Gli autori non hanno riconoscimenti.

1 Concatemerization <ol><li> Risospendere primer Fw e Rv (vedere Tabella dei materiali per le sequenze dei primer) ad una concentrazione di 10 mg / mL in biologia molecolare di grado H 2 O. Poi, mescolare 5 ml di Fw e 5 ml di Rv innesco in una provetta da 1,5 ml microcentrifuga. </li><li> Miscela di primer Anneal mediante riscaldamento alla temperatura di ricottura corretta (75 ° C per i primers descritti) per 15 min. Lasciare in panchina per raffreddare a temperatura ambiente (RT). Preparare la PEG8000 del 60% durante questo incubazione sciogliendo in DDH 2 O. </li><li> Aggiungere 50 ml di 60% PEG8000 (per ottenere una concentrazione finale del 30%), 10 ml di 10x polinucleotide chinasi (PNK) di buffer, 27 ml di H 2 O, e 3 ml di PNK alla miscela di primer. Incubare a 37 ° C per 2 ore. </li><li> Raffreddare a temperatura ambiente e aggiungere 11 ml di tampone di DNA ligasi. Quindi aggiungere 3 U di DNA ligasi e incubare a 37 ° C durante la notte. </li></ol> 2. DNA Purificatione analisi <ol><li> Aggiungere 300 ml di H 2 O per aumentare il volume del mix legatura. Nota: Procedere in una cappa aspirante a causa della tossicità del fenolo: vapori di cloroformio. </li><li> Aggiungere 1 volume (400 ml) di fenolo: cloroformio e mescolare agitando energicamente. </li><li> Centrifugare alla massima velocità per 1 minuto in una microcentrifuga da tavolo. Gli strati acquosi e solventi separerà con lo strato acquoso sulla parte superiore e uno strato bianco di proteina precipitata tra i due strati. </li><li> Trasferimento strato superiore in una nuova provetta da un&#39;attenta pipettaggio (evitare di trasferire centrale, strato bianco) </li><li> Ripetere i punti 2.2 e 2.3 almeno due volte o fino a quando non vi è alcuna proteina precipitata dopo la centrifugazione. </li><li> Aggiungere 1 volume (400 ml) di cloroformio e ripetere i passaggi 2,3-2,4. </li><li> Aggiungere 2 volumi (800 microlitri) di etanolo al 100% prechilled e incubare a -20 ° C per almeno 1 ora o durante la notte. NOTA: questo passaggio precipita le concatemers DNA. </li><li> Spin down alla massima velocità e aspirare supernatant. Lavare una volta con l&#39;aggiunta di 1 ml di etanolo al 70% e lasciare asciugare in cappa. </li><li> DNA Risospendere in 50 ml di endotossina DDH 2 O. libero Nota: L&#39;uso di reagenti endotossina libera è fondamentale per generare una risposta immunitaria innata specifica-DNA in cellule e in vivo. </li><li> Rimuovere un&#39;aliquota 2 microlitri di DNA concatemerized in una nuova provetta e aggiungere 1 ml di tampone del gel del DNA di carico. </li><li> Sciogliere 1% agarosio in tampone TAE mediante riscaldamento alla massima potenza in un forno a microonde per 2 min (o tempo adeguato alla potenza del forno e volume). </li><li> Versare il gel in Impianto di colata, aggiungere 4 ml di colorante fluorescente chelante DNA, inserire un pettine, e lasciare a temperatura ambiente per circa 20 minuti per il gel per impostare. </li><li> Una volta impostato, rimuovere il gel pettine e posto nel serbatoio elettroforesi contenente tampone TAE. Carico 3 ml di campione di DNA o di dimensioni marcatori nei pozzetti. </li><li> Eseguire l&#39;elettroforesi su gel per 30-40 min a 90 V con corrente costante. Visualize il DNA sotto luce ultravioletta per osservare concatemerization (Figura 1A). </li><li> Misurare la concentrazione di DNA nel resto del campione mediante spettroscopia assorbanza UV. Blank lo spettrometro con la stessa DDH 2 O che è stato utilizzato per risospendere il DNA e misurare lo spettro di assorbanza 200-300 nm. NOTA: la concentrazione di DNA può essere calcolata utilizzando la legge di Beer-Lambert, A = e * c * l, dove A è l&#39;assorbanza, via e il coefficiente di estinzione, e l la distanza del percorso della luce. Per misurare le concentrazioni di DNA l&#39;assorbanza a 260 nm dovrebbe essere misurato e un coefficiente di estinzione di 0,027 (mg / ml) -1 cm -1 utilizzato. La luce distanza percorso, l, varierà a seconda dello spettrofotometro. Durante la misurazione della concentrazione, prendere nota del rapporto di assorbanza 260/280 nm come un&#39;indicazione di purezza del DNA; è raccomandato un valore per questo rapporto di cui sopra 2.00. </li></ol> 3. trasfezione di dsDNA Concatemers in vitro <ol><li> Cellule seme in un piatto di coltura di tessuti o piastra per essere il 70% confluenti al momento della stimolazione. </li><li> Calcolare la massa di DNA necessario per la stimolazione delle cellule utilizzando una concentrazione finale di 1-10 mg / ml. La massa necessaria di DNA noterà come X sotto. Per esempio se stimolando le cellule in un singolo pozzetto di una piastra da 6 pozzetti con 2 ml di terreno ad una concentrazione di DNA su 5 mcg / ml poi una massa di 2 * 5 = 10 mg di DNA è necessaria. </li><li> Aggiungere 50 * X ml di mezzo privo di siero in una provetta sterile di dimensioni adatte. Pipettare accuratamente nel centro del mezzo, senza toccare il lato del tubo, 2 * X microlitri di lipidi cationici reagente di trasfezione e lasciar riposare per 5 min. </li><li> Aggiungere X mg di DNA brevemente tubo e vortex. Lasciare a temperatura ambiente per almeno 20 min. Per la trasfezione in vitro aggiungere questa miscela direttamente alle cellule per stimolare citoplasmatici percorsi di rilevamento del DNA. </li></ol> 4 trasfezione di dsDNA Concatemers In Vivo <ol><li> Preparare la miscela di trasfezione come descritto nella 3,1-3,5 con 1 mg di DNA, 2 ml di reagente di trasfezione lipidico, e 18 microlitri di siero medio gratuito per orecchio mouse per essere stimolato. Preparare una sterile 20 ml siringa Hamilton, tappo con una sterile 30 G aghi, e caricare con la miscela di trasfezione del DNA. </li><li> Anestetizzare un C57BL / 6 del mouse utilizzando 1-2% isoflurano. Confermare l&#39;anestesia da perdita di movimento e frequenza respiratoria costante e da un pizzico reflex test, se necessario. Monitorare gli occhi dell&#39;animale durante l&#39;anestesia e utilizzare unguento come richiesto per evitare eccessiva secchezza. </li><li> Usando una tecnica sterile, iniettare con cura nel padiglione auricolare 10 ml di miscela di trasfezione in modo che un singolo &#39;bolla&#39; di liquido è formato tra gli strati dermici dell&#39;orecchio. Nota: Utilizzare un ditale in gomma sul pollice o indice, tendere l&#39;orecchio su di esso, e iniettare ad angolo acuto al fine di garantire l&#39;ago penetra solo il primo strato di pelle del padiglione auricolare. </li><li> Reindurre il mouse indietro nella gabbia e monitorare regolarmente recupero post-anestetico. Utilizzare una lampada di riscaldamento per evitare un eccessivo raffreddamento dei topi anestetizzati. Non lasciare incustoditi i topi prima di aver ripreso conoscenza sufficiente per mantenere decubito sternale. </li><li> Flash congelare l&#39;intero padiglione auricolare in una provetta da microcentrifuga da immersione in azoto liquido per 2 min. </li></ol> 5. Trattamento delle stimolato DNA campioni e analisi mediante PCR quantitativa (qPCR) <ol><li> Dalla coltura cellulare: medio aspirato con una pipetta e scartare rifiuti. </li><li> Aggiungere 1 ml di PBS sterile. Ripetere 5.1 e 5.2 due volte e passare al punto 5.3 </li><li> Dal tessuto orecchio: macinare il tessuto sotto azoto liquido utilizzando pestello in ceramica sterili e malta, il trasferimento di tessuto a terra in una provetta con una spatola sterile, e passare al punto 5.4 </li><li> Aggiungere 350 microlitri tampone di lisi e procedere con l&#39;RNA commerciale protocollo kit di estrazione. Eluire RNA dall&#39;estrazione kit di purificazionecolonna 40 microlitri DDH 2 O. Nota: il kit di estrazione di RNA commerciale (vedi materiali / attrezzature da tavola) funziona molto bene; altre tecniche sono state testate con risultati scadente. </li><li> Quantificare RNA mediante spettroscopia UV come descritto per il DNA in precedenza (punto 2.13). Nota: il coefficiente di estinzione per l&#39;RNA è 0,025 (mg / ml) -1 cm -1. </li><li> Aggiungere a una sterile PCR tubo 1 ml di oligo (dT) primer, 1 ul di dNTP 10 mM mix, e 250 mg di RNA. Portare al volume di 11 microlitri con DDH 2 O. sterile </li><li> Incubare per 5 minuti a 65 ° C. Quindi aggiungere 4 ml First Strand Buffer, 1 ml 0.1 M ditiotreitolo, 0,25 ml trascrittasi inversa e 1,75 ml DDH 2 O al tubo. Incubare a 50 ° C per 1 ora seguito da 72 ° C per 15 min. In alternativa, diluire il cDNA prodotto 1: 5 con DDH 2 O. </li><li> Per la PCR quantitativa uso 2 microlitri di cDNA, 2 ml DDH 2 O, 5 microlitri qPCR master mix, e 1ml ciascuna di 10 uM avanti e indietro le scorte di primer per amplificare gene (s) di scelta. Mescolare in una piastra a 96 pozzetti e analizzare utilizzando una macchina di PCR quantitativa (Figure 1B e 1C). </li></ol>

<ol>
	<li>Yoshida, H., Okabe, Y., Kawane, K., Fukuyama, H., Nagata, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Lethal+anemia+caused+by+interferon-beta+produced+in+mouse+embryos+carrying+undigested+DNA.">Lethal anemia caused by interferon-beta produced in mouse embryos carrying undigested DNA.</a> Nat. Immunol. 6, 49-56 (2005).</li><li>Ishikawa, H., Ma, Z., Barber, G. N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=STING+regulates+intracellular+DNA-mediated,+type+I+interferon-dependent+innate+immunity.">STING regulates intracellular DNA-mediated, type I interferon-dependent innate immunity.</a> Nature. 461, 788-792 (2009).</li><li>Ishii, K. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=TANK-binding+kinase-1+delineates+innate+and+adaptive+immune+responses+to+DNA+vaccines.">TANK-binding kinase-1 delineates innate and adaptive immune responses to DNA vaccines.</a> Nature. 451, 725-729 (2008).</li><li>Stetson, D. B., Medzhitov, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Recognition+of+cytosolic+DNA+activates+an+IRF3-dependent+innate+immune+response.">Recognition of cytosolic DNA activates an IRF3-dependent innate immune response.</a> Immunity. 24, 93-103 (2006).</li><li>Pichlmair, A., Reise Sousa, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Innate+recognition+of+viruses.">Innate recognition of viruses.</a> Immunity. 27, 370-383 (2007).</li><li>Unterholzner, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=IFI16+is+an+innate+immune+sensor+for+intracellular+DNA.">IFI16 is an innate immune sensor for intracellular DNA.</a> Nat. Immunol. 11, 997-1004 (2010).</li><li>Ferguson, B. J., Mansur, D. S., Peters, N. E., Ren, H., Smith, G. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=DNA-PK+is+a+DNA+sensor+for+IRF-3-dependent+innate+immunity.">DNA-PK is a DNA sensor for IRF-3-dependent innate immunity.</a> Elife. 1, e00047 (2012).</li><li>Sun, L., Wu, J., Du, F., Chen, X., Chen, Z. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cyclic+GMP-AMP+synthase+is+a+cytosolic+DNA+sensor+that+activates+the+type+I+interferon+pathway.">Cyclic GMP-AMP synthase is a cytosolic DNA sensor that activates the type I interferon pathway.</a> Science. 339, 786-791 (2013).</li><li>Honda, K., Taniguchi, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=IRFs:+master+regulators+of+signalling+by+Toll-like+receptors+and+cytosolic+pattern-recognition+receptors.">IRFs: master regulators of signalling by Toll-like receptors and cytosolic pattern-recognition receptors.</a> Nat. Rev. Immunol. 6, 644-658 (2006).</li><li>Karayel, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+TLR-independent+DNA+recognition+pathway+in+murine+macrophages:+Ligand+features+and+molecular+signature.">The TLR-independent DNA recognition pathway in murine macrophages: Ligand features and molecular signature.</a> Eur. J. Immunol. 39, 1929-1936 (2009).</li></ol>

The authors have nothing to disclose.

I protocolli qui descritti sono utilizzati per generare dsDNA per stimolare la risposta immunitaria innata citosolico con risultati riproducibili in una vasta gamma di tipi cellulari che in vivo. Poiché il principale reagente substrato utilizzato è un oligonucleotide sintetico, vi è la flessibilità in questo sistema per l&#39;utilizzo di sequenze di DNA alternative o modificazioni chimiche. E &#39;possibile, per esempio, per sostituire l&#39;oligonucleotide filo avanti descritto in questo protocollo con uno...

Il DNA è una componente vitale di tutti gli organismi e le cellule eucarioti, che mantengono in compartimenti specifici. Una funzione del sistema immunitario innato è quello di individuare quando tale compartimentazione si rompe o quando il materiale estraneo viene introdotto nell&#39;organismo attraverso una violazione delle barriere fisiche, esterni. Nel corpo umano ci sono una serie di proteine ​​che esistono per aiutare a degradare piccole quantità di DNA che possono sfuggire alla compartimentazione corretta; DNAsi I, II, e III abbattere DNA nel plasma, endosome, e citosol, rispettivamente. Tuttavia, è stato dimostrato che i topi privi DNAse II muoiono da grave anemia causata da eccessiva produzione di interferoni 1 suggeriscono che il sistema immunitario innato risponde a DNA extra-nucleare. Questa risposta si verifica anche nei topi, che sono del tutto carenti di capacità di segnalazione dei recettori toll-like. Numerosi studi hanno ormai dimostrato che stimolatore dei geni interferone (STING) 2 e-TANK vincolante chinasi 1 (TBK1) 3 sono coinvolti nella rilevazione del DNA nel citoplasma e che questa via di segnalazione attiva interferon fattore di regolazione (IRF) -3 4. La successiva trascrizione IRF3-dipendente di citochine, chemochine, e geni interferone è caratteristico di una risposta immunitaria innata, o un agente patogeno o di pericolo associato modello molecolare (PAMP o umido) 5. Il desiderio di studiare intracellulari nucleici percorsi di rilevamento acido ha portato alla necessità di sviluppare metodi affidabili e riproducibili per stimolare le cellule con l&#39;introduzione di DNA o RNA nelle cellule senza attivare altre risposte immunitarie innate. Un metodo con cui il STING / TBK1 / IRF3 percorso possono essere stimolati sia utilizzando cationici reagenti di trasfezione lipidico per fornire acido nucleico nel citoplasma, dove si può accedere da sensori di DNA come il DNA-PK, IFI16, e CGAs 6-8. Le caratteristiche del DNA che sono attualmente compresi per consentire effl&#39;attivazione icient della risposta immunitaria innata citoplasmatica senza stimolazione di altre vie sono la sua lunghezza, massa, la purezza, e la mancanza di CpG motivi 4,7,9. Oligonucleotidi sintetici sono altamente adatti allo scopo di generare una risposta immunitaria innata quanto permettono la sequenza di DNA di ottimizzare e preparato come una specie chimica pura. Un immuno-stimolante DNA (ISD) sequenza di 45 coppie di basi è stato identificato da Stetson et al. 4 come un adeguato, sequenza CpG-libero per questo scopo. Questa sequenza dsDNA è altrimenti casuale e non ha caratteristiche specifiche di là della sua mancanza di motivi CpG. Abbiamo trovato che concatemerizing l&#39;oligonucleotide DSI in fili significativamente più lunghi aumenta l&#39;ampiezza della stimolazione 7. Generazione di ISD concatemerized è quindi utile per stimolare una risposta immunitaria innata citoplasmatica. Qui vi presentiamo i protocolli per la preparazione di questo reagente e come può essere utilizzato per attivare il percorso di rilevamento del DNA invitro e in vivo. NOTA: Tutti gli studi sugli animali vengono eseguiti secondo protocolli istituzionali approvate e linee guida per la cura degli animali.

<table border="0" cellpadding="0" cellspacing="0" width="1066">
	<tbody>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">Forward Primer</td>
			<td style="width:221px;">Integrated DNA technologies</td>
			<td style="width:144px;">n/a</td>
			<td style="width:407px;">TACAGATCTACTAGTGATCTATGACTGATCTGTACATGATCTACA</td>
		</tr>
		<tr height="19">
			<td height="19" style="height:19px;width:295px;">Reverse Primer</td>
			<td style="width:221px;">Integrated DNA technologies</td>
			<td style="width:144px;">n/a</td>
			<td>TGTAGATCATGTACAGATCAGTCATAGATCACTAGTAGATCTGTA</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">PEG8000</td>
			<td style="width:221px;">Sigma-Aldrich</td>
			<td style="width:144px;">P-4463</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">Molecular biology grade water</td>
			<td style="width:221px;">Sigma-Aldrich</td>
			<td style="width:144px;">W4502-1L</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">T4 Polynucleotide Kinase</td>
			<td style="width:221px;">Promega</td>
			<td style="width:144px;">M4101</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">T4 DNA Ligase</td>
			<td style="width:221px;">Promega</td>
			<td style="width:144px;">M1801</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">Phenol:Chloroform</td>
			<td style="width:221px;">Fisher Chemical</td>
			<td style="width:144px;">BPE1752p-400</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">Chloroform</td>
			<td style="width:221px;">Fisher Chemical</td>
			<td style="width:144px;">C/4960/PB08</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">Ethanol</td>
			<td style="width:221px;">Sigma-Aldrich</td>
			<td style="width:144px;">32221-2.5L</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">DNA gel loading buffer</td>
			<td style="width:221px;">New England biolabs</td>
			<td style="width:144px;">B7021S</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">Agarose</td>
			<td style="width:221px;">Bioline</td>
			<td style="width:144px;">BIO-41025</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">Optimem</td>
			<td style="width:221px;">Life Technologies</td>
			<td style="width:144px;">11058021</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">TransIT-LT1&#160;</td>
			<td style="width:221px;">Mirus Bioscience</td>
			<td style="width:144px;">MIR 2300</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">Hamilton Syringe</td>
			<td style="width:221px;">Hamilton</td>
			<td style="width:144px;">80901 Model 1705</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">30G needles&#160;</td>
			<td style="width:221px;">BD bioscience</td>
			<td style="width:144px;">304000</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">SYBR Safe DNA gel stain</td>
			<td style="width:221px;">Life Technologies</td>
			<td style="width:144px;">S33102</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">Rneasy Plus Mini Kit</td>
			<td style="width:221px;">Qiagen</td>
			<td style="width:144px;">74134</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">Oligo(dT) primer</td>
			<td style="width:221px;">Thermo Scientific</td>
			<td style="width:144px;">SO131</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">dNTP mix</td>
			<td style="width:221px;">Fermentas</td>
			<td style="width:144px;">R0192</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">Super Script III reverse transcriptase</td>
			<td style="width:221px;">Life Technologies</td>
			<td align="right" style="width:144px;">56575</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">First strand cDNA synthesis buffer</td>
			<td style="width:221px;">Life Technologies</td>
			<td style="width:144px;">y02321</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">SybrGreen qPCR Fast master mix</td>
			<td style="width:221px;">Applied Biosystems</td>
			<td align="right" style="width:144px;">4385612</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">cxcl10 murine forward primer&#160;</td>
			<td style="width:221px;">Integrated DNA technologies</td>
			<td style="width:144px;">n/a</td>
			<td>ACTGCATCCATATCGATGAC</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">cxcl10 murine reverse primer</td>
			<td style="width:221px;">Integrated DNA technologies</td>
			<td style="width:144px;">n/a</td>
			<td>TTCATCGTGGCAATGATCTC</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">il6 murine forward primer&#160;</td>
			<td style="width:221px;">Integrated DNA technologies</td>
			<td style="width:144px;">n/a</td>
			<td>GTAGCTATGGTACTCCAGAAGAC</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">il6 murine forward primer&#160;</td>
			<td style="width:221px;">Integrated DNA technologies</td>
			<td style="width:144px;">n/a</td>
			<td>GTAGCTATGGTACTCCAGAAGAC</td>
		</tr>
	</tbody>
</table>

stimulation of cytoplasmic dna sensing pathways in vitro and in vivo

Al fine di stimolare efficacemente una risposta immunitaria innata, il DNA deve essere di lunghezza e purezza sufficiente. Vi presentiamo un metodo in cui DNA a doppia elica (dsDNA), che ha le caratteristiche necessarie per stimolare il DNA citoplasmatico percorsi di rilevamento possono essere generati a basso costo e con facilità. Con la concatemerization di brevi oligonucleotidi sintetici (che manca motivi CpG), dsDNA possono essere generati per essere di lunghezza sufficiente per attivare il rilevamento del DNA citosolico percorso. Questo protocollo prevede la legatura punta smussata degli oligonucleotidi in presenza di polietilene glicole (PEG), che fornisce un ambiente per la legatura efficiente a verificarsi. Le concatemers dsDNA possono essere utilizzati, a seguito purificazione per estrazione con fenolo / cloroformio, per simulare la risposta immunitaria innata in vitro da protocolli di trasfezione standard. Questo DNA può anche essere utilizzato per stimolare l&#39;immunità innata in vivo mediante iniezione intradermica nel padiglione auricolare di un mouse, per esempio. Dastandardizzare il processo concatemerization e protocolli di stimolazione successivi, l&#39;attivazione affidabile e riproducibile del sistema immunitario innato può essere prodotta.

<html> I risultati seguenti indicano che il DNA concatemerized può essere generato con relativa facilità ed è in grado di stimolare una risposta immunitaria innata robusta nelle cellule e nei topi. Con l&#39;uso di PEG8000, si vede chiaramente che la lunghezza del DNA generato è significativamente più lungo e ugualmente in grado di indurre la trascrizione di CXCL10. Come si vede dalle analisi su gel di agarosio, il concatemerization standard ha lunghezze di DNA di 800 paia di basi (bp), mentre per il campione con PE...

Watch this Scientific Journal Video about Stimulation of Cytoplasmic DNA Sensing Pathways In Vitro and In Vivo at JoVE.com

Stimulation of Cytoplasmic DNA Sensing Pathways In Vitro and In Vivo

L&#39;obiettivo del protocollo è quello di utilizzare metodi ottimali per stimolare i percorsi citoplasmatici rilevamento del DNA in cellule e in vivo. Questo risultato è ottenuto migliorando la generazione di lunga, il DNA a doppio filamento durante blunt-end legatura. Le cellule o topi sono poi transfettate con un reagente di trasfezione lipidico.

La stimolazione dei citoplasmatici DNA Sensing Pathways<em&gt; In Vitro</em&gt; E<em&gt; In Vivo</em

In order to efficiently stimulate an innate immune response, DNA must be of sufficient length and purity. We present a method where double stranded DNA ...

stimulation-of-cytoplasmic-dna-sensing-pathways-in-vitro-and-in-vivo

Research

JoVE Journal

Biology

Stimulation of Cytoplasmic DNA Sensing Pathways In Vitro and In Vivo

8.8K Views.  University of Cambridge.  L'obiettivo del protocollo è quello di utilizzare metodi ottimali per stimolare i percorsi citoplasmatici rilevamento del DNA in cellule e in vivo. Questo risultato è ottenuto migliorando la generazione di lunga, il DNA a doppio filamento durante blunt-end legatura. Le cellule o topi sono poi transfettate con un reagente di trasfezione lipidico. 

Video: Stimulation of Cytoplasmic DNA Sensing Pathways In Vitro and In Vivo

In vitro and in vivo Bioluminescence Reporter Gene Imaging of Human Embryonic Stem Cells

The discovery of human embryonic stem cells (hESCs) has dramatically increased the tools available to medical scientists interested in regenerative medicine. However, direct injection of hESCs, and cells differentiated from hESCs, into living organisms has thus far been hampered by significant cell death, teratoma formation, and host immune rejection. Understanding the in vivo hESC behavior after transplantation requires novel imaging techniques to longitudinally monitor hESC localization, proliferation, and viability. Molecular imaging has given investigators a high-throughput, inexpensive, and sensitive means for tracking in vivo cell proliferation over days, weeks, and even months. This advancement has significantly increased the understanding of the spatio-temporal kinetics of hESC engraftment, proliferation, and teratoma-formation in living subjects.

A major advance in molecular imaging has been the extension of noninvasive reporter gene assays from molecular and cellular biology into in vivo multi-modality imaging platforms. These reporter genes, under control of engineered promoters and enhancers that take advantage of the host cell s transcriptional machinery, are introduced into cells using a variety of vector and non-vector methods. Once in the cell, reporter genes can be transcribed either constitutively or only under specific biological or cellular conditions, depending on the type of promoter used. Transcription and translation of reporter genes into bioactive proteins is then detected with sensitive, noninvasive instrumentation (e.g., CCD cameras) using signal-generating probes such as D-luciferin.

To avoid the need for excitatory light to track stem cells in vivo as is required for fluorescence imaging, bioluminescence reporter gene imaging systems require only an exogenously administered probe to induce light emission. Firefly luciferase, derived from the firefly Photinus pyralis, encodes an enzyme that catalyzes D-luciferin to the optically active metabolite, oxyluciferin. Optical activity can then be monitored with an external CCD camera. Stably transduced cells that carry the reporter construct within their chromosomal DNA will pass the reporter construct DNA to daughter cells, allowing for longitudinal monitoring of hESC survival and proliferation in vivo. Furthermore, because expression of the reporter gene product is required for signal generation, only viable parent and daughter cells will create bioluminescence signal; apoptotic or dead cells will not. 

In this video, the specific materials and methods needed for tracking stem cell proliferation and teratoma formation with bioluminescence imaging will be described.

With the growing interest in stem cell therapies, molecular imaging techniques are ideal for monitoring stem cell behavior after transplantation. Luciferase reporter genes have enabled non-invasive, repetitive assessment of cell survival, location, and proliferation in vivo. This video will demonstrate how to track hESC proliferation in a living mouse.

In vitro e in Imaging bioluminescenza gene reporter in vivo di cellule staminali embrionali umane

The discovery of human embryonic stem cells (hESCs) has dramatically increased the tools available to medical scientists interested in regenerative ...

Ricerca

Biologia

DNA Transfection of Mammalian Skeletal Muscles using In Vivo Electroporation

A growing interest in cell biology is to express transgenically modified forms of essential proteins (e.g. fluorescently tagged constructs and/or mutant variants) in order to investigate their endogenous distribution and functional relevance. An interesting approach that has been implemented to fulfill this objective in fully differentiated cells is the in vivo transfection of plasmids by various methods into specific tissues such as liver1, skeletal muscle2,3, and even the brain4. We present here a detailed description of the steps that must be followed in order to efficiently transfect genetic material into fibers of the flexor digitorum brevis (FDB) and interosseus (IO) muscles of adult mice using an in vivo electroporation approach. The experimental parameters have been optimized so as to maximize the number of muscle fibers transfected while minimizing tissue damages that may impair the quality and quantity of the proteins expressed in individual fibers. We have verified that the implementation of the methodology described in this paper results in a high yield of soluble proteins, i.e. EGFP and ECFP3, calpain, FKBP12, &beta;2a-DHPR, etc. ; structural proteins, i.e. minidystrophin and &alpha;-actinin; and membrane proteins, i.e. &alpha;1s-DHPR, RyR1, cardiac Na/Ca2+ exchanger , NaV1.4 Na channel, SERCA1, etc., when applied to FDB, IO and other muscles of mice and rats. The efficient expression of some of these proteins has been verified with biochemical3 and functional evidence5. However, by far the most common confirmatory approach used by us are standard fluorescent microscopy and 2-photon laser scanning microscopy (TPLSM), which permit to identify not only the overall expression, but also the detailed intracellular localization, of fluorescently tagged protein constructs. The method could be equally used to transfect plasmids encoding for the expression of proteins of physiological relevance (as shown here), or for interference RNA (siRNA) aiming to suppress the expression of normally expressed proteins (not tested by us yet). It should be noted that the transfection of FDB and IO muscle fibers is particularly relevant for the investigation of mammalian muscle physiology since fibers enzymatically dissociated from these muscles are currently one of the most suitable models to investigate basic mechanisms of excitability and excitation-contraction coupling under current or voltage clamp conditions2,6-8.

DNA Transfection of Mammalian Skeletal Muscles using In Vivo Electroporation

We describe detailed procedures for the efficient transfection of plasmid DNA into the fibers of foot muscles of live mice using electroporation and the subsequent visualization of protein expression using fluorescence microscopy.

Transfection DNA dei mammiferi muscoli scheletrici con In Vivo Elettroporazione

 A growing interest in cell biology is to express transgenically modified forms of essential proteins (e.g. fluorescently tagged constructs and/or mutant ...

In vivo and in vitro Studies of Adaptor-clathrin Interaction

A major endocytic pathway initiates with the formation of clathrin-coated vesicles (CCVs) that transport cargo from the cell surface to endosomes1-6. CCVs are distinguished by a polyhedral lattice of clathrin that coats the vesicle membrane and serves as a mechanical scaffold. Clathrin coats are assembled during vesicle formation from individual clathrin triskelia , the soluble form of clathrin composed of three heavy and three light chain subunits7,8. Because the triskelion does not have the ability to bind to the membrane directly, clathrin-binding adaptors are critical to link the forming clathrin lattice to the membrane through association with lipids and/or membrane proteins9. Adaptors also package transmembrane protein cargo, such as receptors, and can interact with each other and with other components of the CCV formation machinery9.
Over twenty clathrin adaptors have been described, several are involved in clathrin mediated endocytosis and others localize to the trans Golgi network or endosomes9. With the exception of HIP1R (yeast Sla2p), all known clathrin adaptors bind to the N-terminal -propeller domain of the clathrin heavy chain9. Clathrin adaptors are modular proteins consisting of folded domains connected by unstructured flexible linkers. Within these linker regions, short binding motifs mediate interactions with the clathrin N-terminal domain or other components of the vesicle formation machinery9. Two distinct clathrin-binding motifs have been defined: the clathrin-box and the W-box9. The consensus clathrin-box sequence was originally defined as L[L/I][D/E/N][L/F][D/E]10 but variants have been subsequently discovered11. The W-box conforms to the sequence PWxxW (where x is any residue).
Sla1p (Synthetic Lethal with Actin binding protein-1) was originally identified as an actin associated protein and is necessary for normal actin cytoskeleton structure and dynamics at endocytic sites in yeast cells12. Sla1p also binds the NPFxD endocytic sorting signal and is critical for endocytosis of cargo bearing the NPFxD signal13,14. More recently, Sla1p was demonstrated to bind clathrin through a motif similar to the clathrin box, LLDLQ, termed a variant clathrin-box (vCB), and to function as an endocytic clathrin adaptor15. In addition, Sla1p has become a widely used marker for the endocytic coat in live cell fluorescence microscopy studies16. Here we use Sla1p as a model to describe approaches for adaptor-clathrin interaction studies. We focus on live cell fluorescence microscopy, GST-pull down, and co-immunoprecipitation methods.

In vivo and in vitro Studies of Adaptor-clathrin Interaction

Clathrin-mediated endocytosis depends on adaptor proteins that coordinate cargo selection and clathrin coat assembly. Here we describe procedures to study adaptor-clathrin physical interaction and live cell imaging approaches using as a model the yeast endocytic adaptor protein Sla1p.

In vivo e in vitro di adattatore-clatrina Interazione

A major endocytic pathway initiates with the formation of clathrin-coated vesicles (CCVs) that transport cargo from the cell surface to endosomes1-6. CCVs ...

Visualization of MG53-mediated Cell Membrane Repair Using in vivo and in vitro Systems

Repair of acute injury to the cell membrane is an elemental process of normal cellular physiology, and defective membrane repair has been linked to many degenerative human diseases. The recent discovery of MG53 as a key component of the membrane resealing machinery allows for a better molecular understanding of the basic biology of tissue repair, as well as for potential translational applications in regenerative medicine. Here we detail the experimental protocols for exploring the in vivo function of MG53 in repair of muscle injury using treadmill exercise protocols on mouse models, for testing the ex vivo membrane repair capacity by measuring dye entry into isolated muscle fibers, and for monitoring the dynamic process of MG53-mediated vesicle trafficking and cell membrane repair in cultured cells using live cell confocal microscopy.

Visualization of MG53-mediated Cell Membrane Repair Using in vivo and in vitro Systems

Described here are protocols used to visualize the dynamic process of MG53-mediated cell membrane repair in whole animals and at the cellular level. These methods can be applied to investigate the cell biology of plasma membrane resealing and regenerative medicine.

Visualizzazione di MG53-mediata di riparazione della membrana cellulare Utilizzando In vivo E In vitro Sistemi

Repair of acute injury to the cell membrane is an elemental process of normal cellular physiology, and defective membrane repair has been linked to many ...

Activation of Apoptosis by Cytoplasmic Microinjection of Cytochrome c

Apoptosis, or programmed cell death, is a conserved and highly regulated pathway by which cells die1. Apoptosis can be triggered when cells encounter a wide range of cytotoxic stresses. These insults initiate signaling cascades that ultimately cause the release of cytochrome c from the mitochondrial intermembrane space to the cytoplasm2. The release of cytochrome c from mitochondria is a key event that triggers the rapid activation of caspases, the key cellular proteases which ultimately execute cell death3-4.
The pathway of apoptosis is regulated at points upstream and downstream of cytochrome c release from mitochondria5. In order to study the post-mitochondrial regulation of caspase activation, many investigators have turned to direct cytoplasmic microinjection of holocytochrome c (heme-attached) protein into cells6-9. Cytochrome c is normally localized to the mitochondria where attachment of a heme group is necessary to enable it to activate apoptosis10-11. Therefore, to directly activate caspases, it is necessary to inject the holocytochrome c protein instead of its cDNA, because while the expression of cytochrome c from cDNA constructs will result in mitochondrial targeting and heme attachment, it will be sequestered from cytosolic caspases. Thus, the direct cytosolic microinjection of purified heme-attached cytochrome c protein is a useful tool to mimic mitochondrial cytochrome c release and apoptosis without the use of toxic insults which cause cellular and mitochondrial damage.
In this article, we describe a method for the microinjection of cytochrome c protein into cells, using mouse embryonic fibroblasts (MEFs) and primary sympathetic neurons as examples. While this protocol focuses on the injection of cytochrome c for investigations of apoptosis, the techniques shown here can also be easily adapted for microinjection of other proteins of interest.

Activation of Apoptosis by Cytoplasmic Microinjection of Cytochrome c

In this protocol, we describe the direct cytoplasmic microinjection of cytochrome c protein into fibroblasts and primary sympathetic neurons. This technique allows for the introduction of cytochrome c protein into the cytoplasm of cells and mimics the release of cytochrome c from mitochondria, which occurs during apoptosis.

Attivazione di apoptosi da Microiniezione citoplasmatici del Citocromo C</em

Apoptosis, or programmed cell death, is a conserved and highly regulated pathway by which cells die1.  Apoptosis can be triggered when cells encounter a ...

Isolation of Ribosome Bound Nascent Polypeptides in vitro to Identify Translational Pause Sites Along mRNA

The rate of translational elongation is non-uniform. mRNA secondary structure, codon usage and mRNA associated proteins may alter ribosome movement on the messagefor review see 1. However, it's now widely accepted that synonymous codon usage is the primary cause of non-uniform translational elongation rates1. Synonymous codons are not used with identical frequency. A bias exists in the use of synonymous codons with some codons used more frequently than others2. Codon bias is organism as well as tissue specific2,3. Moreover, frequency of codon usage is directly proportional to the concentrations of cognate tRNAs4. Thus, a frequently used codon will have higher multitude of corresponding tRNAs, which further implies that a frequent codon will be translated faster than an infrequent one. Thus, regions on mRNA enriched in rare codons (potential pause sites) will as a rule slow down ribosome movement on the message and cause accumulation of nascent peptides of the respective sizes5-8. These pause sites can have functional impact on the protein expression, mRNA stability and protein foldingfor review see 9. Indeed, it was shown that alleviation of such pause sites can alter ribosome movement on mRNA and subsequently may affect the efficiency of co-translational (in vivo) protein folding1,7,10,11. To understand the process of protein folding in vivo, in the cell, that is ultimately coupled to the process of protein synthesis it is essential to gain comprehensive insights into the impact of codon usage/tRNA content on the movement of ribosomes along mRNA during translational elongation.
Here we describe a simple technique that can be used to locate major translation pause sites for a given mRNA translated in various cell-free systems6-8. This procedure is based on isolation of nascent polypeptides accumulating on ribosomes during in vitro translation of a target mRNA. The rationale is that at low-frequency codons, the increase in the residence time of the ribosomes results in increased amounts of nascent peptides of the corresponding sizes. In vitro transcribed mRNA is used for in vitro translational reactions in the presence of radioactively labeled amino acids to allow the detection of the nascent chains. In order to isolate ribosome bound nascent polypeptide complexes the translation reaction is layered on top of 30% glycerol solution followed by centrifugation. Nascent polypeptides in polysomal pellet are further treated with ribonuclease A and resolved by SDS PAGE. This technique can be potentially used for any protein and allows analysis of ribosome movement along mRNA and the detection of the major pause sites. Additionally, this protocol can be adapted to study factors and conditions that can alter ribosome movement and thus potentially can also alter the function/conformation of the protein.

Isolation of Ribosome Bound Nascent Polypeptides in vitro to Identify Translational Pause Sites Along mRNA

A technique to identify translational pause sites on mRNA is described. This procedure is based on isolation of nascent polypeptides accumulating on ribosomes during in vitro translation of a target mRNA, followed by the size analysis of the nascent chains using a denaturing gel electrophoresis.

Isolamento dei ribosomi Polipeptidi Bound nascenti<em&gt; In vitro</em&gt; Per identificare i siti di pausa traslazione lungo mRNA

The rate of translational elongation is non-uniform. mRNA secondary structure, codon usage and mRNA associated proteins may alter ribosome movement on the ...

The c-FOS Protein Immunohistological Detection: A Useful Tool As a Marker of Central Pathways Involved in Specific Physiological Responses In Vivo and Ex Vivo

Many studies seek to identify and map the brain regions involved in specific physiological regulations. The proto-oncogene c-fos, an immediate early gene, is expressed in neurons in response to various stimuli. The protein product can be readily detected with immunohistochemical techniques leading to the use of c-FOS detection to map groups of neurons that display changes in their activity. In this article, we focused on the identification of brainstem neuronal populations involved in the ventilatory adaptation to hypoxia or hypercapnia. Two approaches were described to identify involved neuronal populations in vivo in animals and ex vivo in deafferented brainstem preparations. In vivo, animals were exposed to hypercapnic or hypoxic gas mixtures. Ex vivo, deafferented preparations were superfused with hypoxic or hypercapnic artificial cerebrospinal fluid. In both cases, either control in vivo animals or ex vivo preparations were maintained under normoxic and normocapnic conditions. The comparison of these two approaches allows the determination of the origin of the neuronal activation i.e., peripheral and/or central. In vivo and ex vivo, brainstems were collected, fixed, and sliced into sections. Once sections were prepared, immunohistochemical detection of the c-FOS protein was made in order to identify the brainstem groups of cells activated by hypoxic or hypercapnic stimulations. Labeled cells were counted in brainstem respiratory structures. In comparison to the control condition, hypoxia or hypercapnia increased the number of c-FOS labeled cells in several specific brainstem sites that are thus constitutive of the neuronal pathways involved in the adaptation of the central respiratory drive.

The c-FOS Protein Immunohistological Detection: A Useful Tool As a Marker of Central Pathways Involved in Specific Physiological Responses In Vivo and Ex Vivo

Here, we present a protocol based on c-FOS protein immunohistological detection, a classical technique used for the identification of neuronal populations involved in specific physiological responses in vivo and ex vivo.

La proteina C-FOS immunoistologiche Detection: uno strumento utile come indicatore di percorsi centrali coinvolti nelle risposte fisiologiche specifiche<em&gt; In Vivo</em&gt; e<em&gt; Ex Vivo</em

Many studies seek to identify and map the brain regions involved in specific physiological regulations. The proto-oncogene c-fos, an immediate early gene, ...

Filtration Isolation of Nucleic Acids:  A Simple and Rapid DNA Extraction Method

FINA, filtration isolation of nucleic acids, is a novel extraction method which utilizes vertical filtration via a separation membrane and absorbent pad to extract cellular DNA from whole blood in less than 2 min. The blood specimen is treated with detergent, mixed briefly and applied by pipet to the separation membrane. The lysate wicks into the blotting pad due to capillary action, capturing the genomic DNA on the surface of the separation membrane. The extracted DNA is retained on the membrane during a simple wash step wherein PCR inhibitors are wicked into the absorbent blotting pad. The membrane containing the entrapped DNA is then added to the PCR reaction without further purification. This simple method does not require laboratory equipment and can be easily implemented with inexpensive laboratory supplies. Here we describe a protocol for highly sensitive detection and quantitation of HIV-1 proviral DNA from 100 &#181;l whole blood as a model for early infant diagnosis of HIV that could readily be adapted to other genetic targets.

We describe here a simple and rapid paper-based DNA extraction method of HIV proviral DNA from whole blood detected by quantitative PCR. This protocol can be extended for use in detecting other genetic markers or using alternative amplification methods.

L&#39;isolamento di filtrazione di acidi nucleici: DNA metodo di estrazione semplice e veloce

FINA, filtration isolation of nucleic acids, is a novel extraction method which utilizes vertical filtration via a separation membrane and absorbent pad ...

Glucose Uptake Measurement and Response to Insulin Stimulation in In Vitro Cultured Human Primary Myotubes

Skeletal muscle is the largest glucose deposit in mammals and largely contributes to glucose homeostasis. Assessment of insulin sensitivity of muscle cells is of major relevance for all studies dedicated to exploring muscle glucose metabolism and characterizing metabolic alterations. In muscle cells, glucose transporter type 4 (GLUT4) proteins translocate to the plasma membrane in response to insulin, thus allowing massive entry of glucose into the cell. The ability of muscle cells to respond to insulin by increasing the rate of glucose uptake is one of the standard readouts to quantify muscle cell sensitivity to insulin. Human primary myotubes are a suitable in vitro model, as the cells maintain many features of the donor phenotype, including insulin sensitivity. This in vitro model is also suitable for the test of any compounds that could impact insulin responsiveness. Measurements of the glucose uptake rate in differentiated myotubes reflect insulin sensitivity.
In this method, human primary muscle cells are cultured in vitro to obtain differentiated myotubes, and glucose uptake rates with and without insulin stimulation are measured. We provide a detailed protocol to quantify passive and active glucose transport rates using radiolabeled [3H] 2-deoxy-D-Glucose ([3H]2dG). Calculation methods are provided to quantify active basal and insulin-stimulated rates, as well as stimulation fold.

Glucose Uptake Measurement and Response to Insulin Stimulation in In Vitro Cultured Human Primary Myotubes

In this method, human primary muscle cells are cultured in vitro to obtain differentiated myotubes and glucose uptake rates are measured. We provide a detailed protocol to quantify rates in basal and insulin-stimulated states using radiolabeled [3H] 2-deoxy-D-Glucose.

Misurazione e risposta alla somministrazione di glucosio alla stimolazione dell&#39;insulina in<em&gt; In vitro</em&gt; Myotubes primario umano coltivato

Skeletal muscle is the largest glucose deposit in mammals and largely contributes to glucose homeostasis. Assessment of insulin sensitivity of muscle ...

In Vitro and In Vivo Approaches to Determine Intestinal Epithelial Cell Permeability

The intestinal barrier defends against pathogenic microorganism and microbial toxin. Its function is regulated by tight junction permeability and epithelial cell integrity, and disruption of the intestinal barrier function contributes to progression of gastrointestinal and systemic disease. Two simple methods are described here to measure the permeability of intestinal epithelium. In vitro, Caco-2BBe cells are plated in tissue culture wells as a monolayer and transepithelial electrical resistance (TER) can be measured by an epithelial (volt/ohm) meter. This method is convincing because of its user-friendly operation and repeatability. In vivo, mice are gavaged with 4 kDa fluorescein isothiocyanate (FITC)-dextran, and the FITC-dextran concentrations are measured in collected serum samples from mice to determine the epithelial permeability. Oral gavage provides an accurate dose, and therefore is the preferred method to measure the intestinal permeability in vivo. Taken together, these two methods can measure the permeability of the intestinal epithelium in vitro and in vivo, and hence be used to study the connection between diseases and barrier function.

In Vitro and In Vivo Approaches to Determine Intestinal Epithelial Cell Permeability

Two methods are presented here to determine intestinal barrier function. An epithelial meter (volt/ohm) is used for measurements of transepithelial electrical resistance of cultured epithelia directly in tissue culture wells. In mice, the FITC-dextran gavage method is used to determine the intestinal permeability in vivo.