others localize to the trans Golgi network or endosomes9. With the exception of HIP1R (yeast Sla2p), all known clathrin adaptors bind to the N-terminal -propeller domain of the clathrin heavy chain9. Clathrin adaptors are modular proteins consisting of folded domains connected by unstructured flexible linkers. Within these linker regions, short binding motifs mediate interactions with the clathrin N-terminal domain or other components of the vesicle formation machinery9. Two distinct clathrin-binding motifs have been defined: the clathrin-box and the W-box9. The consensus clathrin-box sequence was originally defined as L[L/I][D/E/N][L/F][D/E]10 but variants have been subsequently discovered11. The W-box conforms to the sequence PWxxW (where x is any residue).
Sla1p (Synthetic Lethal with Actin binding protein-1) was originally identified as an actin associated protein and is necessary for normal actin cytoskeleton structure and dynamics at endocytic sites in yeast cells12. Sla1p also binds the NPFxD endocytic sorting signal and is critical for endocytosis of cargo bearing the NPFxD signal13,14. More recently, Sla1p was demonstrated to bind clathrin through a motif similar to the clathrin box, LLDLQ, termed a variant clathrin-box (vCB), and to function as an endocytic clathrin adaptor15. In addition, Sla1p has become a widely used marker for the endocytic coat in live cell fluorescence microscopy studies16. Here we use Sla1p as a model to describe approaches for adaptor-clathrin interaction studies. We focus on live cell fluorescence microscopy, GST-pull down, and co-immunoprecipitation methods.

In vivo and in vitro Studies of Adaptor-clathrin Interaction

Clathrin-mediated endocytosis depends on adaptor proteins that coordinate cargo selection and clathrin coat assembly. Here we describe procedures to study adaptor-clathrin physical interaction and live cell imaging approaches using as a model the yeast endocytic adaptor protein Sla1p.

In vivo ו במבחנה של אינטראקציה מתאם-clathrin

A major endocytic pathway initiates with the formation of clathrin-coated vesicles (CCVs) that transport cargo from the cell surface to endosomes1-6. CCVs ...

Visualization of MG53-mediated Cell Membrane Repair Using in vivo and in vitro Systems

Repair of acute injury to the cell membrane is an elemental process of normal cellular physiology, and defective membrane repair has been linked to many degenerative human diseases. The recent discovery of MG53 as a key component of the membrane resealing machinery allows for a better molecular understanding of the basic biology of tissue repair, as well as for potential translational applications in regenerative medicine. Here we detail the experimental protocols for exploring the in vivo function of MG53 in repair of muscle injury using treadmill exercise protocols on mouse models, for testing the ex vivo membrane repair capacity by measuring dye entry into isolated muscle fibers, and for monitoring the dynamic process of MG53-mediated vesicle trafficking and cell membrane repair in cultured cells using live cell confocal microscopy.

Visualization of MG53-mediated Cell Membrane Repair Using in vivo and in vitro Systems

Described here are protocols used to visualize the dynamic process of MG53-mediated cell membrane repair in whole animals and at the cellular level. These methods can be applied to investigate the cell biology of plasma membrane resealing and regenerative medicine.

ויזואליזציה של תיקון MG53 בתיווך קרום התא באמצעות In vivo ו במבחנה מערכות

Repair of acute injury to the cell membrane is an elemental process of normal cellular physiology, and defective membrane repair has been linked to many ...

Activation of Apoptosis by Cytoplasmic Microinjection of Cytochrome c

Apoptosis, or programmed cell death, is a conserved and highly regulated pathway by which cells die1. Apoptosis can be triggered when cells encounter a wide range of cytotoxic stresses. These insults initiate signaling cascades that ultimately cause the release of cytochrome c from the mitochondrial intermembrane space to the cytoplasm2. The release of cytochrome c from mitochondria is a key event that triggers the rapid activation of caspases, the key cellular proteases which ultimately execute cell death3-4.
The pathway of apoptosis is regulated at points upstream and downstream of cytochrome c release from mitochondria5. In order to study the post-mitochondrial regulation of caspase activation, many investigators have turned to direct cytoplasmic microinjection of holocytochrome c (heme-attached) protein into cells6-9. Cytochrome c is normally localized to the mitochondria where attachment of a heme group is necessary to enable it to activate apoptosis10-11. Therefore, to directly activate caspases, it is necessary to inject the holocytochrome c protein instead of its cDNA, because while the expression of cytochrome c from cDNA constructs will result in mitochondrial targeting and heme attachment, it will be sequestered from cytosolic caspases. Thus, the direct cytosolic microinjection of purified heme-attached cytochrome c protein is a useful tool to mimic mitochondrial cytochrome c release and apoptosis without the use of toxic insults which cause cellular and mitochondrial damage.
In this article, we describe a method for the microinjection of cytochrome c protein into cells, using mouse embryonic fibroblasts (MEFs) and primary sympathetic neurons as examples. While this protocol focuses on the injection of cytochrome c for investigations of apoptosis, the techniques shown here can also be easily adapted for microinjection of other proteins of interest.

Activation of Apoptosis by Cytoplasmic Microinjection of Cytochrome c

In this protocol, we describe the direct cytoplasmic microinjection of cytochrome c protein into fibroblasts and primary sympathetic neurons. This technique allows for the introduction of cytochrome c protein into the cytoplasm of cells and mimics the release of cytochrome c from mitochondria, which occurs during apoptosis.

הפעלה של אפופטוזיס על ידי Microinjection cytoplasmic של ציטוכרום ג</em

Apoptosis, or programmed cell death, is a conserved and highly regulated pathway by which cells die1.  Apoptosis can be triggered when cells encounter a ...

Isolation of Ribosome Bound Nascent Polypeptides in vitro to Identify Translational Pause Sites Along mRNA

The rate of translational elongation is non-uniform. mRNA secondary structure, codon usage and mRNA associated proteins may alter ribosome movement on the messagefor review see 1. However, it's now widely accepted that synonymous codon usage is the primary cause of non-uniform translational elongation rates1. Synonymous codons are not used with identical frequency. A bias exists in the use of synonymous codons with some codons used more frequently than others2. Codon bias is organism as well as tissue specific2,3. Moreover, frequency of codon usage is directly proportional to the concentrations of cognate tRNAs4. Thus, a frequently used codon will have higher multitude of corresponding tRNAs, which further implies that a frequent codon will be translated faster than an infrequent one. Thus, regions on mRNA enriched in rare codons (potential pause sites) will as a rule slow down ribosome movement on the message and cause accumulation of nascent peptides of the respective sizes5-8. These pause sites can have functional impact on the protein expression, mRNA stability and protein foldingfor review see 9. Indeed, it was shown that alleviation of such pause sites can alter ribosome movement on mRNA and subsequently may affect the efficiency of co-translational (in vivo) protein folding1,7,10,11. To understand the process of protein folding in vivo, in the cell, that is ultimately coupled to the process of protein synthesis it is essential to gain comprehensive insights into the impact of codon usage/tRNA content on the movement of ribosomes along mRNA during translational elongation.
Here we describe a simple technique that can be used to locate major translation pause sites for a given mRNA translated in various cell-free systems6-8. This procedure is based on isolation of nascent polypeptides accumulating on ribosomes during in vitro translation of a target mRNA. The rationale is that at low-frequency codons, the increase in the residence time of the ribosomes results in increased amounts of nascent peptides of the corresponding sizes. In vitro transcribed mRNA is used for in vitro translational reactions in the presence of radioactively labeled amino acids to allow the detection of the nascent chains. In order to isolate ribosome bound nascent polypeptide complexes the translation reaction is layered on top of 30% glycerol solution followed by centrifugation. Nascent polypeptides in polysomal pellet are further treated with ribonuclease A and resolved by SDS PAGE. This technique can be potentially used for any protein and allows analysis of ribosome movement along mRNA and the detection of the major pause sites. Additionally, this protocol can be adapted to study factors and conditions that can alter ribosome movement and thus potentially can also alter the function/conformation of the protein.

Isolation of Ribosome Bound Nascent Polypeptides in vitro to Identify Translational Pause Sites Along mRNA

A technique to identify translational pause sites on mRNA is described. This procedure is based on isolation of nascent polypeptides accumulating on ribosomes during in vitro translation of a target mRNA, followed by the size analysis of the nascent chains using a denaturing gel electrophoresis.

הבידוד של הריבוזום פוליפפטידים המתהווה כרוכים<em&gt; במבחנה</em&gt; כדי לזהות אתרים השהה של תרגום לאורך ה-mRNA

The rate of translational elongation is non-uniform. mRNA secondary structure, codon usage and mRNA associated proteins may alter ribosome movement on the ...

The c-FOS Protein Immunohistological Detection: A Useful Tool As a Marker of Central Pathways Involved in Specific Physiological Responses In Vivo and Ex Vivo

Many studies seek to identify and map the brain regions involved in specific physiological regulations. The proto-oncogene c-fos, an immediate early gene, is expressed in neurons in response to various stimuli. The protein product can be readily detected with immunohistochemical techniques leading to the use of c-FOS detection to map groups of neurons that display changes in their activity. In this article, we focused on the identification of brainstem neuronal populations involved in the ventilatory adaptation to hypoxia or hypercapnia. Two approaches were described to identify involved neuronal populations in vivo in animals and ex vivo in deafferented brainstem preparations. In vivo, animals were exposed to hypercapnic or hypoxic gas mixtures. Ex vivo, deafferented preparations were superfused with hypoxic or hypercapnic artificial cerebrospinal fluid. In both cases, either control in vivo animals or ex vivo preparations were maintained under normoxic and normocapnic conditions. The comparison of these two approaches allows the determination of the origin of the neuronal activation i.e., peripheral and/or central. In vivo and ex vivo, brainstems were collected, fixed, and sliced into sections. Once sections were prepared, immunohistochemical detection of the c-FOS protein was made in order to identify the brainstem groups of cells activated by hypoxic or hypercapnic stimulations. Labeled cells were counted in brainstem respiratory structures. In comparison to the control condition, hypoxia or hypercapnia increased the number of c-FOS labeled cells in several specific brainstem sites that are thus constitutive of the neuronal pathways involved in the adaptation of the central respiratory drive.

The c-FOS Protein Immunohistological Detection: A Useful Tool As a Marker of Central Pathways Involved in Specific Physiological Responses In Vivo and Ex Vivo

Here, we present a protocol based on c-FOS protein immunohistological detection, a classical technique used for the identification of neuronal populations involved in specific physiological responses in vivo and ex vivo.

חלבון C-FOS איתור immunohistological: כלי שימושי כסמן של מסלולים מרכזיים המעורבים בתגובות פיסיולוגיות ספציפיות<em&gt; In vivo</em&gt; ו<em&gt; Ex Vivo</em

Many studies seek to identify and map the brain regions involved in specific physiological regulations. The proto-oncogene c-fos, an immediate early gene, ...

Filtration Isolation of Nucleic Acids:  A Simple and Rapid DNA Extraction Method

FINA, filtration isolation of nucleic acids, is a novel extraction method which utilizes vertical filtration via a separation membrane and absorbent pad to extract cellular DNA from whole blood in less than 2 min. The blood specimen is treated with detergent, mixed briefly and applied by pipet to the separation membrane. The lysate wicks into the blotting pad due to capillary action, capturing the genomic DNA on the surface of the separation membrane. The extracted DNA is retained on the membrane during a simple wash step wherein PCR inhibitors are wicked into the absorbent blotting pad. The membrane containing the entrapped DNA is then added to the PCR reaction without further purification. This simple method does not require laboratory equipment and can be easily implemented with inexpensive laboratory supplies. Here we describe a protocol for highly sensitive detection and quantitation of HIV-1 proviral DNA from 100 &#181;l whole blood as a model for early infant diagnosis of HIV that could readily be adapted to other genetic targets.

We describe here a simple and rapid paper-based DNA extraction method of HIV proviral DNA from whole blood detected by quantitative PCR. This protocol can be extended for use in detecting other genetic markers or using alternative amplification methods.

בידוד סינון של חומצות גרעין: שיטת הפקת DNA פשוטה ומהירה

FINA, filtration isolation of nucleic acids, is a novel extraction method which utilizes vertical filtration via a separation membrane and absorbent pad ...

Glucose Uptake Measurement and Response to Insulin Stimulation in In Vitro Cultured Human Primary Myotubes

Skeletal muscle is the largest glucose deposit in mammals and largely contributes to glucose homeostasis. Assessment of insulin sensitivity of muscle cells is of major relevance for all studies dedicated to exploring muscle glucose metabolism and characterizing metabolic alterations. In muscle cells, glucose transporter type 4 (GLUT4) proteins translocate to the plasma membrane in response to insulin, thus allowing massive entry of glucose into the cell. The ability of muscle cells to respond to insulin by increasing the rate of glucose uptake is one of the standard readouts to quantify muscle cell sensitivity to insulin. Human primary myotubes are a suitable in vitro model, as the cells maintain many features of the donor phenotype, including insulin sensitivity. This in vitro model is also suitable for the test of any compounds that could impact insulin responsiveness. Measurements of the glucose uptake rate in differentiated myotubes reflect insulin sensitivity.
In this method, human primary muscle cells are cultured in vitro to obtain differentiated myotubes, and glucose uptake rates with and without insulin stimulation are measured. We provide a detailed protocol to quantify passive and active glucose transport rates using radiolabeled [3H] 2-deoxy-D-Glucose ([3H]2dG). Calculation methods are provided to quantify active basal and insulin-stimulated rates, as well as stimulation fold.

Glucose Uptake Measurement and Response to Insulin Stimulation in In Vitro Cultured Human Primary Myotubes

In this method, human primary muscle cells are cultured in vitro to obtain differentiated myotubes and glucose uptake rates are measured. We provide a detailed protocol to quantify rates in basal and insulin-stimulated states using radiolabeled [3H] 2-deoxy-D-Glucose.

גלוקוז ספיגה מדידה ותגובה גירוי אינסולין ב<em&gt; במבחנה</em&gt; מיוטובים ראשוניים אדם מתורבת

Skeletal muscle is the largest glucose deposit in mammals and largely contributes to glucose homeostasis. Assessment of insulin sensitivity of muscle ...

In Vitro and In Vivo Approaches to Determine Intestinal Epithelial Cell Permeability

The intestinal barrier defends against pathogenic microorganism and microbial toxin. Its function is regulated by tight junction permeability and epithelial cell integrity, and disruption of the intestinal barrier function contributes to progression of gastrointestinal and systemic disease. Two simple methods are described here to measure the permeability of intestinal epithelium. In vitro, Caco-2BBe cells are plated in tissue culture wells as a monolayer and transepithelial electrical resistance (TER) can be measured by an epithelial (volt/ohm) meter. This method is convincing because of its user-friendly operation and repeatability. In vivo, mice are gavaged with 4 kDa fluorescein isothiocyanate (FITC)-dextran, and the FITC-dextran concentrations are measured in collected serum samples from mice to determine the epithelial permeability. Oral gavage provides an accurate dose, and therefore is the preferred method to measure the intestinal permeability in vivo. Taken together, these two methods can measure the permeability of the intestinal epithelium in vitro and in vivo, and hence be used to study the connection between diseases and barrier function.

In Vitro and In Vivo Approaches to Determine Intestinal Epithelial Cell Permeability

Two methods are presented here to determine intestinal barrier function. An epithelial meter (volt/ohm) is used for measurements of transepithelial electrical resistance of cultured epithelia directly in tissue culture wells. In mice, the FITC-dextran gavage method is used to determine the intestinal permeability in vivo.

במבחנה , גישות In Vivo כדי לקבוע חדירות תאים אפיתל המעי

The intestinal barrier defends against pathogenic microorganism and microbial toxin. Its function is regulated by tight junction permeability and ...

Modified Methods for Loading of High-Throughput DNA Extraction Plates Reduce Potential for Contamination

High-throughput DNA sequencing techniques have contributed substantially to advances in our understanding of relationships among microbial communities, host characteristics, and broader ecosystem functions. With this rapid increase in breadth and depth of sequencing capabilities have come methods to extract, amplify, analyze, and interpret environmental DNA successfully with maximum efficiency. Unfortunately, performing DNA extractions quickly can come at the cost of increasing the risk of contamination among samples. In particular, high-throughput extractions that are based on samples contained in a 96-well plate offer a relatively quick method, compared to single-tube extractions, but also increase opportunities for well-to-well cross-contamination. To minimize the risk of cross-contamination among samples, while retaining the benefits of high-throughput extraction techniques, we developed a new method for loading environmental samples into 96-well plates. We used pierceable PCR sealing films to cover each plate while loading samples and added samples first to PCR tubes before moving them into wells; together, these practices reduce the risk of sample drift and unintended double loading of wells. The method outlined in this paper provides researchers with an approach to maximize available high-throughput extraction techniques while reducing the risk of cross-contamination inherent to 96-well plates. We provide a detailed step by step outline of how to move from sample collection to DNA extraction while minimizing the risk of unwanted cross-contamination.

Current methods for loading 96-well plates for DNA extractions can be prone to contamination. We detail a new method for loading 96-well plates that reduces risk of cross-contamination among wells. Our method will help other researchers capitalize on the efficiency of high-throughput DNA extraction techniques and minimize risk of contamination.

שיטות ששונו לטעינת לוחות מיצוי DNA בתפוקה גבוהה להפחית את הפוטנציאל לזיהום

High-throughput DNA sequencing techniques have contributed substantially to advances in our understanding of relationships among microbial communities, ...

גירוי של cytoplasmic מסלולי חישה DNA

Summary

Explore More Videos

Chapters in this video

במבחנה פליטת אור הדמיה vivo ג'ין הכתב של בתאי גזע עובריים אנושיים

In vivo ו במבחנה של אינטראקציה מתאם-clathrin

ויזואליזציה של תיקון MG53 בתיווך קרום התא באמצעות In vivo ו במבחנה מערכות

הפעלה של אפופטוזיס על ידי Microinjection cytoplasmic של ציטוכרום ג

הבידוד של הריבוזום פוליפפטידים המתהווה כרוכים

חלבון C-FOS איתור immunohistological: כלי שימושי כסמן של מסלולים מרכזיים המעורבים בתגובות פיסיולוגיות ספציפיות

בידוד סינון של חומצות גרעין: שיטת הפקת DNA פשוטה ומהירה

גלוקוז ספיגה מדידה ותגובה גירוי אינסולין ב

במבחנה , גישות In Vivo כדי לקבוע חדירות תאים אפיתל המעי

שיטות ששונו לטעינת לוחות מיצוי DNA בתפוקה גבוהה להפחית את הפוטנציאל לזיהום