Die Autoren haben keine Bestätigungen.

1. Concatemerisierungsreaktion <ol><li> Resuspendieren Primer Fw und Rv (siehe Tabelle der Materialien für die Primer-Sequenzen) zu einer Konzentration von 10 ug / ul in die Molekularbiologie H 2 O. Dann mischen 5 ul FW und 5 ul Primer Rv in einem 1,5 ml Mikrozentrifugenröhrchen. </li><li> Glühen Zündmittelmischung durch Erhitzen auf die richtige Anlagerungstemperatur (75 ° C für die hier beschriebenen Primer) für 15 min. Lassen Sie auf der Bank, um bei Raumtemperatur (RT) abkühlen. Bereiten Sie den 60% PEG8000 während dieser Inkubationszeit durch Lösen in ddH 2 O. </li><li> Dann werden 50 ul 60% PEG8000, 10 ul 10x-Polynukleotid-Kinase (PNK)-Puffer, 27 ul H 2 O und 3 ul PNK auf die Primergemisch (zu einer Endkonzentration von 30% zu erreichen). Bei 37 ° C für 2 Stunden. </li><li> Abkühlen bei RT und fügen Sie 11 ul der DNA-Ligase-Puffer. Dann fügen Sie 3 U-DNA-Ligase und bei 37 ° C über Nacht. </li></ol> 2. DNA Purificationund Analyse <ol><li> Werden 300 ul H 2 O auf das Volumen des Ligationsgemisches zu erhöhen. Hinweis: Gehen Sie in einem Abzug wegen der Giftigkeit von Phenol: Chloroform Dampf. </li><li> 1 Volumen (400 ul) Phenol: Chloroform und durch kräftiges Schütteln mischen. </li><li> Zentrifuge bei max Geschwindigkeit für 1 min in einer Tischmikrozentrifuge. Die wässrigen und Lösungsmittelschichten mit der wässrigen Schicht auf der Oberseite und eine weiße Schicht des gefällten Proteins zwischen den zwei Schichten zu trennen. </li><li> Übertragen obere Schicht in ein neues Röhrchen durch sorgfältige Pipettieren (Vermeidung der Übertragung Mitte, weiße Schicht) </li><li> Wiederholen Sie die Schritte 2.2 und 2.3 mindestens zweimal oder bis keine ausgefällte Protein nach Zentrifugation. </li><li> 1 Volumen (400 ul) von Chloroform und wiederholen Sie die Schritte 2.3-2.4. </li><li> Add 2 Volumina (800 ul) von 100% vorgekühltem Ethanol und Inkubation bei -20 ° C für mindestens 1 h oder über Nacht. Hinweis: Dieser Schritt fällt die DNA Concatemeren. </li><li> Spin-Down bei max Geschwindigkeit und saugen Supernatant. Einmal zu waschen durch Zugabe von 1 ml 70% Ethanol und an der Luft trocknen in Abzug. </li><li> Resuspendieren DNA in 50 ul endotoxinfrei ddH 2 O. Anmerkung: Die Verwendung von Endotoxin freien Reagenzien ist für die Erzeugung eines DNA-spezifischen angeborene Immunantwort in Zellen und in vivo. </li><li> Entfernen Sie ein 2 ul Aliquot der DNA in concatemerized ein frisches Röhrchen und 1 ml DNA-Gel-Ladepuffer. </li><li> Man löst 1% Agarose in TAE-Puffer durch Erhitzen bei voller Leistung in einem Mikrowellenofen für 2 Minuten (oder die Zeit, die angemessen auf die Leistung des Ofens und Volumen). </li><li> Gießen Gel in Gussvorrichtung, fügen Sie 4 ul fluoreszierenden DNA-Chelat-Farbstoff, legen Sie einen Kamm, und bei Raumtemperatur für ca. 20 min für das Gel gesetzt. </li><li> Einmal eingestellt, nehmen Sie den Kamm und Ort Gel in Elektrophorese Tank mit TAE-Puffer. Last 3 ul DNA-Probe oder Größenmarker in die Vertiefungen. </li><li> Führen Gelelektrophorese für 30-40 min bei 90 V mit Konstantstrom. Visualize die DNA unter UV-Licht, um Concatemerisierungsreaktion (Abbildung 1A) zu beobachten. </li><li> Messung der DNA-Konzentration in dem Rest der Probe, die durch UV-Absorptionsspektroskopie. Blank das Spektrometer mit dem gleichen ddH2O, die verwendet wurde, um die DNA zu suspendieren und messen das Absorptionsspektrum von 200 bis 300 nm auf. HINWEIS: DNA-Konzentration kann mit Hilfe des Lambert-Beer-Gesetz, A = e * c * l, wobei A die Absorption berechnet werden, e die Extinktionskoeffizienten und l den Abstand des Lichtweges. Zur Messung der DNA-Konzentration die Absorption bei 260 nm zu messen und einen Extinktionskoeffizienten von 0,027 (g / ml) -1 cm -1 verwendet. Der Lichtweg Abstand L in Abhängigkeit von dem Spektrophotometer unterschiedlich. Während die Messung der Konzentration, nehmen die 260/280 nm Absorptionsverhältnis als Hinweis auf DNA-Reinheit; ein Wert für dieses Verhältnis von über 2,00 wird empfohlen. </li></ol> 3. Die Transfektion von dsDNA Concatemeren In Vitro <ol><li> Samenzellen in einer Gewebekulturschale oder eine Platte zu 70% konfluenten zum Zeitpunkt der Stimulation. </li><li> Berechnen der Masse der DNA für die Stimulation der Zellen mit einer Endkonzentration von 1-10 ug / ml erforderlich. Die erforderliche Masse der DNA wird als X unten angegeben werden. Zum Beispiel, wenn stimulierenden Zellen in einer einzelnen Vertiefung einer Platte mit 6 Vertiefungen mit 2 ml Medium in einer Konzentration von 5 ug DNA / ml, dann einer Masse von 2 * 5 = 10 ug der DNA erforderlich ist. </li><li> Geben Sie 50 * X ul Serum freien Medium in eine geeignete Größe sterilen Röhrchen. Pipette vorsichtig in der Mitte des Mediums, ohne Berührung der Seite des Rohres, 2 * X ul kationische Lipid Transfektionsreagenz und lassen für 5 min. </li><li> Fügen X ug DNA in die Röhre und kurz vortexen. Lassen bei RT für mindestens 20 min. Für die in vitro-Transfektion diese Mischung direkt an Zellen zytoplasmatische DNA Messwege zu stimulieren. </li></ol> 4. Die Transfektion von dsDNA Concatemeren ichn Vivo <ol><li> Bereiten Transfektionsmischung wie in 3.1-3.5 mit 1 pg DNA, 2 ul Lipid Transfektionsreagenz und 18 ul Serum freien Medium pro Maus Ohr stimuliert werden beschrieben. Bereiten Sie eine sterile 20 ul Hamilton-Spritze, Kappe mit einer sterilen Nadel 30 G, und laden Sie mit der DNA-Transfektion Mix. </li><li> Betäuben einen C57BL / 6 Maus mit 1-2% Isofluran. Anästhesie bestätigen Verlust der Bewegung und konstanter Atemfrequenz und durch Pinch-Reflex-Test, wenn nötig. Augen Tieres während der Narkose zu überwachen und zu verwenden Salbe wie erforderlich, um übermäßige Trockenheit zu vermeiden. </li><li> Verwendung einer sterilen Technik injizieren vorsichtig in die Ohrmuschel 10 ul der Transfektionsgemisch so daß eine einzige &quot;Blase&quot; von Flüssigkeit zwischen den Hautschichten des Ohres gebildet ist. Hinweis: Verwenden Sie eine Gummihülse auf dem Daumen oder Zeigefinger strecken das Ohr über sie, und injizieren in einem spitzen Winkel, um sicherzustellen, die Nadel dringt nur die erste Schicht der Haut der Ohrmuschel. </li><li> Reintroduce Maus wieder in den Käfig und regelmäßig zu überwachen Post-Aufwachraum. Verwenden Sie eine Wärmelampe, um übermäßige Kühlung der narkotisierten Mäusen zu vermeiden. Mäuse nicht unbeaufsichtigt lassen, bis sie das Bewusstsein wiedererlangt, um ausreichend Brustlage zu halten. </li><li> Flash frieren die ganze Ohrmuschel in ein Mikrozentrifugenröhrchen durch in flüssigem Stickstoff für 2 Minuten eingetaucht. </li></ol> 5. Die Verarbeitung von DNA-Proben und Stimulated Analyse durch quantitative PCR (qPCR) <ol><li> Von der Zellkultur: absaugen Medium mit einer Pipette und entsorgen Abfälle. </li><li> 1 ml sterilem PBS. 5.1 und 5.2 wiederholen zweimal und gehen Sie zu Schritt 5.3 </li><li> Von Ohrgewebe: schleifen Gewebe unter flüssigem Stickstoff mit sterilen Keramik Mörser und Stößel, Transfer Grundgewebe, um ein Mikrozentrifugenröhrchen mit einem sterilen Spatel und gehen Sie zu Schritt 5.4 </li><li> Fügen Sie 350 ul Lysepuffer und fahren mit kommerziellen RNA-Extraktions-Kits Protokoll. Eluieren RNA-Extraktions-Kits von ReinigungsSäule in 40 ul ddH 2 O. Hinweis: Die kommerzielle RNA-Extraktion-Kit (siehe Materialien / Geräte-Tabelle) funktioniert sehr gut; andere Techniken haben mit unterdurchschnittlich Ergebnissen getestet. </li><li> Quantifizieren RNA durch UV-Spektroskopie, wie für die DNA-oben (Abschnitt 2.13) beschrieben. Hinweis: Der Extinktionskoeffizient für RNA 0,025 (g / ml) -1 cm -1. </li><li> In den sterile PCR-Röhrchen 1 ul Oligo (dT)-Primer, 1 ul 10 mM dNTP-Mischung und 250 ug RNA. Stellen Sie die Lautstärke auf 11 ul mit sterilem ddH 2 O. </li><li> Inkubation für 5 min bei 65 ° C aufweist. Dann fügen Sie 4 ul First Strand Buffer, 1 ul 0,1 M Dithiothreitol, 0,25 ul reverse Transkriptase und 1,75 ul ddH 2 O, um die Röhre. Inkubieren bei 50 ° C für 1 h, gefolgt von 72 ° C für 15 min. Optional, verdünnte cDNA Produkt 1: 5 mit ddH 2 O. </li><li> Für die quantitative PCR Verwendung 2 ul cDNA, 2 ul ddH 2 O, 5 ul qPCR Master Mix, und 1ul jeweils von 10 uM vorwärts und rückwärts Primer Bestände Gen (e) der Wahl zu verstärken. Mix in eine 96-Well-Platte und analysieren mit Hilfe eines quantitativen PCR-Maschine (1B und 1C). </li></ol>

<ol>
	<li>Yoshida, H., Okabe, Y., Kawane, K., Fukuyama, H., Nagata, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Lethal+anemia+caused+by+interferon-beta+produced+in+mouse+embryos+carrying+undigested+DNA.">Lethal anemia caused by interferon-beta produced in mouse embryos carrying undigested DNA.</a> Nat. Immunol. 6, 49-56 (2005).</li><li>Ishikawa, H., Ma, Z., Barber, G. N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=STING+regulates+intracellular+DNA-mediated,+type+I+interferon-dependent+innate+immunity.">STING regulates intracellular DNA-mediated, type I interferon-dependent innate immunity.</a> Nature. 461, 788-792 (2009).</li><li>Ishii, K. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=TANK-binding+kinase-1+delineates+innate+and+adaptive+immune+responses+to+DNA+vaccines.">TANK-binding kinase-1 delineates innate and adaptive immune responses to DNA vaccines.</a> Nature. 451, 725-729 (2008).</li><li>Stetson, D. B., Medzhitov, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Recognition+of+cytosolic+DNA+activates+an+IRF3-dependent+innate+immune+response.">Recognition of cytosolic DNA activates an IRF3-dependent innate immune response.</a> Immunity. 24, 93-103 (2006).</li><li>Pichlmair, A., Reise Sousa, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Innate+recognition+of+viruses.">Innate recognition of viruses.</a> Immunity. 27, 370-383 (2007).</li><li>Unterholzner, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=IFI16+is+an+innate+immune+sensor+for+intracellular+DNA.">IFI16 is an innate immune sensor for intracellular DNA.</a> Nat. Immunol. 11, 997-1004 (2010).</li><li>Ferguson, B. J., Mansur, D. S., Peters, N. E., Ren, H., Smith, G. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=DNA-PK+is+a+DNA+sensor+for+IRF-3-dependent+innate+immunity.">DNA-PK is a DNA sensor for IRF-3-dependent innate immunity.</a> Elife. 1, e00047 (2012).</li><li>Sun, L., Wu, J., Du, F., Chen, X., Chen, Z. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cyclic+GMP-AMP+synthase+is+a+cytosolic+DNA+sensor+that+activates+the+type+I+interferon+pathway.">Cyclic GMP-AMP synthase is a cytosolic DNA sensor that activates the type I interferon pathway.</a> Science. 339, 786-791 (2013).</li><li>Honda, K., Taniguchi, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=IRFs:+master+regulators+of+signalling+by+Toll-like+receptors+and+cytosolic+pattern-recognition+receptors.">IRFs: master regulators of signalling by Toll-like receptors and cytosolic pattern-recognition receptors.</a> Nat. Rev. Immunol. 6, 644-658 (2006).</li><li>Karayel, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+TLR-independent+DNA+recognition+pathway+in+murine+macrophages:+Ligand+features+and+molecular+signature.">The TLR-independent DNA recognition pathway in murine macrophages: Ligand features and molecular signature.</a> Eur. J. Immunol. 39, 1929-1936 (2009).</li></ol>

The authors have nothing to disclose.

Die hier beschriebenen Protokolle werden verwendet, um dsDNA zu erzeugen, um die cytosolische angeborenen Immunantwort mit reproduzierbaren Ergebnissen in einer Vielzahl von Zelltypen in vivo zu stimulieren. Da das Hauptsubstrat Reagenz verwendet wird, ist ein synthetisches Oligonukleotid, es ist die Flexibilität dieses Systems für die alternative DNA-Sequenzen oder chemische Modifikationen. Es ist möglich, zum Beispiel, um die in diesem Protokoll mit einem, der eine Fluoreszenzmarkierung oder ein Biotin-Ein...

DNA ist ein wichtiger Bestandteil aller Organismen und Zellen, die Eukaryoten halten in bestimmten Fächern. Eine Funktion des angeborenen Immunsystems ist es, festzustellen, wann solche Kompartimentierung bricht oder wenn Fremdkörper in den Organismus über eine Verletzung der körperlichen, externe Barrieren eingeführt. Im menschlichen Körper gibt es eine Reihe von Proteinen, zu helfen verschlechtern kleinen DNA-Mengen, die die korrekte Kompartimentierung entweichen kann existieren; DNAse I, II, und III brechen DNA im Plasma, Endosomen und Cytosol sind. Es hat sich jedoch gezeigt, dass Mäuse ohne DNAse II sterben an schweren Anämie, die durch übermäßige Produktion von Interferonen 1 was darauf hindeutet, dass verursacht das angeborene Immunsystem reagiert auf Extra-Kern-DNA. Diese Reaktion tritt auch in Mäusen, die in Toll-like-Rezeptor-Signal Kapazität völlig unzulänglich sind. Zahlreiche Studien haben jetzt, dass Stimulator der Interferon-Gene (STING) 2 und TANK-binding kinase 1 (TB gezeigtK1) 3 in der Detektion von DNA in das Cytoplasma und dass dieser Signalweg aktiviert, Interferon Regulatory Factor (IRF) -3 4 beteiligt. Die anschließende IRF3-abhängige Transkription von Zytokin-Chemokin-und Interferon-Gene ist charakteristisch für einen angeborenen Immunantwort, entweder einen Erreger oder Gefahr assoziierte molekulare Muster (PAMP oder DAMP) 5. Der Wunsch, die intrazelluläre Signalwege Nucleinsäuredetektion Studie hat zu der Forderung geführt, um robuste und reproduzierbare Verfahren zur Stimulierung Zellen durch die Einführung von DNA oder RNA in Zellen ohne Aktivierung anderen angeborenen Immunantwort zu entwickeln. Eine Methode, durch die der Sting / TBK1 / IRF3 Wegs stimuliert werden kann durch Verwendung von kationischen Lipid-Transfektionsreagenzien Nukleinsäure in das Cytoplasma, wo sie von DNA-Sensoren, wie DNA-PK, IFI16 und CGAS 6-8 zugänglich zu liefern. Die Eigenschaften der DNA, die derzeit verstanden werden eff ermöglicheniziente Aktivierung der cytoplasmatischen angeborenen Immunantwort ohne Stimulation anderer Wege sind die Länge, Masse, Reinheit und das Fehlen von CpG-Motiven 4,7,9. Synthetische Oligonukleotide eignen sich für die Zwecke der Erzeugung einer angeborenen Immunantwort, wie sie es dem DNA-Sequenz optimiert und als reine chemische Spezies hergestellt werden. Ein 45-Basenpaar-immunstimulatorischen DNA (ISD)-Sequenz wurde durch Stetson et al. 4 als geeignetes, CpG-freie Sequenz für diesen Zweck identifiziert. Diese dsDNA-Sequenz ist ansonsten zufällig und hat keine spezifischen Funktionen, die über ihren Mangel an CpG-Motive. Wir haben gefunden, daß durch concatemerizing ISD Oligonukleotids in deutlich längeren Stränge erhöht die Größe der Stimulations 7. Generation von concatemerized ISD ist daher nützlich für die Förderung einer zytoplasmatischen angeborenen Immunantwort. Hier präsentieren wir Protokolle zur Herstellung dieses Reagenz und wie sie verwendet werden, um die DNA Messweges in aktivierenvitro als auch in vivo. HINWEIS: Alle Tierversuche genehmigt werden unter institutionellen Protokolle und Tierpflege-Richtlinien durchgeführt.

<table border="0" cellpadding="0" cellspacing="0" width="1066">
	<tbody>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">Forward Primer</td>
			<td style="width:221px;">Integrated DNA technologies</td>
			<td style="width:144px;">n/a</td>
			<td style="width:407px;">TACAGATCTACTAGTGATCTATGACTGATCTGTACATGATCTACA</td>
		</tr>
		<tr height="19">
			<td height="19" style="height:19px;width:295px;">Reverse Primer</td>
			<td style="width:221px;">Integrated DNA technologies</td>
			<td style="width:144px;">n/a</td>
			<td>TGTAGATCATGTACAGATCAGTCATAGATCACTAGTAGATCTGTA</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">PEG8000</td>
			<td style="width:221px;">Sigma-Aldrich</td>
			<td style="width:144px;">P-4463</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">Molecular biology grade water</td>
			<td style="width:221px;">Sigma-Aldrich</td>
			<td style="width:144px;">W4502-1L</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">T4 Polynucleotide Kinase</td>
			<td style="width:221px;">Promega</td>
			<td style="width:144px;">M4101</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">T4 DNA Ligase</td>
			<td style="width:221px;">Promega</td>
			<td style="width:144px;">M1801</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">Phenol:Chloroform</td>
			<td style="width:221px;">Fisher Chemical</td>
			<td style="width:144px;">BPE1752p-400</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">Chloroform</td>
			<td style="width:221px;">Fisher Chemical</td>
			<td style="width:144px;">C/4960/PB08</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">Ethanol</td>
			<td style="width:221px;">Sigma-Aldrich</td>
			<td style="width:144px;">32221-2.5L</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">DNA gel loading buffer</td>
			<td style="width:221px;">New England biolabs</td>
			<td style="width:144px;">B7021S</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">Agarose</td>
			<td style="width:221px;">Bioline</td>
			<td style="width:144px;">BIO-41025</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">Optimem</td>
			<td style="width:221px;">Life Technologies</td>
			<td style="width:144px;">11058021</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">TransIT-LT1&#160;</td>
			<td style="width:221px;">Mirus Bioscience</td>
			<td style="width:144px;">MIR 2300</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">Hamilton Syringe</td>
			<td style="width:221px;">Hamilton</td>
			<td style="width:144px;">80901 Model 1705</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">30G needles&#160;</td>
			<td style="width:221px;">BD bioscience</td>
			<td style="width:144px;">304000</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">SYBR Safe DNA gel stain</td>
			<td style="width:221px;">Life Technologies</td>
			<td style="width:144px;">S33102</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">Rneasy Plus Mini Kit</td>
			<td style="width:221px;">Qiagen</td>
			<td style="width:144px;">74134</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">Oligo(dT) primer</td>
			<td style="width:221px;">Thermo Scientific</td>
			<td style="width:144px;">SO131</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">dNTP mix</td>
			<td style="width:221px;">Fermentas</td>
			<td style="width:144px;">R0192</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">Super Script III reverse transcriptase</td>
			<td style="width:221px;">Life Technologies</td>
			<td align="right" style="width:144px;">56575</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">First strand cDNA synthesis buffer</td>
			<td style="width:221px;">Life Technologies</td>
			<td style="width:144px;">y02321</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">SybrGreen qPCR Fast master mix</td>
			<td style="width:221px;">Applied Biosystems</td>
			<td align="right" style="width:144px;">4385612</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">cxcl10 murine forward primer&#160;</td>
			<td style="width:221px;">Integrated DNA technologies</td>
			<td style="width:144px;">n/a</td>
			<td>ACTGCATCCATATCGATGAC</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">cxcl10 murine reverse primer</td>
			<td style="width:221px;">Integrated DNA technologies</td>
			<td style="width:144px;">n/a</td>
			<td>TTCATCGTGGCAATGATCTC</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">il6 murine forward primer&#160;</td>
			<td style="width:221px;">Integrated DNA technologies</td>
			<td style="width:144px;">n/a</td>
			<td>GTAGCTATGGTACTCCAGAAGAC</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">il6 murine forward primer&#160;</td>
			<td style="width:221px;">Integrated DNA technologies</td>
			<td style="width:144px;">n/a</td>
			<td>GTAGCTATGGTACTCCAGAAGAC</td>
		</tr>
	</tbody>
</table>

stimulation of cytoplasmic dna sensing pathways in vitro and in vivo

Um effizient eine angeborene Immunantwort zu stimulieren, müssen DNA von ausreichender Länge und Reinheit sein. Wir stellen ein Verfahren, bei dem Doppelstrang-DNA (dsDNA), das die erforderlichen Eigenschaften hat, um die cytoplasmatischen DNA Erfassungswege kann kostengünstig und mit Leichtigkeit erzeugt werden stimulieren. Vom Concatemerisierungsreaktion von kurzen, synthetischen Oligonukleotiden (die CpG-Motive fehlen), können dsDNA erzeugt werden, um eine ausreichende Länge aufweisen, um die cytosolische DNA Erfassungspfad zu aktivieren. Dieses Protokoll beinhaltet Ligation stumpfer Enden der Oligonukleotide in Gegenwart von Polyethylenglykol (PEG), der eine Umgebung für effiziente Ligation statt bietet. Die dsDNA Concatemeren verwendet werden kann, nach der Reinigung durch Phenol / Chloroform-Extraktion, um die angeborene Immunantwort in vitro durch Standard Transfektionsprotokolle simulieren. Diese DNA kann auch verwendet werden, um angeborene Immunität in vivo durch intradermale Injektion in die Ohrmuschel der Maus zu stimulieren, zum Beispiel. DurchStandardisierung der Concatemerisierungsreaktion Prozess und die anschließende Stimulationsprotokolle kann eine zuverlässige und reproduzierbare Aktivierung des angeborenen Immunsystems produziert werden.

<html> Die Ergebnisse zeigen, dass unter concatemerized DNA relativ leicht erzeugt werden kann und fähig ist, die Stimulierung eine robuste angeborene Immunantwort in Zellen und in Mäusen. Mit der Verwendung von PEG8000 ist deutlich zu sehen, daß die Länge der DNA erzeugt wird, wesentlich länger ist und gleich zu induzieren Transkription von CXCL10. Wie durch Agarose-Gel-Analyse ersichtlich, weist die Standard Concatemerisierungsreaktion Längen der DNA bis zu 800 Basenpaaren (bp), während bei der Probe mit PEG8000...

Watch this Scientific Journal Video about Stimulation of Cytoplasmic DNA Sensing Pathways In Vitro and In Vivo at JoVE.com

Stimulation of Cytoplasmic DNA Sensing Pathways In Vitro and In Vivo

Das Ziel des Protokolls ist es, die optimalen Methoden zur Stimulierung der cytoplasmatischen DNA Erfassungswege in Zellen und in vivo zu verwenden. Dies wird durch die Verbesserung der Erzeugung von langen, doppelsträngigen DNA während blunt-end Ligation erreicht. Zellen oder Mäuse werden dann unter Verwendung einer Lipid Transfektionsreagenz transfiziert.

Stimulation der DNA-Sensing Zytoplasmatische Pathways<em&gt; In-vitro-</em&gt; Und<em&gt; In Vivo</em

In order to efficiently stimulate an innate immune response, DNA must be of sufficient length and purity. We present a method where double stranded DNA ...

stimulation-of-cytoplasmic-dna-sensing-pathways-in-vitro-and-in-vivo

Research

JoVE Journal

Biology

Stimulation of Cytoplasmic DNA Sensing Pathways In Vitro and In Vivo

8.8K Aufrufe.  University of Cambridge.  Das Ziel des Protokolls ist es, die optimalen Methoden zur Stimulierung der cytoplasmatischen DNA Erfassungswege in Zellen und in vivo zu verwenden. Dies wird durch die Verbesserung der Erzeugung von langen, doppelsträngigen DNA während blunt-end Ligation erreicht. Zellen oder Mäuse werden dann unter Verwendung einer Lipid Transfektionsreagenz transfiziert. 

Serie: Stimulation of Cytoplasmic DNA Sensing Pathways In Vitro and In Vivo

In vitro and in vivo Bioluminescence Reporter Gene Imaging of Human Embryonic Stem Cells

The discovery of human embryonic stem cells (hESCs) has dramatically increased the tools available to medical scientists interested in regenerative medicine. However, direct injection of hESCs, and cells differentiated from hESCs, into living organisms has thus far been hampered by significant cell death, teratoma formation, and host immune rejection. Understanding the in vivo hESC behavior after transplantation requires novel imaging techniques to longitudinally monitor hESC localization, proliferation, and viability. Molecular imaging has given investigators a high-throughput, inexpensive, and sensitive means for tracking in vivo cell proliferation over days, weeks, and even months. This advancement has significantly increased the understanding of the spatio-temporal kinetics of hESC engraftment, proliferation, and teratoma-formation in living subjects.

A major advance in molecular imaging has been the extension of noninvasive reporter gene assays from molecular and cellular biology into in vivo multi-modality imaging platforms. These reporter genes, under control of engineered promoters and enhancers that take advantage of the host cell s transcriptional machinery, are introduced into cells using a variety of vector and non-vector methods. Once in the cell, reporter genes can be transcribed either constitutively or only under specific biological or cellular conditions, depending on the type of promoter used. Transcription and translation of reporter genes into bioactive proteins is then detected with sensitive, noninvasive instrumentation (e.g., CCD cameras) using signal-generating probes such as D-luciferin.

To avoid the need for excitatory light to track stem cells in vivo as is required for fluorescence imaging, bioluminescence reporter gene imaging systems require only an exogenously administered probe to induce light emission. Firefly luciferase, derived from the firefly Photinus pyralis, encodes an enzyme that catalyzes D-luciferin to the optically active metabolite, oxyluciferin. Optical activity can then be monitored with an external CCD camera. Stably transduced cells that carry the reporter construct within their chromosomal DNA will pass the reporter construct DNA to daughter cells, allowing for longitudinal monitoring of hESC survival and proliferation in vivo. Furthermore, because expression of the reporter gene product is required for signal generation, only viable parent and daughter cells will create bioluminescence signal; apoptotic or dead cells will not. 

In this video, the specific materials and methods needed for tracking stem cell proliferation and teratoma formation with bioluminescence imaging will be described.

With the growing interest in stem cell therapies, molecular imaging techniques are ideal for monitoring stem cell behavior after transplantation. Luciferase reporter genes have enabled non-invasive, repetitive assessment of cell survival, location, and proliferation in vivo. This video will demonstrate how to track hESC proliferation in a living mouse.

In vitro und in vivo Biolumineszenz Reporter Gene Imaging von humanen embryonalen Stammzellen

The discovery of human embryonic stem cells (hESCs) has dramatically increased the tools available to medical scientists interested in regenerative ...

Forschung

Biologie

DNA Transfection of Mammalian Skeletal Muscles using In Vivo Electroporation

A growing interest in cell biology is to express transgenically modified forms of essential proteins (e.g. fluorescently tagged constructs and/or mutant variants) in order to investigate their endogenous distribution and functional relevance. An interesting approach that has been implemented to fulfill this objective in fully differentiated cells is the in vivo transfection of plasmids by various methods into specific tissues such as liver1, skeletal muscle2,3, and even the brain4. We present here a detailed description of the steps that must be followed in order to efficiently transfect genetic material into fibers of the flexor digitorum brevis (FDB) and interosseus (IO) muscles of adult mice using an in vivo electroporation approach. The experimental parameters have been optimized so as to maximize the number of muscle fibers transfected while minimizing tissue damages that may impair the quality and quantity of the proteins expressed in individual fibers. We have verified that the implementation of the methodology described in this paper results in a high yield of soluble proteins, i.e. EGFP and ECFP3, calpain, FKBP12, &beta;2a-DHPR, etc. ; structural proteins, i.e. minidystrophin and &alpha;-actinin; and membrane proteins, i.e. &alpha;1s-DHPR, RyR1, cardiac Na/Ca2+ exchanger , NaV1.4 Na channel, SERCA1, etc., when applied to FDB, IO and other muscles of mice and rats. The efficient expression of some of these proteins has been verified with biochemical3 and functional evidence5. However, by far the most common confirmatory approach used by us are standard fluorescent microscopy and 2-photon laser scanning microscopy (TPLSM), which permit to identify not only the overall expression, but also the detailed intracellular localization, of fluorescently tagged protein constructs. The method could be equally used to transfect plasmids encoding for the expression of proteins of physiological relevance (as shown here), or for interference RNA (siRNA) aiming to suppress the expression of normally expressed proteins (not tested by us yet). It should be noted that the transfection of FDB and IO muscle fibers is particularly relevant for the investigation of mammalian muscle physiology since fibers enzymatically dissociated from these muscles are currently one of the most suitable models to investigate basic mechanisms of excitability and excitation-contraction coupling under current or voltage clamp conditions2,6-8.

DNA Transfection of Mammalian Skeletal Muscles using In Vivo Electroporation

We describe detailed procedures for the efficient transfection of plasmid DNA into the fibers of foot muscles of live mice using electroporation and the subsequent visualization of protein expression using fluorescence microscopy.

DNA Transfektion von Säuger Skelettmuskulatur mit In Vivo Elektroporation

 A growing interest in cell biology is to express transgenically modified forms of essential proteins (e.g. fluorescently tagged constructs and/or mutant ...

In vivo and in vitro Studies of Adaptor-clathrin Interaction

A major endocytic pathway initiates with the formation of clathrin-coated vesicles (CCVs) that transport cargo from the cell surface to endosomes1-6. CCVs are distinguished by a polyhedral lattice of clathrin that coats the vesicle membrane and serves as a mechanical scaffold. Clathrin coats are assembled during vesicle formation from individual clathrin triskelia , the soluble form of clathrin composed of three heavy and three light chain subunits7,8. Because the triskelion does not have the ability to bind to the membrane directly, clathrin-binding adaptors are critical to link the forming clathrin lattice to the membrane through association with lipids and/or membrane proteins9. Adaptors also package transmembrane protein cargo, such as receptors, and can interact with each other and with other components of the CCV formation machinery9.
Over twenty clathrin adaptors have been described, several are involved in clathrin mediated endocytosis and others localize to the trans Golgi network or endosomes9. With the exception of HIP1R (yeast Sla2p), all known clathrin adaptors bind to the N-terminal -propeller domain of the clathrin heavy chain9. Clathrin adaptors are modular proteins consisting of folded domains connected by unstructured flexible linkers. Within these linker regions, short binding motifs mediate interactions with the clathrin N-terminal domain or other components of the vesicle formation machinery9. Two distinct clathrin-binding motifs have been defined: the clathrin-box and the W-box9. The consensus clathrin-box sequence was originally defined as L[L/I][D/E/N][L/F][D/E]10 but variants have been subsequently discovered11. The W-box conforms to the sequence PWxxW (where x is any residue).
Sla1p (Synthetic Lethal with Actin binding protein-1) was originally identified as an actin associated protein and is necessary for normal actin cytoskeleton structure and dynamics at endocytic sites in yeast cells12. Sla1p also binds the NPFxD endocytic sorting signal and is critical for endocytosis of cargo bearing the NPFxD signal13,14. More recently, Sla1p was demonstrated to bind clathrin through a motif similar to the clathrin box, LLDLQ, termed a variant clathrin-box (vCB), and to function as an endocytic clathrin adaptor15. In addition, Sla1p has become a widely used marker for the endocytic coat in live cell fluorescence microscopy studies16. Here we use Sla1p as a model to describe approaches for adaptor-clathrin interaction studies. We focus on live cell fluorescence microscopy, GST-pull down, and co-immunoprecipitation methods.

In vivo and in vitro Studies of Adaptor-clathrin Interaction

Clathrin-mediated endocytosis depends on adaptor proteins that coordinate cargo selection and clathrin coat assembly. Here we describe procedures to study adaptor-clathrin physical interaction and live cell imaging approaches using as a model the yeast endocytic adaptor protein Sla1p.

In vivo und in vitro Studien zur Adapter-Clathrin Interaction

A major endocytic pathway initiates with the formation of clathrin-coated vesicles (CCVs) that transport cargo from the cell surface to endosomes1-6. CCVs ...

Visualization of MG53-mediated Cell Membrane Repair Using in vivo and in vitro Systems

Repair of acute injury to the cell membrane is an elemental process of normal cellular physiology, and defective membrane repair has been linked to many degenerative human diseases. The recent discovery of MG53 as a key component of the membrane resealing machinery allows for a better molecular understanding of the basic biology of tissue repair, as well as for potential translational applications in regenerative medicine. Here we detail the experimental protocols for exploring the in vivo function of MG53 in repair of muscle injury using treadmill exercise protocols on mouse models, for testing the ex vivo membrane repair capacity by measuring dye entry into isolated muscle fibers, and for monitoring the dynamic process of MG53-mediated vesicle trafficking and cell membrane repair in cultured cells using live cell confocal microscopy.

Visualization of MG53-mediated Cell Membrane Repair Using in vivo and in vitro Systems

Described here are protocols used to visualize the dynamic process of MG53-mediated cell membrane repair in whole animals and at the cellular level. These methods can be applied to investigate the cell biology of plasma membrane resealing and regenerative medicine.

Visualisierung der MG53-vermittelte Cell Membrane Repair mit In vivo Und In-vitro- Systems

Repair of acute injury to the cell membrane is an elemental process of normal cellular physiology, and defective membrane repair has been linked to many ...

Activation of Apoptosis by Cytoplasmic Microinjection of Cytochrome c

Apoptosis, or programmed cell death, is a conserved and highly regulated pathway by which cells die1. Apoptosis can be triggered when cells encounter a wide range of cytotoxic stresses. These insults initiate signaling cascades that ultimately cause the release of cytochrome c from the mitochondrial intermembrane space to the cytoplasm2. The release of cytochrome c from mitochondria is a key event that triggers the rapid activation of caspases, the key cellular proteases which ultimately execute cell death3-4.
The pathway of apoptosis is regulated at points upstream and downstream of cytochrome c release from mitochondria5. In order to study the post-mitochondrial regulation of caspase activation, many investigators have turned to direct cytoplasmic microinjection of holocytochrome c (heme-attached) protein into cells6-9. Cytochrome c is normally localized to the mitochondria where attachment of a heme group is necessary to enable it to activate apoptosis10-11. Therefore, to directly activate caspases, it is necessary to inject the holocytochrome c protein instead of its cDNA, because while the expression of cytochrome c from cDNA constructs will result in mitochondrial targeting and heme attachment, it will be sequestered from cytosolic caspases. Thus, the direct cytosolic microinjection of purified heme-attached cytochrome c protein is a useful tool to mimic mitochondrial cytochrome c release and apoptosis without the use of toxic insults which cause cellular and mitochondrial damage.
In this article, we describe a method for the microinjection of cytochrome c protein into cells, using mouse embryonic fibroblasts (MEFs) and primary sympathetic neurons as examples. While this protocol focuses on the injection of cytochrome c for investigations of apoptosis, the techniques shown here can also be easily adapted for microinjection of other proteins of interest.

Activation of Apoptosis by Cytoplasmic Microinjection of Cytochrome c

In this protocol, we describe the direct cytoplasmic microinjection of cytochrome c protein into fibroblasts and primary sympathetic neurons. This technique allows for the introduction of cytochrome c protein into the cytoplasm of cells and mimics the release of cytochrome c from mitochondria, which occurs during apoptosis.

Die Aktivierung der Apoptose durch cytoplasmatische Mikroinjektion von Cytochrom C</em

Apoptosis, or programmed cell death, is a conserved and highly regulated pathway by which cells die1.  Apoptosis can be triggered when cells encounter a ...

Isolation of Ribosome Bound Nascent Polypeptides in vitro to Identify Translational Pause Sites Along mRNA

The rate of translational elongation is non-uniform. mRNA secondary structure, codon usage and mRNA associated proteins may alter ribosome movement on the messagefor review see 1. However, it's now widely accepted that synonymous codon usage is the primary cause of non-uniform translational elongation rates1. Synonymous codons are not used with identical frequency. A bias exists in the use of synonymous codons with some codons used more frequently than others2. Codon bias is organism as well as tissue specific2,3. Moreover, frequency of codon usage is directly proportional to the concentrations of cognate tRNAs4. Thus, a frequently used codon will have higher multitude of corresponding tRNAs, which further implies that a frequent codon will be translated faster than an infrequent one. Thus, regions on mRNA enriched in rare codons (potential pause sites) will as a rule slow down ribosome movement on the message and cause accumulation of nascent peptides of the respective sizes5-8. These pause sites can have functional impact on the protein expression, mRNA stability and protein foldingfor review see 9. Indeed, it was shown that alleviation of such pause sites can alter ribosome movement on mRNA and subsequently may affect the efficiency of co-translational (in vivo) protein folding1,7,10,11. To understand the process of protein folding in vivo, in the cell, that is ultimately coupled to the process of protein synthesis it is essential to gain comprehensive insights into the impact of codon usage/tRNA content on the movement of ribosomes along mRNA during translational elongation.
Here we describe a simple technique that can be used to locate major translation pause sites for a given mRNA translated in various cell-free systems6-8. This procedure is based on isolation of nascent polypeptides accumulating on ribosomes during in vitro translation of a target mRNA. The rationale is that at low-frequency codons, the increase in the residence time of the ribosomes results in increased amounts of nascent peptides of the corresponding sizes. In vitro transcribed mRNA is used for in vitro translational reactions in the presence of radioactively labeled amino acids to allow the detection of the nascent chains. In order to isolate ribosome bound nascent polypeptide complexes the translation reaction is layered on top of 30% glycerol solution followed by centrifugation. Nascent polypeptides in polysomal pellet are further treated with ribonuclease A and resolved by SDS PAGE. This technique can be potentially used for any protein and allows analysis of ribosome movement along mRNA and the detection of the major pause sites. Additionally, this protocol can be adapted to study factors and conditions that can alter ribosome movement and thus potentially can also alter the function/conformation of the protein.

Isolation of Ribosome Bound Nascent Polypeptides in vitro to Identify Translational Pause Sites Along mRNA

A technique to identify translational pause sites on mRNA is described. This procedure is based on isolation of nascent polypeptides accumulating on ribosomes during in vitro translation of a target mRNA, followed by the size analysis of the nascent chains using a denaturing gel electrophoresis.

Isolierung von Ribosom gebunden Nascent Polypeptide<em&gt; In-vitro-</em&gt; Identifizieren Translational Pause Standorten entlang mRNA

The rate of translational elongation is non-uniform. mRNA secondary structure, codon usage and mRNA associated proteins may alter ribosome movement on the ...

The c-FOS Protein Immunohistological Detection: A Useful Tool As a Marker of Central Pathways Involved in Specific Physiological Responses In Vivo and Ex Vivo

Many studies seek to identify and map the brain regions involved in specific physiological regulations. The proto-oncogene c-fos, an immediate early gene, is expressed in neurons in response to various stimuli. The protein product can be readily detected with immunohistochemical techniques leading to the use of c-FOS detection to map groups of neurons that display changes in their activity. In this article, we focused on the identification of brainstem neuronal populations involved in the ventilatory adaptation to hypoxia or hypercapnia. Two approaches were described to identify involved neuronal populations in vivo in animals and ex vivo in deafferented brainstem preparations. In vivo, animals were exposed to hypercapnic or hypoxic gas mixtures. Ex vivo, deafferented preparations were superfused with hypoxic or hypercapnic artificial cerebrospinal fluid. In both cases, either control in vivo animals or ex vivo preparations were maintained under normoxic and normocapnic conditions. The comparison of these two approaches allows the determination of the origin of the neuronal activation i.e., peripheral and/or central. In vivo and ex vivo, brainstems were collected, fixed, and sliced into sections. Once sections were prepared, immunohistochemical detection of the c-FOS protein was made in order to identify the brainstem groups of cells activated by hypoxic or hypercapnic stimulations. Labeled cells were counted in brainstem respiratory structures. In comparison to the control condition, hypoxia or hypercapnia increased the number of c-FOS labeled cells in several specific brainstem sites that are thus constitutive of the neuronal pathways involved in the adaptation of the central respiratory drive.

The c-FOS Protein Immunohistological Detection: A Useful Tool As a Marker of Central Pathways Involved in Specific Physiological Responses In Vivo and Ex Vivo

Here, we present a protocol based on c-FOS protein immunohistological detection, a classical technique used for the identification of neuronal populations involved in specific physiological responses in vivo and ex vivo.

Die c-fos-Protein Immunohistologische Nachweis: Ein nützliches Werkzeug als Marker der Mittelwegen beteiligt sind in spezifischen physiologischen Antworten<em&gt; In Vivo</em&gt; und<em&gt; Ex Vivo</em

Many studies seek to identify and map the brain regions involved in specific physiological regulations. The proto-oncogene c-fos, an immediate early gene, ...

Filtration Isolation of Nucleic Acids:  A Simple and Rapid DNA Extraction Method

FINA, filtration isolation of nucleic acids, is a novel extraction method which utilizes vertical filtration via a separation membrane and absorbent pad to extract cellular DNA from whole blood in less than 2 min. The blood specimen is treated with detergent, mixed briefly and applied by pipet to the separation membrane. The lysate wicks into the blotting pad due to capillary action, capturing the genomic DNA on the surface of the separation membrane. The extracted DNA is retained on the membrane during a simple wash step wherein PCR inhibitors are wicked into the absorbent blotting pad. The membrane containing the entrapped DNA is then added to the PCR reaction without further purification. This simple method does not require laboratory equipment and can be easily implemented with inexpensive laboratory supplies. Here we describe a protocol for highly sensitive detection and quantitation of HIV-1 proviral DNA from 100 &#181;l whole blood as a model for early infant diagnosis of HIV that could readily be adapted to other genetic targets.

We describe here a simple and rapid paper-based DNA extraction method of HIV proviral DNA from whole blood detected by quantitative PCR. This protocol can be extended for use in detecting other genetic markers or using alternative amplification methods.

Filtration Isolierung von Nukleinsäuren: Eine einfache und schnelle DNA-Extraktionsmethode

FINA, filtration isolation of nucleic acids, is a novel extraction method which utilizes vertical filtration via a separation membrane and absorbent pad ...

Glucose Uptake Measurement and Response to Insulin Stimulation in In Vitro Cultured Human Primary Myotubes

Skeletal muscle is the largest glucose deposit in mammals and largely contributes to glucose homeostasis. Assessment of insulin sensitivity of muscle cells is of major relevance for all studies dedicated to exploring muscle glucose metabolism and characterizing metabolic alterations. In muscle cells, glucose transporter type 4 (GLUT4) proteins translocate to the plasma membrane in response to insulin, thus allowing massive entry of glucose into the cell. The ability of muscle cells to respond to insulin by increasing the rate of glucose uptake is one of the standard readouts to quantify muscle cell sensitivity to insulin. Human primary myotubes are a suitable in vitro model, as the cells maintain many features of the donor phenotype, including insulin sensitivity. This in vitro model is also suitable for the test of any compounds that could impact insulin responsiveness. Measurements of the glucose uptake rate in differentiated myotubes reflect insulin sensitivity.
In this method, human primary muscle cells are cultured in vitro to obtain differentiated myotubes, and glucose uptake rates with and without insulin stimulation are measured. We provide a detailed protocol to quantify passive and active glucose transport rates using radiolabeled [3H] 2-deoxy-D-Glucose ([3H]2dG). Calculation methods are provided to quantify active basal and insulin-stimulated rates, as well as stimulation fold.

Glucose Uptake Measurement and Response to Insulin Stimulation in In Vitro Cultured Human Primary Myotubes

In this method, human primary muscle cells are cultured in vitro to obtain differentiated myotubes and glucose uptake rates are measured. We provide a detailed protocol to quantify rates in basal and insulin-stimulated states using radiolabeled [3H] 2-deoxy-D-Glucose.

Glukoseaufnahme Messung und Response auf Insulin Stimulation in<em&gt; In vitro</em&gt; Kultivierte menschliche primäre Myotubes

Skeletal muscle is the largest glucose deposit in mammals and largely contributes to glucose homeostasis. Assessment of insulin sensitivity of muscle ...

In Vitro and In Vivo Approaches to Determine Intestinal Epithelial Cell Permeability

The intestinal barrier defends against pathogenic microorganism and microbial toxin. Its function is regulated by tight junction permeability and epithelial cell integrity, and disruption of the intestinal barrier function contributes to progression of gastrointestinal and systemic disease. Two simple methods are described here to measure the permeability of intestinal epithelium. In vitro, Caco-2BBe cells are plated in tissue culture wells as a monolayer and transepithelial electrical resistance (TER) can be measured by an epithelial (volt/ohm) meter. This method is convincing because of its user-friendly operation and repeatability. In vivo, mice are gavaged with 4 kDa fluorescein isothiocyanate (FITC)-dextran, and the FITC-dextran concentrations are measured in collected serum samples from mice to determine the epithelial permeability. Oral gavage provides an accurate dose, and therefore is the preferred method to measure the intestinal permeability in vivo. Taken together, these two methods can measure the permeability of the intestinal epithelium in vitro and in vivo, and hence be used to study the connection between diseases and barrier function.

In Vitro and In Vivo Approaches to Determine Intestinal Epithelial Cell Permeability

Two methods are presented here to determine intestinal barrier function. An epithelial meter (volt/ohm) is used for measurements of transepithelial electrical resistance of cultured epithelia directly in tissue culture wells. In mice, the FITC-dextran gavage method is used to determine the intestinal permeability in vivo.