Les auteurs n&#39;ont aucun remerciements.

1. concatémérisation <ol><li> Resuspendre les amorces Fw et Rv (voir le tableau des matériaux pour les séquences d&#39;amorces) à une concentration de 10 pg / pl de la biologie moléculaire note H 2 O. Ensuite, mélanger 5 pi de Fw et 5 pi de Rv amorce dans un tube de 1,5 ml. </li><li> Mélange d&#39;amorces de recuit par chauffage à la température d&#39;hybridation appropriée (75 ° C pour les amorces décrites ici) pendant 15 min. Laisser sur le banc de refroidir à la température ambiante (RT). Préparer le PEG8000 60% au cours de cette incubation par dissolution dans le trou DDH 2 O. </li><li> Ajouter 50 ul de 60% ​​PEG8000 (pour atteindre une concentration finale de 30%), 10 pi de 10x polynucléotide kinase (PNK) tampon, 27 pi de H 2 O, et 3 pi de PNK à la composition de l&#39;amorce. Incuber à 37 ° C pendant 2 heures. </li><li> Refroidir à la température ambiante et ajouter 11 ul de tampon ADN ligase. Ajouter ensuite 3 U d&#39;ADN ligase et on incube à 37 ° C pendant une nuit. </li></ol> 2 Purification de l&#39;ADNAnalyse et <ol><li> Ajouter 300 ul de H 2 O pour augmenter le volume du mélange de ligature. Remarque: Procédez à une hotte en raison de la toxicité du phénol: chloroforme vapeur. </li><li> Ajouter 1 volume (400 pi) de phénol: chloroforme et mélanger en agitant vigoureusement. </li><li> Centrifugeuse à vitesse max pendant 1 min dans une microcentrifugeuse de table. Les phases aqueuse et de solvant se séparent de la phase aqueuse au-dessus et une couche blanche de protéine précipitée entre les deux couches. </li><li> Transférer la couche supérieure dans un nouveau tube de pipetage attention (éviter le transfert du milieu, la couche blanche) </li><li> Répéter les étapes 2.2 et 2.3 au moins deux fois ou jusqu&#39;à ce qu&#39;il n&#39;y a pas de protéine précipité après centrifugation. </li><li> Ajouter 1 volume (400 pi) de chloroforme et répétez les étapes 2.3-2.4. </li><li> Ajouter 2 volumes (800 pi) de 100% d&#39;éthanol préalablement refroidi et incuber à 20 ° C pendant au moins 1 heure ou jusqu&#39;au lendemain. REMARQUE: cette étape précipite les concatémères ADN. </li><li> Isoler à la vitesse max et aspirer supernatant. Laver une fois en ajoutant 1 ml de 70% d&#39;éthanol et sécher à l&#39;air dans une hotte. </li><li> ADN Remettre en suspension dans 50 pi d&#39;endotoxines ddH 2 O. Remarque: L&#39;utilisation des endotoxines libres réactifs est critique pour la génération d&#39;une réponse immunitaire innée spécifique de l&#39;ADN dans des cellules et in vivo. </li><li> Retirer une partie aliquote de 2 pl de l&#39;ADN concatemerized dans un tube frais et ajouter 1 ml de tampon de gel de l&#39;ADN de chargement. </li><li> Dissoudre 1% d&#39;agarose dans du tampon TAE par chauffage à pleine puissance dans un four à micro-ondes pendant 2 min (temps ou qui est approprié à la puissance du four et le volume). </li><li> Verser le gel dans un appareil de coulée, ajouter 4 pl de colorant fluorescent de l&#39;ADN de chélation, insérer un peigne, et laisser à température ambiante pendant environ 20 min pour le gel à définir. </li><li> Une fois ensemble, enlever le gel de peigne et le lieu dans le réservoir d&#39;électrophorèse contenant un tampon TAE. Charge 3 pl de l&#39;échantillon ou la taille des marqueurs ADN dans les puits. </li><li> Exécutez électrophorèse sur gel pour 30-40 min à 90 V avec un courant constant. Visualize l&#39;ADN sous lumière ultra-violette d&#39;observer concatémérisation (figure 1A). </li><li> Mesurer la concentration de l&#39;ADN dans le reste de l&#39;échantillon par spectroscopie d&#39;absorption UV. Blank le spectromètre avec le même trou DDH 2 O qui a été utilisé pour remettre en suspension l&#39;ADN et mesurer le spectre d&#39;absorbance de 200 à 300 nm. REMARQUE: concentration d&#39;ADN peut être calculée en utilisant la loi de Beer-Lambert, A = e * c * l, où A est l&#39;absorbance, e le coefficient d&#39;extinction, et l la distance du trajet de la lumière. Pour la mesure de concentrations d&#39;ADN de l&#39;absorbance à 260 nm doit être mesuré et un coefficient d&#39;extinction de 0,027 (pg / ml) -1 cm -1 utilisés. La distance de la trajectoire de la lumière, l, va varier en fonction du spectrophotomètre. Bien que la mesure de la concentration, de prendre note du rapport d&#39;absorbance 260/280 nm comme une indication de la pureté de l&#39;ADN; une valeur de ce ratio supérieur à 2,00 est recommandé. </li></ol> 3. transfection de dsADN concatémères de Vitro <ol><li> cellules de semences dans une boîte de culture de tissu ou une plaque à 70% de confluence au moment de la stimulation. </li><li> Calculer la masse d&#39;ADN nécessaire pour la stimulation de cellules en utilisant une concentration finale de 1 à 10 pg / ml. La masse requise de l&#39;ADN est à noter que X ci-dessous. Par exemple, si la stimulation des cellules dans un seul puits d&#39;une plaque à 6 puits avec 2 ml de milieu à une concentration d&#39;ADN de 5 pg / ml, puis une masse de 2 * 5 = 10 ug d&#39;ADN est requise. </li><li> Ajouter 50 ul de X * un milieu exempt de sérum dans un tube stérile de taille appropriée. Pipette avec précaution dans le centre du milieu, sans toucher le côté du tube, 2 * pi X cationique réactif de transfection lipidique et laisser reposer pendant 5 min. </li><li> Ajouter X pg d&#39;ADN dans le tube et vortex brièvement. Laisser à température ambiante pendant au moins 20 min. Pour la transfection in vitro ajouter ce mélange directement dans les cellules à stimuler les voies de l&#39;ADN cytoplasmique de détection. </li></ol> 4. transfection de l&#39;ADN double brin concatémères jen Vivo <ol><li> Préparer mélange de transfection comme décrit dans 3.1 à 3.5 en utilisant une pg d&#39;ADN, 2 pi de réactif de transfection lipide, et 18 ul de sérum par un milieu dépourvu de l&#39;oreille de souris à être stimulée. Préparer un 20 pi Hamilton seringue stérile, bouchon avec une aiguille 30 G stérile, et charger avec le mélange d&#39;ADN de transfection. </li><li> Anesthésier une souris C57BL / 6 en utilisant 1-2% d&#39;isoflurane. Confirmez l&#39;anesthésie par une perte de mouvement et le rythme respiratoire constant et par test de réflexe de pincement si nécessaire. Surveiller les yeux de l&#39;animal pendant l&#39;anesthésie et utiliser la pommade comme nécessaire pour éviter la sécheresse excessive. </li><li> En utilisant une technique stérile, injecter avec soin dans le pavillon de l&#39;oreille 10 ul du mélange de transfection de sorte qu&#39;un seul «bulle» de liquide est formé entre les couches dermiques de l&#39;oreille. Remarque: Utilisez un dé à coudre en caoutchouc sur le pouce ou l&#39;index, étirer l&#39;oreille au-dessus, et injecter un angle aigu pour garantir l&#39;aiguille ne pénètre que la première couche de la peau du pavillon de l&#39;oreille. </li><li> Reintroduire la souris dans la cage et régulièrement surveiller la récupération post-anesthésique. Utilisation d&#39;une lampe de chauffage pour éviter un refroidissement excessif des souris anesthésiées. Ne pas laisser sans surveillance souris jusqu&#39;à ce qu&#39;ils aient repris conscience suffisante pour maintenir décubitus sternal. </li><li> Flash geler l&#39;ensemble du pavillon de l&#39;oreille, dans un tube à centrifuger en l&#39;immergeant dans de l&#39;azote liquide pendant 2 minutes. </li></ol> 5 Traitement des échantillons d&#39;ADN stimulée et l&#39;analyse par PCR quantitative (qPCR) <ol><li> De la culture cellulaire: Aspirer le milieu avec une pipette et jeter les déchets. </li><li> Ajouter 1 ml de PBS stérile. Répétez 5.1 et 5.2 deux fois et passez à l&#39;étape 5.3 </li><li> À partir de tissus de l&#39;oreille: broyer les tissus sous azote liquide à l&#39;aide d&#39;un pilon et le mortier en céramique stériles, transférer tissu broyé dans un tube à centrifuger aide d&#39;une spatule stérile, et passez à l&#39;étape 5.4 </li><li> Ajouter tampon de lyse 350 pi et de procéder à ARN commerciale protocole du kit d&#39;extraction. Elute ARN à partir de l&#39;extraction kit de purificationcolonne dans 40 ul ddH 2 O. Remarque: Le kit d&#39;extraction d&#39;ARN commercial (voir matériaux / table de l&#39;équipement) fonctionne très bien; d&#39;autres techniques ont été testées avec des résultats en dessous. </li><li> Quantifier l&#39;ARN par spectroscopie UV comme décrit ci-dessus pour l&#39;ADN (section 2.13). Remarque: le coefficient d&#39;extinction de l&#39;ARN est de 0,025 (pg / ml) -1 cm -1. </li><li> Ajouter à une PCR stérile tube 1 pi d&#39;oligo (dT) amorce, une ul de 10 mM dNTP mix, et 250 ug d&#39;ARN. Compléter le volume à 11 ul avec le trou DDH 2 O. stérile </li><li> Incuber pendant 5 min à 65 ° C. Puis ajouter 4 pi First Strand Buffer, 1 pl 0,1 M dithiothréitol, 0,25 ul transcriptase inverse et 1,75 ul ddH 2 O dans le tube. Incuber à 50 ° C pendant 1 h, suivi par 72 ° C pendant 15 min. Eventuellement, diluer le produit ADNc 1: 5 en utilisant le trou DDH 2 O. </li><li> Pour la PCR quantitative utilisation 2 ul d&#39;ADNc, 2 pl ddH 2 O, 5 pi qPCR Master Mix, et 1ul de 10 uM de chaque marche avant et arrière des stocks d&#39;amorces pour amplifier le gène (s) de choix. Mélanger dans une plaque à 96 puits et à analyser à l&#39;aide d&#39;un appareil de PCR quantitative (Figures 1B et 1C). </li></ol>

<ol>
	<li>Yoshida, H., Okabe, Y., Kawane, K., Fukuyama, H., Nagata, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Lethal+anemia+caused+by+interferon-beta+produced+in+mouse+embryos+carrying+undigested+DNA.">Lethal anemia caused by interferon-beta produced in mouse embryos carrying undigested DNA.</a> Nat. Immunol. 6, 49-56 (2005).</li><li>Ishikawa, H., Ma, Z., Barber, G. N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=STING+regulates+intracellular+DNA-mediated,+type+I+interferon-dependent+innate+immunity.">STING regulates intracellular DNA-mediated, type I interferon-dependent innate immunity.</a> Nature. 461, 788-792 (2009).</li><li>Ishii, K. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=TANK-binding+kinase-1+delineates+innate+and+adaptive+immune+responses+to+DNA+vaccines.">TANK-binding kinase-1 delineates innate and adaptive immune responses to DNA vaccines.</a> Nature. 451, 725-729 (2008).</li><li>Stetson, D. B., Medzhitov, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Recognition+of+cytosolic+DNA+activates+an+IRF3-dependent+innate+immune+response.">Recognition of cytosolic DNA activates an IRF3-dependent innate immune response.</a> Immunity. 24, 93-103 (2006).</li><li>Pichlmair, A., Reise Sousa, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Innate+recognition+of+viruses.">Innate recognition of viruses.</a> Immunity. 27, 370-383 (2007).</li><li>Unterholzner, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=IFI16+is+an+innate+immune+sensor+for+intracellular+DNA.">IFI16 is an innate immune sensor for intracellular DNA.</a> Nat. Immunol. 11, 997-1004 (2010).</li><li>Ferguson, B. J., Mansur, D. S., Peters, N. E., Ren, H., Smith, G. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=DNA-PK+is+a+DNA+sensor+for+IRF-3-dependent+innate+immunity.">DNA-PK is a DNA sensor for IRF-3-dependent innate immunity.</a> Elife. 1, e00047 (2012).</li><li>Sun, L., Wu, J., Du, F., Chen, X., Chen, Z. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cyclic+GMP-AMP+synthase+is+a+cytosolic+DNA+sensor+that+activates+the+type+I+interferon+pathway.">Cyclic GMP-AMP synthase is a cytosolic DNA sensor that activates the type I interferon pathway.</a> Science. 339, 786-791 (2013).</li><li>Honda, K., Taniguchi, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=IRFs:+master+regulators+of+signalling+by+Toll-like+receptors+and+cytosolic+pattern-recognition+receptors.">IRFs: master regulators of signalling by Toll-like receptors and cytosolic pattern-recognition receptors.</a> Nat. Rev. Immunol. 6, 644-658 (2006).</li><li>Karayel, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+TLR-independent+DNA+recognition+pathway+in+murine+macrophages:+Ligand+features+and+molecular+signature.">The TLR-independent DNA recognition pathway in murine macrophages: Ligand features and molecular signature.</a> Eur. J. Immunol. 39, 1929-1936 (2009).</li></ol>

The authors have nothing to disclose.

Les protocoles décrits ici sont utilisés pour générer l&#39;ADN double brin à stimuler la réponse immunitaire innée cytosolique avec des résultats reproductibles dans une large gamme de types de cellules et in vivo. Etant donné que le réactif principal de substrat utilisé est un oligonucléotide synthétique, une certaine souplesse dans ce système pour l&#39;utilisation de séquences d&#39;ADN ou d&#39;autres modifications chimiques. Il est possible, par exemple, à la place de l&#39;oligonucléotid...

ADN est un élément essentiel de tous les organismes et les cellules eucaryotes, qui maintiennent dans des compartiments spécifiques. Une fonction du système immunitaire inné est de déterminer quand tel cloisonnement tombe en panne ou lorsque le matériau étranger est introduit dans l&#39;organisme par une violation des obstacles externes, physiques. Dans le corps humain, il existe un certain nombre de protéines qui existent à l&#39;aide de petites quantités de dégradation de l&#39;ADN qui peut échapper à la bonne cloisonnement; DNAse I, II, et III défoncer ADN dans le plasma, endosome, et le cytosol, respectivement. Cependant, il a été démontré que des souris dépourvues de DNAse II meurent d&#39;une anémie sévère provoquée par une production excessive d&#39;interférons 1 suggérant que le système immunitaire inné répond à l&#39;ADN extra-nucléaire. Cette réponse se produit même chez les souris qui sont entièrement déficiente de la capacité de signalisation du récepteur Toll-like. De nombreuses études ont maintenant démontré que stimulateur de gènes d&#39;interféron (Sting) 2 et le réservoir de liaison kinase 1 (TBK1) 3 sont impliqués dans la détection de l&#39;ADN dans le cytoplasme et que cette voie de signalisation active le facteur de régulation de l&#39;interféron (IRF) -3 4. La transcription de IRF3 dépendante subséquente des cytokines, des chimiokines, des gènes de l&#39;interféron et est caractéristique d&#39;une réponse immunitaire innée, soit à un agent pathogène ou d&#39;un danger associé à motif moléculaire (PAMP ou DAMP) 5. Le désir d&#39;étudier intracellulaires voies de détection de l&#39;acide nucléique a conduit à la nécessité de développer des méthodes robustes et reproductibles pour la stimulation des cellules par l&#39;introduction d&#39;ADN ou d&#39;ARN dans les cellules sans activer d&#39;autres réponses immunitaires innées. Un procédé par lequel le / TBK1 / voie de IRF3 de piqûre peut être stimulée est d&#39;utiliser cationiques réactifs de transfection lipide pour délivrer un acide nucléique dans le cytoplasme où il peut être accédé par des capteurs de l&#39;ADN comme l&#39;ADN-PK, IFI16, et CGA 8.6. Les caractéristiques de l&#39;ADN qui sont actuellement comprises pour permettre effactivation isant de la réponse immunitaire innée cytoplasmique sans stimulation d&#39;autres voies sont sa longueur, la masse, la pureté et l&#39;absence de motifs CpG 4,7,9. Les oligonucleotides synthétiques sont très convenable pour le but de générer une réponse immunitaire innée, car ils permettent la séquence d&#39;ADN devant être optimisée et préparée comme une espèce chimique pur. Un ADN (ISD) séquence d&#39;immuno-stimulation de 45 paires de bases a été identifié par Stetson et al. 4 comme étant une séquence appropriée, sans CpG à cet effet. Cette séquence d&#39;ADN double brin est par ailleurs aléatoire et n&#39;a pas de caractéristiques spécifiques au-delà de son manque de motifs CpG. Nous avons découvert que par l&#39;oligonucléotide concatemerizing ISD significativement plus longues en brins augmente la grandeur de la stimulation 7. La génération d&#39;ISD concatemerized est donc utile pour stimuler une réponse immunitaire innée cytoplasmique. Nous présentons ici les protocoles pour la préparation de ce réactif et comment il peut être utilisé pour activer la voie de l&#39;ADN de détection envitro ainsi que in vivo. NOTE: Toutes les études animales sont réalisées selon des protocoles approuvés institutionnels et les lignes directrices de soins aux animaux.

<table border="0" cellpadding="0" cellspacing="0" width="1066">
	<tbody>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">Forward Primer</td>
			<td style="width:221px;">Integrated DNA technologies</td>
			<td style="width:144px;">n/a</td>
			<td style="width:407px;">TACAGATCTACTAGTGATCTATGACTGATCTGTACATGATCTACA</td>
		</tr>
		<tr height="19">
			<td height="19" style="height:19px;width:295px;">Reverse Primer</td>
			<td style="width:221px;">Integrated DNA technologies</td>
			<td style="width:144px;">n/a</td>
			<td>TGTAGATCATGTACAGATCAGTCATAGATCACTAGTAGATCTGTA</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">PEG8000</td>
			<td style="width:221px;">Sigma-Aldrich</td>
			<td style="width:144px;">P-4463</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">Molecular biology grade water</td>
			<td style="width:221px;">Sigma-Aldrich</td>
			<td style="width:144px;">W4502-1L</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">T4 Polynucleotide Kinase</td>
			<td style="width:221px;">Promega</td>
			<td style="width:144px;">M4101</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">T4 DNA Ligase</td>
			<td style="width:221px;">Promega</td>
			<td style="width:144px;">M1801</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">Phenol:Chloroform</td>
			<td style="width:221px;">Fisher Chemical</td>
			<td style="width:144px;">BPE1752p-400</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">Chloroform</td>
			<td style="width:221px;">Fisher Chemical</td>
			<td style="width:144px;">C/4960/PB08</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">Ethanol</td>
			<td style="width:221px;">Sigma-Aldrich</td>
			<td style="width:144px;">32221-2.5L</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">DNA gel loading buffer</td>
			<td style="width:221px;">New England biolabs</td>
			<td style="width:144px;">B7021S</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">Agarose</td>
			<td style="width:221px;">Bioline</td>
			<td style="width:144px;">BIO-41025</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">Optimem</td>
			<td style="width:221px;">Life Technologies</td>
			<td style="width:144px;">11058021</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">TransIT-LT1&#160;</td>
			<td style="width:221px;">Mirus Bioscience</td>
			<td style="width:144px;">MIR 2300</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">Hamilton Syringe</td>
			<td style="width:221px;">Hamilton</td>
			<td style="width:144px;">80901 Model 1705</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">30G needles&#160;</td>
			<td style="width:221px;">BD bioscience</td>
			<td style="width:144px;">304000</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">SYBR Safe DNA gel stain</td>
			<td style="width:221px;">Life Technologies</td>
			<td style="width:144px;">S33102</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">Rneasy Plus Mini Kit</td>
			<td style="width:221px;">Qiagen</td>
			<td style="width:144px;">74134</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">Oligo(dT) primer</td>
			<td style="width:221px;">Thermo Scientific</td>
			<td style="width:144px;">SO131</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">dNTP mix</td>
			<td style="width:221px;">Fermentas</td>
			<td style="width:144px;">R0192</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">Super Script III reverse transcriptase</td>
			<td style="width:221px;">Life Technologies</td>
			<td align="right" style="width:144px;">56575</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">First strand cDNA synthesis buffer</td>
			<td style="width:221px;">Life Technologies</td>
			<td style="width:144px;">y02321</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">SybrGreen qPCR Fast master mix</td>
			<td style="width:221px;">Applied Biosystems</td>
			<td align="right" style="width:144px;">4385612</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">cxcl10 murine forward primer&#160;</td>
			<td style="width:221px;">Integrated DNA technologies</td>
			<td style="width:144px;">n/a</td>
			<td>ACTGCATCCATATCGATGAC</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">cxcl10 murine reverse primer</td>
			<td style="width:221px;">Integrated DNA technologies</td>
			<td style="width:144px;">n/a</td>
			<td>TTCATCGTGGCAATGATCTC</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">il6 murine forward primer&#160;</td>
			<td style="width:221px;">Integrated DNA technologies</td>
			<td style="width:144px;">n/a</td>
			<td>GTAGCTATGGTACTCCAGAAGAC</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">il6 murine forward primer&#160;</td>
			<td style="width:221px;">Integrated DNA technologies</td>
			<td style="width:144px;">n/a</td>
			<td>GTAGCTATGGTACTCCAGAAGAC</td>
		</tr>
	</tbody>
</table>

stimulation of cytoplasmic dna sensing pathways in vitro and in vivo

Afin de stimuler efficacement une réponse immunitaire innée, l&#39;ADN doit être d&#39;une longueur et une pureté suffisante. Nous présentons une méthode où l&#39;ADN double brin (ADN double brin) qui a les caractéristiques requises pour stimuler l&#39;ADN cytoplasmique voies de détection peuvent être générés à moindre coût et en toute simplicité. Par la concatémérisation de courts oligonucléotides synthétiques (qui n&#39;ont pas de motifs CpG), l&#39;ADN double brin peut être généré pour avoir une longueur suffisante pour activer la voie de l&#39;ADN de détection cytosolique. Ce protocole implique de ligature d&#39;extrémités franches les oligonucléotides en présence de polyéthylène glycol (PEG), qui fournit un environnement efficace pour la liaison de se produire. Les concatémères ADN double brin peuvent être utilisés, après purification par extraction au phénol / chloroforme, pour simuler la réponse immunitaire innée in vitro par des protocoles de transfection standard. Cet ADN peut également être utilisé pour stimuler l&#39;immunité innée in vivo par injection intradermique dans le pavillon de l&#39;oreille d&#39;une souris, par exemple. Parstandardisation du processus de concatémérisation et les protocoles de stimulation ultérieures, une activation fiable et reproductible du système immunitaire inné peut être produit.

<html> Les résultats ci-dessous indiquent que l&#39;ADN concatemerized peut être générée avec une relative facilité et est capable de stimuler une réponse immunitaire innée robuste dans des cellules et chez des souris. Avec l&#39;utilisation de PEG8000, il peut être clairement vu que la longueur de l&#39;ADN en cours de création est nettement plus longue et également capable d&#39;induire la transcription de CXCL10. Comme on le voit par analyse sur gel d&#39;agarose, la norme a concatémérisation longueurs d&...

Watch this Scientific Journal Video about Stimulation of Cytoplasmic DNA Sensing Pathways In Vitro and In Vivo at JoVE.com

Stimulation of Cytoplasmic DNA Sensing Pathways In Vitro and In Vivo

L&#39;objectif du protocole est d&#39;utiliser des méthodes optimales pour stimuler les voies cytoplasmiques ADN de détection dans les cellules et in vivo. Ce résultat est obtenu en améliorant le temps de génération de l&#39;ADN double brin au cours de la ligature d&#39;extrémités franches. Les cellules et les souris sont ensuite transfectées en utilisant un réactif de transfection lipidique.

Stimulation de la cytoplasmiques ADN de détection Pathways<em&gt; In Vitro</em&gt; Et<em&gt; In Vivo</em

In order to efficiently stimulate an innate immune response, DNA must be of sufficient length and purity. We present a method where double stranded DNA ...

stimulation-of-cytoplasmic-dna-sensing-pathways-in-vitro-and-in-vivo

Research

JoVE Journal

Biology

Stimulation of Cytoplasmic DNA Sensing Pathways In Vitro and In Vivo

8.8K vues.  University of Cambridge.  L'objectif du protocole est d'utiliser des méthodes optimales pour stimuler les voies cytoplasmiques ADN de détection dans les cellules et in vivo. Ce résultat est obtenu en améliorant le temps de génération de l'ADN double brin au cours de la ligature d'extrémités franches. Les cellules et les souris sont ensuite transfectées en utilisant un réactif de transfection lipidique. 

Vidéo: Stimulation of Cytoplasmic DNA Sensing Pathways In Vitro and In Vivo

In vitro and in vivo Bioluminescence Reporter Gene Imaging of Human Embryonic Stem Cells

The discovery of human embryonic stem cells (hESCs) has dramatically increased the tools available to medical scientists interested in regenerative medicine. However, direct injection of hESCs, and cells differentiated from hESCs, into living organisms has thus far been hampered by significant cell death, teratoma formation, and host immune rejection. Understanding the in vivo hESC behavior after transplantation requires novel imaging techniques to longitudinally monitor hESC localization, proliferation, and viability. Molecular imaging has given investigators a high-throughput, inexpensive, and sensitive means for tracking in vivo cell proliferation over days, weeks, and even months. This advancement has significantly increased the understanding of the spatio-temporal kinetics of hESC engraftment, proliferation, and teratoma-formation in living subjects.

A major advance in molecular imaging has been the extension of noninvasive reporter gene assays from molecular and cellular biology into in vivo multi-modality imaging platforms. These reporter genes, under control of engineered promoters and enhancers that take advantage of the host cell s transcriptional machinery, are introduced into cells using a variety of vector and non-vector methods. Once in the cell, reporter genes can be transcribed either constitutively or only under specific biological or cellular conditions, depending on the type of promoter used. Transcription and translation of reporter genes into bioactive proteins is then detected with sensitive, noninvasive instrumentation (e.g., CCD cameras) using signal-generating probes such as D-luciferin.

To avoid the need for excitatory light to track stem cells in vivo as is required for fluorescence imaging, bioluminescence reporter gene imaging systems require only an exogenously administered probe to induce light emission. Firefly luciferase, derived from the firefly Photinus pyralis, encodes an enzyme that catalyzes D-luciferin to the optically active metabolite, oxyluciferin. Optical activity can then be monitored with an external CCD camera. Stably transduced cells that carry the reporter construct within their chromosomal DNA will pass the reporter construct DNA to daughter cells, allowing for longitudinal monitoring of hESC survival and proliferation in vivo. Furthermore, because expression of the reporter gene product is required for signal generation, only viable parent and daughter cells will create bioluminescence signal; apoptotic or dead cells will not. 

In this video, the specific materials and methods needed for tracking stem cell proliferation and teratoma formation with bioluminescence imaging will be described.

With the growing interest in stem cell therapies, molecular imaging techniques are ideal for monitoring stem cell behavior after transplantation. Luciferase reporter genes have enabled non-invasive, repetitive assessment of cell survival, location, and proliferation in vivo. This video will demonstrate how to track hESC proliferation in a living mouse.

In vitro et in vivo en bioluminescence gène rapporteur imagerie des cellules souches embryonnaires humaines

The discovery of human embryonic stem cells (hESCs) has dramatically increased the tools available to medical scientists interested in regenerative ...

Recherche

Biologie

DNA Transfection of Mammalian Skeletal Muscles using In Vivo Electroporation

A growing interest in cell biology is to express transgenically modified forms of essential proteins (e.g. fluorescently tagged constructs and/or mutant variants) in order to investigate their endogenous distribution and functional relevance. An interesting approach that has been implemented to fulfill this objective in fully differentiated cells is the in vivo transfection of plasmids by various methods into specific tissues such as liver1, skeletal muscle2,3, and even the brain4. We present here a detailed description of the steps that must be followed in order to efficiently transfect genetic material into fibers of the flexor digitorum brevis (FDB) and interosseus (IO) muscles of adult mice using an in vivo electroporation approach. The experimental parameters have been optimized so as to maximize the number of muscle fibers transfected while minimizing tissue damages that may impair the quality and quantity of the proteins expressed in individual fibers. We have verified that the implementation of the methodology described in this paper results in a high yield of soluble proteins, i.e. EGFP and ECFP3, calpain, FKBP12, &beta;2a-DHPR, etc. ; structural proteins, i.e. minidystrophin and &alpha;-actinin; and membrane proteins, i.e. &alpha;1s-DHPR, RyR1, cardiac Na/Ca2+ exchanger , NaV1.4 Na channel, SERCA1, etc., when applied to FDB, IO and other muscles of mice and rats. The efficient expression of some of these proteins has been verified with biochemical3 and functional evidence5. However, by far the most common confirmatory approach used by us are standard fluorescent microscopy and 2-photon laser scanning microscopy (TPLSM), which permit to identify not only the overall expression, but also the detailed intracellular localization, of fluorescently tagged protein constructs. The method could be equally used to transfect plasmids encoding for the expression of proteins of physiological relevance (as shown here), or for interference RNA (siRNA) aiming to suppress the expression of normally expressed proteins (not tested by us yet). It should be noted that the transfection of FDB and IO muscle fibers is particularly relevant for the investigation of mammalian muscle physiology since fibers enzymatically dissociated from these muscles are currently one of the most suitable models to investigate basic mechanisms of excitability and excitation-contraction coupling under current or voltage clamp conditions2,6-8.

DNA Transfection of Mammalian Skeletal Muscles using In Vivo Electroporation

We describe detailed procedures for the efficient transfection of plasmid DNA into the fibers of foot muscles of live mice using electroporation and the subsequent visualization of protein expression using fluorescence microscopy.

Transfection d&#39;ADN des mammifères muscles squelettiques à l&#39;aide In Vivo L&#39;électroporation

 A growing interest in cell biology is to express transgenically modified forms of essential proteins (e.g. fluorescently tagged constructs and/or mutant ...

In vivo and in vitro Studies of Adaptor-clathrin Interaction

A major endocytic pathway initiates with the formation of clathrin-coated vesicles (CCVs) that transport cargo from the cell surface to endosomes1-6. CCVs are distinguished by a polyhedral lattice of clathrin that coats the vesicle membrane and serves as a mechanical scaffold. Clathrin coats are assembled during vesicle formation from individual clathrin triskelia , the soluble form of clathrin composed of three heavy and three light chain subunits7,8. Because the triskelion does not have the ability to bind to the membrane directly, clathrin-binding adaptors are critical to link the forming clathrin lattice to the membrane through association with lipids and/or membrane proteins9. Adaptors also package transmembrane protein cargo, such as receptors, and can interact with each other and with other components of the CCV formation machinery9.
Over twenty clathrin adaptors have been described, several are involved in clathrin mediated endocytosis and others localize to the trans Golgi network or endosomes9. With the exception of HIP1R (yeast Sla2p), all known clathrin adaptors bind to the N-terminal -propeller domain of the clathrin heavy chain9. Clathrin adaptors are modular proteins consisting of folded domains connected by unstructured flexible linkers. Within these linker regions, short binding motifs mediate interactions with the clathrin N-terminal domain or other components of the vesicle formation machinery9. Two distinct clathrin-binding motifs have been defined: the clathrin-box and the W-box9. The consensus clathrin-box sequence was originally defined as L[L/I][D/E/N][L/F][D/E]10 but variants have been subsequently discovered11. The W-box conforms to the sequence PWxxW (where x is any residue).
Sla1p (Synthetic Lethal with Actin binding protein-1) was originally identified as an actin associated protein and is necessary for normal actin cytoskeleton structure and dynamics at endocytic sites in yeast cells12. Sla1p also binds the NPFxD endocytic sorting signal and is critical for endocytosis of cargo bearing the NPFxD signal13,14. More recently, Sla1p was demonstrated to bind clathrin through a motif similar to the clathrin box, LLDLQ, termed a variant clathrin-box (vCB), and to function as an endocytic clathrin adaptor15. In addition, Sla1p has become a widely used marker for the endocytic coat in live cell fluorescence microscopy studies16. Here we use Sla1p as a model to describe approaches for adaptor-clathrin interaction studies. We focus on live cell fluorescence microscopy, GST-pull down, and co-immunoprecipitation methods.

In vivo and in vitro Studies of Adaptor-clathrin Interaction

Clathrin-mediated endocytosis depends on adaptor proteins that coordinate cargo selection and clathrin coat assembly. Here we describe procedures to study adaptor-clathrin physical interaction and live cell imaging approaches using as a model the yeast endocytic adaptor protein Sla1p.

In vivo et in vitro de l&#39;adaptateur-clathrine Interaction

A major endocytic pathway initiates with the formation of clathrin-coated vesicles (CCVs) that transport cargo from the cell surface to endosomes1-6. CCVs ...

Visualization of MG53-mediated Cell Membrane Repair Using in vivo and in vitro Systems

Repair of acute injury to the cell membrane is an elemental process of normal cellular physiology, and defective membrane repair has been linked to many degenerative human diseases. The recent discovery of MG53 as a key component of the membrane resealing machinery allows for a better molecular understanding of the basic biology of tissue repair, as well as for potential translational applications in regenerative medicine. Here we detail the experimental protocols for exploring the in vivo function of MG53 in repair of muscle injury using treadmill exercise protocols on mouse models, for testing the ex vivo membrane repair capacity by measuring dye entry into isolated muscle fibers, and for monitoring the dynamic process of MG53-mediated vesicle trafficking and cell membrane repair in cultured cells using live cell confocal microscopy.

Visualization of MG53-mediated Cell Membrane Repair Using in vivo and in vitro Systems

Described here are protocols used to visualize the dynamic process of MG53-mediated cell membrane repair in whole animals and at the cellular level. These methods can be applied to investigate the cell biology of plasma membrane resealing and regenerative medicine.

Visualisation de MG53 médiation réparation de la membrane cellulaire utilisant In vivo Et In vitro Systèmes

Repair of acute injury to the cell membrane is an elemental process of normal cellular physiology, and defective membrane repair has been linked to many ...

Activation of Apoptosis by Cytoplasmic Microinjection of Cytochrome c

Apoptosis, or programmed cell death, is a conserved and highly regulated pathway by which cells die1. Apoptosis can be triggered when cells encounter a wide range of cytotoxic stresses. These insults initiate signaling cascades that ultimately cause the release of cytochrome c from the mitochondrial intermembrane space to the cytoplasm2. The release of cytochrome c from mitochondria is a key event that triggers the rapid activation of caspases, the key cellular proteases which ultimately execute cell death3-4.
The pathway of apoptosis is regulated at points upstream and downstream of cytochrome c release from mitochondria5. In order to study the post-mitochondrial regulation of caspase activation, many investigators have turned to direct cytoplasmic microinjection of holocytochrome c (heme-attached) protein into cells6-9. Cytochrome c is normally localized to the mitochondria where attachment of a heme group is necessary to enable it to activate apoptosis10-11. Therefore, to directly activate caspases, it is necessary to inject the holocytochrome c protein instead of its cDNA, because while the expression of cytochrome c from cDNA constructs will result in mitochondrial targeting and heme attachment, it will be sequestered from cytosolic caspases. Thus, the direct cytosolic microinjection of purified heme-attached cytochrome c protein is a useful tool to mimic mitochondrial cytochrome c release and apoptosis without the use of toxic insults which cause cellular and mitochondrial damage.
In this article, we describe a method for the microinjection of cytochrome c protein into cells, using mouse embryonic fibroblasts (MEFs) and primary sympathetic neurons as examples. While this protocol focuses on the injection of cytochrome c for investigations of apoptosis, the techniques shown here can also be easily adapted for microinjection of other proteins of interest.

Activation of Apoptosis by Cytoplasmic Microinjection of Cytochrome c

In this protocol, we describe the direct cytoplasmic microinjection of cytochrome c protein into fibroblasts and primary sympathetic neurons. This technique allows for the introduction of cytochrome c protein into the cytoplasm of cells and mimics the release of cytochrome c from mitochondria, which occurs during apoptosis.

L&#39;activation de l&#39;apoptose par micro-injection cytoplasmique du cytochrome C</em

Apoptosis, or programmed cell death, is a conserved and highly regulated pathway by which cells die1.  Apoptosis can be triggered when cells encounter a ...

Isolation of Ribosome Bound Nascent Polypeptides in vitro to Identify Translational Pause Sites Along mRNA

The rate of translational elongation is non-uniform. mRNA secondary structure, codon usage and mRNA associated proteins may alter ribosome movement on the messagefor review see 1. However, it's now widely accepted that synonymous codon usage is the primary cause of non-uniform translational elongation rates1. Synonymous codons are not used with identical frequency. A bias exists in the use of synonymous codons with some codons used more frequently than others2. Codon bias is organism as well as tissue specific2,3. Moreover, frequency of codon usage is directly proportional to the concentrations of cognate tRNAs4. Thus, a frequently used codon will have higher multitude of corresponding tRNAs, which further implies that a frequent codon will be translated faster than an infrequent one. Thus, regions on mRNA enriched in rare codons (potential pause sites) will as a rule slow down ribosome movement on the message and cause accumulation of nascent peptides of the respective sizes5-8. These pause sites can have functional impact on the protein expression, mRNA stability and protein foldingfor review see 9. Indeed, it was shown that alleviation of such pause sites can alter ribosome movement on mRNA and subsequently may affect the efficiency of co-translational (in vivo) protein folding1,7,10,11. To understand the process of protein folding in vivo, in the cell, that is ultimately coupled to the process of protein synthesis it is essential to gain comprehensive insights into the impact of codon usage/tRNA content on the movement of ribosomes along mRNA during translational elongation.
Here we describe a simple technique that can be used to locate major translation pause sites for a given mRNA translated in various cell-free systems6-8. This procedure is based on isolation of nascent polypeptides accumulating on ribosomes during in vitro translation of a target mRNA. The rationale is that at low-frequency codons, the increase in the residence time of the ribosomes results in increased amounts of nascent peptides of the corresponding sizes. In vitro transcribed mRNA is used for in vitro translational reactions in the presence of radioactively labeled amino acids to allow the detection of the nascent chains. In order to isolate ribosome bound nascent polypeptide complexes the translation reaction is layered on top of 30% glycerol solution followed by centrifugation. Nascent polypeptides in polysomal pellet are further treated with ribonuclease A and resolved by SDS PAGE. This technique can be potentially used for any protein and allows analysis of ribosome movement along mRNA and the detection of the major pause sites. Additionally, this protocol can be adapted to study factors and conditions that can alter ribosome movement and thus potentially can also alter the function/conformation of the protein.

Isolation of Ribosome Bound Nascent Polypeptides in vitro to Identify Translational Pause Sites Along mRNA

A technique to identify translational pause sites on mRNA is described. This procedure is based on isolation of nascent polypeptides accumulating on ribosomes during in vitro translation of a target mRNA, followed by the size analysis of the nascent chains using a denaturing gel electrophoresis.

Isolement du ribosome Bound polypeptides naissants<em&gt; In vitro</em&gt; Pour identifier les sites de pause de translation le long d&#39;ARNm

The rate of translational elongation is non-uniform. mRNA secondary structure, codon usage and mRNA associated proteins may alter ribosome movement on the ...

The c-FOS Protein Immunohistological Detection: A Useful Tool As a Marker of Central Pathways Involved in Specific Physiological Responses In Vivo and Ex Vivo

Many studies seek to identify and map the brain regions involved in specific physiological regulations. The proto-oncogene c-fos, an immediate early gene, is expressed in neurons in response to various stimuli. The protein product can be readily detected with immunohistochemical techniques leading to the use of c-FOS detection to map groups of neurons that display changes in their activity. In this article, we focused on the identification of brainstem neuronal populations involved in the ventilatory adaptation to hypoxia or hypercapnia. Two approaches were described to identify involved neuronal populations in vivo in animals and ex vivo in deafferented brainstem preparations. In vivo, animals were exposed to hypercapnic or hypoxic gas mixtures. Ex vivo, deafferented preparations were superfused with hypoxic or hypercapnic artificial cerebrospinal fluid. In both cases, either control in vivo animals or ex vivo preparations were maintained under normoxic and normocapnic conditions. The comparison of these two approaches allows the determination of the origin of the neuronal activation i.e., peripheral and/or central. In vivo and ex vivo, brainstems were collected, fixed, and sliced into sections. Once sections were prepared, immunohistochemical detection of the c-FOS protein was made in order to identify the brainstem groups of cells activated by hypoxic or hypercapnic stimulations. Labeled cells were counted in brainstem respiratory structures. In comparison to the control condition, hypoxia or hypercapnia increased the number of c-FOS labeled cells in several specific brainstem sites that are thus constitutive of the neuronal pathways involved in the adaptation of the central respiratory drive.

The c-FOS Protein Immunohistological Detection: A Useful Tool As a Marker of Central Pathways Involved in Specific Physiological Responses In Vivo and Ex Vivo

Here, we present a protocol based on c-FOS protein immunohistological detection, a classical technique used for the identification of neuronal populations involved in specific physiological responses in vivo and ex vivo.

La protéine c-FOS détection immunohistologique: Un outil utile comme marqueur des voies centrales impliquées dans les réponses physiologiques spécifiques<em&gt; In Vivo</em&gt; et<em&gt; Ex Vivo</em

Many studies seek to identify and map the brain regions involved in specific physiological regulations. The proto-oncogene c-fos, an immediate early gene, ...

Filtration Isolation of Nucleic Acids:  A Simple and Rapid DNA Extraction Method

FINA, filtration isolation of nucleic acids, is a novel extraction method which utilizes vertical filtration via a separation membrane and absorbent pad to extract cellular DNA from whole blood in less than 2 min. The blood specimen is treated with detergent, mixed briefly and applied by pipet to the separation membrane. The lysate wicks into the blotting pad due to capillary action, capturing the genomic DNA on the surface of the separation membrane. The extracted DNA is retained on the membrane during a simple wash step wherein PCR inhibitors are wicked into the absorbent blotting pad. The membrane containing the entrapped DNA is then added to the PCR reaction without further purification. This simple method does not require laboratory equipment and can be easily implemented with inexpensive laboratory supplies. Here we describe a protocol for highly sensitive detection and quantitation of HIV-1 proviral DNA from 100 &#181;l whole blood as a model for early infant diagnosis of HIV that could readily be adapted to other genetic targets.

We describe here a simple and rapid paper-based DNA extraction method of HIV proviral DNA from whole blood detected by quantitative PCR. This protocol can be extended for use in detecting other genetic markers or using alternative amplification methods.

Filtration Isolement des acides nucléiques: Une méthode d&#39;extraction de l&#39;ADN simple et rapide

FINA, filtration isolation of nucleic acids, is a novel extraction method which utilizes vertical filtration via a separation membrane and absorbent pad ...

Glucose Uptake Measurement and Response to Insulin Stimulation in In Vitro Cultured Human Primary Myotubes

Skeletal muscle is the largest glucose deposit in mammals and largely contributes to glucose homeostasis. Assessment of insulin sensitivity of muscle cells is of major relevance for all studies dedicated to exploring muscle glucose metabolism and characterizing metabolic alterations. In muscle cells, glucose transporter type 4 (GLUT4) proteins translocate to the plasma membrane in response to insulin, thus allowing massive entry of glucose into the cell. The ability of muscle cells to respond to insulin by increasing the rate of glucose uptake is one of the standard readouts to quantify muscle cell sensitivity to insulin. Human primary myotubes are a suitable in vitro model, as the cells maintain many features of the donor phenotype, including insulin sensitivity. This in vitro model is also suitable for the test of any compounds that could impact insulin responsiveness. Measurements of the glucose uptake rate in differentiated myotubes reflect insulin sensitivity.
In this method, human primary muscle cells are cultured in vitro to obtain differentiated myotubes, and glucose uptake rates with and without insulin stimulation are measured. We provide a detailed protocol to quantify passive and active glucose transport rates using radiolabeled [3H] 2-deoxy-D-Glucose ([3H]2dG). Calculation methods are provided to quantify active basal and insulin-stimulated rates, as well as stimulation fold.

Glucose Uptake Measurement and Response to Insulin Stimulation in In Vitro Cultured Human Primary Myotubes

In this method, human primary muscle cells are cultured in vitro to obtain differentiated myotubes and glucose uptake rates are measured. We provide a detailed protocol to quantify rates in basal and insulin-stimulated states using radiolabeled [3H] 2-deoxy-D-Glucose.

Mesure de l&#39;absorption de glucose et réponse à la stimulation de l&#39;insuline dans<em&gt; In Vitro</em&gt; Myotubes primaires humains cultivés

Skeletal muscle is the largest glucose deposit in mammals and largely contributes to glucose homeostasis. Assessment of insulin sensitivity of muscle ...

In Vitro and In Vivo Approaches to Determine Intestinal Epithelial Cell Permeability

The intestinal barrier defends against pathogenic microorganism and microbial toxin. Its function is regulated by tight junction permeability and epithelial cell integrity, and disruption of the intestinal barrier function contributes to progression of gastrointestinal and systemic disease. Two simple methods are described here to measure the permeability of intestinal epithelium. In vitro, Caco-2BBe cells are plated in tissue culture wells as a monolayer and transepithelial electrical resistance (TER) can be measured by an epithelial (volt/ohm) meter. This method is convincing because of its user-friendly operation and repeatability. In vivo, mice are gavaged with 4 kDa fluorescein isothiocyanate (FITC)-dextran, and the FITC-dextran concentrations are measured in collected serum samples from mice to determine the epithelial permeability. Oral gavage provides an accurate dose, and therefore is the preferred method to measure the intestinal permeability in vivo. Taken together, these two methods can measure the permeability of the intestinal epithelium in vitro and in vivo, and hence be used to study the connection between diseases and barrier function.

In Vitro and In Vivo Approaches to Determine Intestinal Epithelial Cell Permeability

Two methods are presented here to determine intestinal barrier function. An epithelial meter (volt/ohm) is used for measurements of transepithelial electrical resistance of cultured epithelia directly in tissue culture wells. In mice, the FITC-dextran gavage method is used to determine the intestinal permeability in vivo.