Yazarlar bildirimleri var.

1. Concatemerization <ol><li> Yeniden süspanse primerler Fw ve Rv&#39;nin Moleküler Biyoloji H2O içinde 10 mg / ml &#39;lik bir konsantrasyon (primer diziler Malzemesi Tablo) Daha sonra, 5 ul Fw ve 1.5 ml mikrosantrifüj tüpü içinde Rv primerin 5 ul karıştırın. </li><li> 15 dakika boyunca (burada tarif edilen primerler için 75 ° C) doğru tavlama sıcaklığına kadar ısıtılarak Tavlama primer karışımını içerir. Oda sıcaklığında (RT) soğumasını bankta bırakın. GKD 2 O. içinde çözülerek inkübasyon sırasında% 60 PEG8000 hazırlayın </li><li> % 60 PEG8000, 50 ul 10x polinükleotid kinaz (PNK) tamponu, H2O 27 ul, ve primer karışımı PNK 3 ul 10 ul (% 30 arasında bir nihai konsantrasyon elde etmek için). 2 saat boyunca 37 ° C&#39;de inkübe edilir. </li><li> Oda sıcaklığında soğumaya ve DNA ligaz tamponu 11 ul ekleyin. Daha sonra DNA ligazı 3 U ekleyin ve gece boyunca 37 ° C&#39;de inkübe edin. </li></ol> 2. DNA Saflaştırmave Analizi <ol><li> Ligasyon karışımı hacmini artırmak için H2O 300 ul ilave edin. Not: kloroform buharı: nedeniyle fenol toksisitesi bir davlumbaz devam edin. </li><li> 1 hacim fenol (400 ul) ilave: kloroform ve kuvvetlice çalkalayarak karıştırın. </li><li> Bir masa mikrosantrifüjde 1 dakika boyunca maksimum hızda santrifüj. Sulu ve solvent tabakalar üzerine, sulu tabaka ve bu iki katman arasında çöken protein, beyaz bir tabaka ile ayrılacaktır. </li><li> Dikkatli pipetle tarafından yeni bir tüp üst tabakasını aktarın (orta aktarılmasını önlemek, beyaz tabaka) </li><li> Tekrar 2.2 ve 2.3 en az iki kez ya da hiç Çöken protein santrifüj sonra oraya kadar adım. </li><li> 1 hacim kloroform (400 ul) ekleyin ve tekrar 2,3-2,4 adımları. </li><li> % 100 önceden soğutulmuş etanol 2 hacim (800 ul) ilave edilir ve en az 1 saat veya gece boyunca -20 ° C&#39;de inkübe edin. NOT: Bu adımı DNA konkatemerler çöker. </li><li> Maksimum hız ve aspire Süpermarket aşağı Spinrnatant. % 70 etanol içinde 1 ml ilave etmek suretiyle bir kez yıkayın ve duman başlığı içinde havayla kurumaya bırakın. </li><li> Endotoksin ücretsiz GKD 2 O. 50 ul yeniden süspanse DNA Not: endotoksin içermeyen reaktiflerin kullanımı, hücreler ve in vivo olarak bir DNA spesifik olmayan bağışıklık tepkisini oluşturmak için çok önemlidir. </li><li> Yeni bir tüp içine concatemerized DNA, 2 ul numuneyi çıkarın ve 1 ml DNA jel yükleme tamponu ilave edin. </li><li> (Fırın ve ses gücü uygun olan ya da zaman) 2 dakika boyunca bir mikrodalga fırın içinde tam güçte ısıtılarak, TAE tamponu içindeki% 1 agaroz eritilir. </li><li> , Döküm aparatı içine jel dökün floresan bir DNA kenetleme boya 4 ul, tarak eklemek ve jel ayarlamak için yaklaşık 20 dakika için oda sıcaklığında bırakın. </li><li> Ayarlandıktan sonra, TAE tamponu içeren elektroforez tankına tarak ve yer jel kaldırmak. Yük kuyularına DNA örneği veya büyüklüğü belirteçlerin 3 ul. </li><li> Sabit akım ile 90 V 30-40 dakika boyunca jel elektroforezi çalıştırın. Visualize ultra-viyole ışığı altında DNA concatemerization (Şekil 1A) gözlemlemek. </li><li> UV emme spektroskopisi ile numunenin geri kalan DNA konsantrasyonu ölçümü. DNA tekrar süspansiyon ve 200-300 nm absorbans spektrumunun ölçülmesi için kullanılan aynı GKD 2 O ile Boş spektrometresi. NOT: Bir DNA konsantrasyonu absorbanstır Beer-Lambert yasasına A = E * C * l kullanılarak hesaplanabilir, ışık yolu olan mesafesini sönüm katsayısı E ve L &#39;dir. DNA ölçümü için ölçülmelidir 260 nm&#39;de absorbansı ve 0.027 (ug / ml) bir sönüm katsayısı -1 cm-1 konsantrasyonlar kullanılır. Işık yolu mesafesi, I, spektrofotometre bağlı olarak değişecektir. Konsantrasyonunun ölçülmesi, DNA saflıkta bir göstergesi olarak 260/280 nm emilim oranı not edin; Yukarıda 2.00 Bu oran için bir değer tavsiye edilir. </li></ol> Vi yılında dsDNA konkatemerlerin 3. Transfeksiyonutro <ol><li> , Bir doku kültür kabı veya plakasında Tohum hücreleri stimülasyonu sırasında% 70 birleşmiş olması. </li><li> 1-10 ug / ml &#39;lik bir nihai konsantrasyon kullanılarak hücrelerin uyarılması için gerekli DNA kütlesi hesaplanır. DNA gerekli kütlesi aşağıdaki X olarak ifade edilecektir. Örneğin, daha sonra 5 mg / ml &#39;lik bir konsantrasyonda DNA DNA 2 x 5 = 10 ug bir kitle de ortam 2 ml 6 yuvalı bir plaka tek bir çukuruna hücre uyarıcı gerekiyorsa. </li><li> Uygun boyutlu steril bir tüpe, serum barındırmayan ortam, 50 * X, ul ekleyin. Pipet dikkatle ortamının merkezine, borunun, 2 * X, katyonik lipit transfeksiyon reaktifi ul ve 5 dakika boyunca bırakın kenarını dokunmadan. </li><li> Tüp ve vorteks kısaca DNA X ug ekleyin. En az 20 dakika boyunca oda sıcaklığında bekletin. In vitro transfeksiyon için, DNA, sitoplazmik algılama yollarını uyardığı için hücrelere doğrudan bu karışımı ekleyin. </li></ol> DsDNA konkatemerler I 4. transfeksiyonuin vivo koşullarda <ol><li> 3,1-3,5 1 mg DNA, 2 ul lipit transfeksiyon ayıracı ve 18 ul serum fare kulağı başına ücretsiz orta uyarılacak kullanarak açıklandığı gibi transfeksiyon karışımı hazırlayın. Steril bir 30 G iğne ile steril bir 20 ul Hamilton şırıngası, başlık hazırlanmakta ve DNA transfeksiyon karışımı ile yükleyin. </li><li> % 1-2 izofluran kullanılarak C57BL / 6 fare anestezisi. Hareket ve sürekli solunum hızının kaybı ve gerekirse tutam refleks testi ile anestezi onaylayın. Anestezi sırasında hayvanın gözleri izlemek ve aşırı kuruluğu önlemek için gerektiği gibi merhem kullanın. </li><li> Steril teknik kullanılarak, kulak kepçesine dikkatle sıvının tek bir &quot;kabarcık&quot; kulak dermal tabakaları arasında oluşturulur, böylece transfeksiyon karışımı 10 ul enjekte edilir. Not: iğne kulak kepçesi sadece cildin ilk katmanını nüfuz sağlamak için dar bir açıda, başparmak veya parmağı üzerinde bir lastik yüksük kullanın üzerinde kulak streç, ve enjekte. </li><li> Reinğa geri fare kafesin içine ve düzenli anestezi sonrası kurtarma izlemek. Anestezi uygulanmış farelerin aşırı soğumasını ortadan kaldıracak için bir ısıtma lambası kullanın. Onlar sternum yatma korumak için yeterli bilince kavuştular kadar sahipsiz fareler bırakmayın. </li><li> Flaş 2 dakika süre ile sıvı azot içinde daldırarak bir mikrosantrifüj tüpü içinde, bütün kulak kulak kepçesi dondurma. </li></ol> Kantitatif PCR ile DNA Uyanlı Örnekleri ve Analizi 5. İşleme (qPCR) <ol><li> Aspirat bir pipet ile orta ve atık atmak: Hücre kültüründen. </li><li> Steril PBS içinde 1 ml ilave edilir. 5.1 ve 5.2 iki kez tekrarlayın ve 5.3 adıma geçin </li><li> Kulak dokusundan: steril seramik havan ve tokmağı kullanarak sıvı azot altında dokuyu eziyet steril bir spatula kullanarak bir mikrosantrifüj tüp zemin doku transferi, ve 5.4 adıma geçin </li><li> 350 ul lizis tamponu ekleyin ve ticari RNA ekstraksiyon kiti protokolü ile devam edin. Ekstraksiyon kiti saflaştırma elute RNA&#39;nın40 ul GKD 2 O. sütun Not: Ticari RNA ekstraksiyon kiti çok iyi çalışıyor (malzeme / ekipman tabloya bakınız); diğer teknikler subpar sonuçlar ile test edilmiştir. </li><li> (Bölüm 2.13), yukarıda tarif edildiği gibi DNA için UV spektroskopi ile RNA miktarı belirlenir. Not: RNA için yok olma katsayısı 0.025 (ug / ml) 1 cm -1. </li><li> Oligo (dT) primeri steril bir PCR tüpü 1 ul ekle 10 mM dNTP, 1 ul karıştırın ve 250 ug RNA. Steril GKD 2 O. ile 11 ul hacmi Makyaj </li><li> 65 ° C sıcaklıkta 5 dakika boyunca inkübe edin. Daha sonra 4 ul içine First Strand Tampon, 1 ul 0.1 M ditiyotreitol eklemek, 0.25 ul tüp transkriptaz ve 1.75 ul GKD 2 O ters. 15 dakika boyunca 72 ° C, daha sonra 1 saat boyunca 50 ° C&#39;de inkübe edilir. O. GKD 2 kullanılarak 5: İsteğe bağlı olarak, cDNA ürününü 1 sulandırmak </li><li> Kantitatif PCR kullanımı 2 ul cDNA, 2 ul GKD 2 O, 5 ul qPCR usta karışımı ve 1 içinİleri 10 uM her ul ve seçim gen (ler) yükseltmek için primer stokları ters. 96 oyuklu bir plaka içerisinde karıştırın ve kantitatif PCR makinesi (Şekil 1B ve 1C) kullanarak analiz eder. </li></ol>

<ol>
	<li>Yoshida, H., Okabe, Y., Kawane, K., Fukuyama, H., Nagata, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Lethal+anemia+caused+by+interferon-beta+produced+in+mouse+embryos+carrying+undigested+DNA.">Lethal anemia caused by interferon-beta produced in mouse embryos carrying undigested DNA.</a> Nat. Immunol. 6, 49-56 (2005).</li><li>Ishikawa, H., Ma, Z., Barber, G. N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=STING+regulates+intracellular+DNA-mediated,+type+I+interferon-dependent+innate+immunity.">STING regulates intracellular DNA-mediated, type I interferon-dependent innate immunity.</a> Nature. 461, 788-792 (2009).</li><li>Ishii, K. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=TANK-binding+kinase-1+delineates+innate+and+adaptive+immune+responses+to+DNA+vaccines.">TANK-binding kinase-1 delineates innate and adaptive immune responses to DNA vaccines.</a> Nature. 451, 725-729 (2008).</li><li>Stetson, D. B., Medzhitov, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Recognition+of+cytosolic+DNA+activates+an+IRF3-dependent+innate+immune+response.">Recognition of cytosolic DNA activates an IRF3-dependent innate immune response.</a> Immunity. 24, 93-103 (2006).</li><li>Pichlmair, A., Reise Sousa, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Innate+recognition+of+viruses.">Innate recognition of viruses.</a> Immunity. 27, 370-383 (2007).</li><li>Unterholzner, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=IFI16+is+an+innate+immune+sensor+for+intracellular+DNA.">IFI16 is an innate immune sensor for intracellular DNA.</a> Nat. Immunol. 11, 997-1004 (2010).</li><li>Ferguson, B. J., Mansur, D. S., Peters, N. E., Ren, H., Smith, G. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=DNA-PK+is+a+DNA+sensor+for+IRF-3-dependent+innate+immunity.">DNA-PK is a DNA sensor for IRF-3-dependent innate immunity.</a> Elife. 1, e00047 (2012).</li><li>Sun, L., Wu, J., Du, F., Chen, X., Chen, Z. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cyclic+GMP-AMP+synthase+is+a+cytosolic+DNA+sensor+that+activates+the+type+I+interferon+pathway.">Cyclic GMP-AMP synthase is a cytosolic DNA sensor that activates the type I interferon pathway.</a> Science. 339, 786-791 (2013).</li><li>Honda, K., Taniguchi, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=IRFs:+master+regulators+of+signalling+by+Toll-like+receptors+and+cytosolic+pattern-recognition+receptors.">IRFs: master regulators of signalling by Toll-like receptors and cytosolic pattern-recognition receptors.</a> Nat. Rev. Immunol. 6, 644-658 (2006).</li><li>Karayel, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+TLR-independent+DNA+recognition+pathway+in+murine+macrophages:+Ligand+features+and+molecular+signature.">The TLR-independent DNA recognition pathway in murine macrophages: Ligand features and molecular signature.</a> Eur. J. Immunol. 39, 1929-1936 (2009).</li></ol>

The authors have nothing to disclose.

Burada açıklanan protokoller hücre tiplerinin geniş bir yelpazede ve in vivo olarak yeniden üretilebilir sonuçlar sitosolik doğuştan gelen bağışıklık tepkisi ortaya çıkarmak için dsDNA oluşturmak için kullanılır. Ikinci ana tabaka reaktif bir sentetik oligonükleotid olduğu, alternatif bir DNA sekanslarını veya kimyasal modifikasyonlar için, bu sistemde bir esneklik elde edilir. Bu, örneğin, bir flüoresan etiket veya lokalizasyonunu etiket ya da diğer biyomoleküllerle etkileşiminin...

DNA ökaryotlarda özel bölmelere tutmak tüm organizmalar ve hücrelerin, önemli bir bileşenidir. Bu bölmelere ayırır ya da zaman doğuştan gelen bağışıklık sistemi arasında bir fonksiyonu, tanımlanması için bir yabancı madde, fiziksel, dış engelleri ihlal ile organizma içine sokulduğunda. İnsan vücudunda doğru compartmentalization kaçabilir DNA&#39;nın küçük miktarlarda düşmesine yardımcı olmak için vardır proteinlerin bir dizi vardır; DNAz I, II ve III, plazma, endozoma ve sitozol içinde DNA break down. Ancak, doğuştan gelen bağışıklık sistemi ekstra nükleer DNA tepki verdiğini DNAz II eksik farenin düşündüren interferonlar 1 aşırı üretimine yol açtığı şiddetli anemi ölmektedir olduğu gösterilmiştir. Bu yanıt, daha da Toll-benzeri reseptör sinyal kapasitesi tamamen eksik olan farelerde görülür. Çeşitli çalışmalar şimdi interferon genleri (STING) 2 ve TANK-bağlayıcı kinaz 1 (TB olduğunu uyarıcı göstermiştirK1) 3 sitoplazmada DNA&#39;nın saptanması ve bu sinyal yolunun, interferon ayarlayıcı faktör (IRF) -3 4 aktive katılmaktadırlar. Sitokin, kemokin, ve interferon gen daha sonra IRF3 bağımlı transkripsiyon, bir patojen ya da tehlike ilişkili moleküler model (PAMP ya da ıslak) 5 ya da doğuştan gelen bağışıklık tepkisinin özelliğidir. Hücre içi nükleik asit algılama yollan araştırmak için arzu diğer doğal immün yanıtları aktive olmayan hücrelere DNA ya da RNA&#39;nın hücrelere verilmesi ile teşvik etmek için sağlam ve tekrarlanabilir yöntemler geliştirmeye ihtiyacına yol açmıştır. / Sokması TBK1 / IRF3 yolu uyarılabilir hangi bir yöntemi, bu, DNA-PK, IFI16 ve CGAS 6-8 gibi DNA sensörleri tarafından erişilebilir sitoplazmaya nükleik asit sağlamak üzere katyonik lipit transfeksiyon reaktifleri kullanılarak gereğidir. Şu anda eff izin vermek için anlaşılır DNA özellikleriDiğer yolların uyarımı olmaksızın sitoplazmik tabii immun cevabın aktivasyonu icient CpG uzunluğu, kütle, saflık ve eksik 4,7,9 motifleridir. Sentetik oligonükleotidlerin, optimize edilmiş DNA dizisi ve saf kimyasal türler gibi hazırlanabilir izin olarak doğuştan gelen bağışıklık tepkisi üretmek amacı için oldukça uygundurlar. Bir 45 baz çift immüno-uyarıcı DNA (ISD) dizisi, bu amaç için uygun bir CpG içermeyen sekans olarak şapkalı ve ark. 4 ile teşhis edildi. Bu dsDNA dizi aksi takdirde rastgele ve CpG motifleri onun eksikliği dışında hiçbir özel özellikleri vardır. Bu önemli ölçüde daha uzun şeritler haline ISD oligonükleotid concatemerizing tarafından uyarılması 7 büyüklüğünü arttırdığını bulduk. Concatemerized ISD Üretimi sitoplazmik bir doğuştan gelen bağışıklık tepkisinin uyarılması için faydalıdır. Burada bu reaktifinin hazırlanması için protokoller sunulmuş ve bu DNA algılama yolunu aktive etmek için kullanılabilir nasılin vivo ve in vitro. NOT: Tüm hayvan çalışmaları onaylanan kurumsal protokollere ve hayvan bakımı kurallar altında yapılmaktadır.

<table border="0" cellpadding="0" cellspacing="0" width="1066">
	<tbody>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">Forward Primer</td>
			<td style="width:221px;">Integrated DNA technologies</td>
			<td style="width:144px;">n/a</td>
			<td style="width:407px;">TACAGATCTACTAGTGATCTATGACTGATCTGTACATGATCTACA</td>
		</tr>
		<tr height="19">
			<td height="19" style="height:19px;width:295px;">Reverse Primer</td>
			<td style="width:221px;">Integrated DNA technologies</td>
			<td style="width:144px;">n/a</td>
			<td>TGTAGATCATGTACAGATCAGTCATAGATCACTAGTAGATCTGTA</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">PEG8000</td>
			<td style="width:221px;">Sigma-Aldrich</td>
			<td style="width:144px;">P-4463</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">Molecular biology grade water</td>
			<td style="width:221px;">Sigma-Aldrich</td>
			<td style="width:144px;">W4502-1L</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">T4 Polynucleotide Kinase</td>
			<td style="width:221px;">Promega</td>
			<td style="width:144px;">M4101</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">T4 DNA Ligase</td>
			<td style="width:221px;">Promega</td>
			<td style="width:144px;">M1801</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">Phenol:Chloroform</td>
			<td style="width:221px;">Fisher Chemical</td>
			<td style="width:144px;">BPE1752p-400</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">Chloroform</td>
			<td style="width:221px;">Fisher Chemical</td>
			<td style="width:144px;">C/4960/PB08</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">Ethanol</td>
			<td style="width:221px;">Sigma-Aldrich</td>
			<td style="width:144px;">32221-2.5L</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">DNA gel loading buffer</td>
			<td style="width:221px;">New England biolabs</td>
			<td style="width:144px;">B7021S</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">Agarose</td>
			<td style="width:221px;">Bioline</td>
			<td style="width:144px;">BIO-41025</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">Optimem</td>
			<td style="width:221px;">Life Technologies</td>
			<td style="width:144px;">11058021</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">TransIT-LT1&#160;</td>
			<td style="width:221px;">Mirus Bioscience</td>
			<td style="width:144px;">MIR 2300</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">Hamilton Syringe</td>
			<td style="width:221px;">Hamilton</td>
			<td style="width:144px;">80901 Model 1705</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">30G needles&#160;</td>
			<td style="width:221px;">BD bioscience</td>
			<td style="width:144px;">304000</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">SYBR Safe DNA gel stain</td>
			<td style="width:221px;">Life Technologies</td>
			<td style="width:144px;">S33102</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">Rneasy Plus Mini Kit</td>
			<td style="width:221px;">Qiagen</td>
			<td style="width:144px;">74134</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">Oligo(dT) primer</td>
			<td style="width:221px;">Thermo Scientific</td>
			<td style="width:144px;">SO131</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">dNTP mix</td>
			<td style="width:221px;">Fermentas</td>
			<td style="width:144px;">R0192</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">Super Script III reverse transcriptase</td>
			<td style="width:221px;">Life Technologies</td>
			<td align="right" style="width:144px;">56575</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">First strand cDNA synthesis buffer</td>
			<td style="width:221px;">Life Technologies</td>
			<td style="width:144px;">y02321</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">SybrGreen qPCR Fast master mix</td>
			<td style="width:221px;">Applied Biosystems</td>
			<td align="right" style="width:144px;">4385612</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">cxcl10 murine forward primer&#160;</td>
			<td style="width:221px;">Integrated DNA technologies</td>
			<td style="width:144px;">n/a</td>
			<td>ACTGCATCCATATCGATGAC</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">cxcl10 murine reverse primer</td>
			<td style="width:221px;">Integrated DNA technologies</td>
			<td style="width:144px;">n/a</td>
			<td>TTCATCGTGGCAATGATCTC</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">il6 murine forward primer&#160;</td>
			<td style="width:221px;">Integrated DNA technologies</td>
			<td style="width:144px;">n/a</td>
			<td>GTAGCTATGGTACTCCAGAAGAC</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">il6 murine forward primer&#160;</td>
			<td style="width:221px;">Integrated DNA technologies</td>
			<td style="width:144px;">n/a</td>
			<td>GTAGCTATGGTACTCCAGAAGAC</td>
		</tr>
	</tbody>
</table>

stimulation of cytoplasmic dna sensing pathways in vitro and in vivo

Etkili bir doğuştan gelen bağışıklık tepkisini uyarmak için, DNA, yeterli uzunluk ve saflıkta olmalıdır. Biz, gerekli özelliklere sahip çift sarmallı DNA (dsDNA) algılama yolları ucuz ve kolaylıkla oluşturulabilir sitoplazmik DNA teşvik etmek için bir yöntem sunulmaktadır. Kısa sentetik oligonükleotidlerin (CpG motifleri eksik olan) en concatemerization ile, dsDNA sitosolik DNA algılama yolunu aktive etmek için yeterli bir uzunluğa sahip olması elde edilebilir. Bu protokol, etkili bir ligasyon meydana gelmesi için bir ortam sağlar polietilen glikol varlığında (PEG) içinde oligonükleotidlerin kör uç ligasyonu içerir. DsDNA karakterlerini, standart transfeksiyon protokolleri ile, in vitro olarak doğuştan gelen bağışıklık tepkisini için, fenol / kloroform ekstraksiyonu ile saflaştırma işleminden sonra, kullanılabilir. Bu DNA, aynı zamanda, örneğin, bir fare kulak kepçesine intradermal enjeksiyon yolu ile, in vivo doğal bağışıklığı uyarmak için kullanılabilir. Tarafındanconcatemerization işlemi ve daha sonraki stimülasyon protokolleri standartlaştırılması, doğuştan gelen bağışıklık sistemi, güvenilir ve yeniden üretilebilir bir aktivasyona üretilebilir.

<html> Aşağıdaki sonuçlar concatemerized DNA, nispeten kolay bir şekilde üretilebilir ve hücrelerde ve farelerde güçlü bir doğal bağışıklık tepkisini uyarabilen edilebileceğini gösterir. PEG8000 kullanımı ile, açık bir şekilde oluşturulan DNA uzunluğu önemli ölçüde daha uzun ve CXCL10 kopyalanmasının indükleme yeteneğine eşit olduğu görülebilir. Agaroz jel analizi ile görüldüğü gibi, PEG8000 ile numune için, DNA uzunluğu 10000 bp (Şekil 1A) aşan sarmallar da ...

Watch this Scientific Journal Video about Stimulation of Cytoplasmic DNA Sensing Pathways In Vitro and In Vivo at JoVE.com

Stimulation of Cytoplasmic DNA Sensing Pathways In Vitro and In Vivo

Protokolün amacı hücrelerin in vivo ve in sitoplazmik DNA algılama yolları uyarılması için uygun yöntemler kullanılmasıdır. Bu uç ligasyonu içinde uzun bir çift şeritli DNA oluşumunu geliştirerek elde edilir. Hücreler daha sonra ya da farenin bir lipit transfeksiyon ayıracı kullanılarak transfekte edilir.

Sitoplazmik DNA Algılama Pathways uyarılması<em&gt; İn Vitro</em&gt; Ve<em&gt; In Vivo</em

In order to efficiently stimulate an innate immune response, DNA must be of sufficient length and purity. We present a method where double stranded DNA ...

stimulation-of-cytoplasmic-dna-sensing-pathways-in-vitro-and-in-vivo

Research

JoVE Journal

Biology

Stimulation of Cytoplasmic DNA Sensing Pathways In Vitro and In Vivo

8.8K Görüntüleme.  University of Cambridge.  Protokolün amacı hücrelerin in vivo ve in sitoplazmik DNA algılama yolları uyarılması için uygun yöntemler kullanılmasıdır. Bu uç ligasyonu içinde uzun bir çift şeritli DNA oluşumunu geliştirerek elde edilir. Hücreler daha sonra ya da farenin bir lipit transfeksiyon ayıracı kullanılarak transfekte edilir. 

Video: Stimulation of Cytoplasmic DNA Sensing Pathways In Vitro and In Vivo

In vitro and in vivo Bioluminescence Reporter Gene Imaging of Human Embryonic Stem Cells

The discovery of human embryonic stem cells (hESCs) has dramatically increased the tools available to medical scientists interested in regenerative medicine. However, direct injection of hESCs, and cells differentiated from hESCs, into living organisms has thus far been hampered by significant cell death, teratoma formation, and host immune rejection. Understanding the in vivo hESC behavior after transplantation requires novel imaging techniques to longitudinally monitor hESC localization, proliferation, and viability. Molecular imaging has given investigators a high-throughput, inexpensive, and sensitive means for tracking in vivo cell proliferation over days, weeks, and even months. This advancement has significantly increased the understanding of the spatio-temporal kinetics of hESC engraftment, proliferation, and teratoma-formation in living subjects.

A major advance in molecular imaging has been the extension of noninvasive reporter gene assays from molecular and cellular biology into in vivo multi-modality imaging platforms. These reporter genes, under control of engineered promoters and enhancers that take advantage of the host cell s transcriptional machinery, are introduced into cells using a variety of vector and non-vector methods. Once in the cell, reporter genes can be transcribed either constitutively or only under specific biological or cellular conditions, depending on the type of promoter used. Transcription and translation of reporter genes into bioactive proteins is then detected with sensitive, noninvasive instrumentation (e.g., CCD cameras) using signal-generating probes such as D-luciferin.

To avoid the need for excitatory light to track stem cells in vivo as is required for fluorescence imaging, bioluminescence reporter gene imaging systems require only an exogenously administered probe to induce light emission. Firefly luciferase, derived from the firefly Photinus pyralis, encodes an enzyme that catalyzes D-luciferin to the optically active metabolite, oxyluciferin. Optical activity can then be monitored with an external CCD camera. Stably transduced cells that carry the reporter construct within their chromosomal DNA will pass the reporter construct DNA to daughter cells, allowing for longitudinal monitoring of hESC survival and proliferation in vivo. Furthermore, because expression of the reporter gene product is required for signal generation, only viable parent and daughter cells will create bioluminescence signal; apoptotic or dead cells will not. 

In this video, the specific materials and methods needed for tracking stem cell proliferation and teratoma formation with bioluminescence imaging will be described.

With the growing interest in stem cell therapies, molecular imaging techniques are ideal for monitoring stem cell behavior after transplantation. Luciferase reporter genes have enabled non-invasive, repetitive assessment of cell survival, location, and proliferation in vivo. This video will demonstrate how to track hESC proliferation in a living mouse.

In vitro ve in vivo Biyoparlaklık Reporter Gen Görüntüleme İnsan Embriyonik Kök Hücreleri

The discovery of human embryonic stem cells (hESCs) has dramatically increased the tools available to medical scientists interested in regenerative ...

Biyoloji

DNA Transfection of Mammalian Skeletal Muscles using In Vivo Electroporation

A growing interest in cell biology is to express transgenically modified forms of essential proteins (e.g. fluorescently tagged constructs and/or mutant variants) in order to investigate their endogenous distribution and functional relevance. An interesting approach that has been implemented to fulfill this objective in fully differentiated cells is the in vivo transfection of plasmids by various methods into specific tissues such as liver1, skeletal muscle2,3, and even the brain4. We present here a detailed description of the steps that must be followed in order to efficiently transfect genetic material into fibers of the flexor digitorum brevis (FDB) and interosseus (IO) muscles of adult mice using an in vivo electroporation approach. The experimental parameters have been optimized so as to maximize the number of muscle fibers transfected while minimizing tissue damages that may impair the quality and quantity of the proteins expressed in individual fibers. We have verified that the implementation of the methodology described in this paper results in a high yield of soluble proteins, i.e. EGFP and ECFP3, calpain, FKBP12, &beta;2a-DHPR, etc. ; structural proteins, i.e. minidystrophin and &alpha;-actinin; and membrane proteins, i.e. &alpha;1s-DHPR, RyR1, cardiac Na/Ca2+ exchanger , NaV1.4 Na channel, SERCA1, etc., when applied to FDB, IO and other muscles of mice and rats. The efficient expression of some of these proteins has been verified with biochemical3 and functional evidence5. However, by far the most common confirmatory approach used by us are standard fluorescent microscopy and 2-photon laser scanning microscopy (TPLSM), which permit to identify not only the overall expression, but also the detailed intracellular localization, of fluorescently tagged protein constructs. The method could be equally used to transfect plasmids encoding for the expression of proteins of physiological relevance (as shown here), or for interference RNA (siRNA) aiming to suppress the expression of normally expressed proteins (not tested by us yet). It should be noted that the transfection of FDB and IO muscle fibers is particularly relevant for the investigation of mammalian muscle physiology since fibers enzymatically dissociated from these muscles are currently one of the most suitable models to investigate basic mechanisms of excitability and excitation-contraction coupling under current or voltage clamp conditions2,6-8.

DNA Transfection of Mammalian Skeletal Muscles using In Vivo Electroporation

We describe detailed procedures for the efficient transfection of plasmid DNA into the fibers of foot muscles of live mice using electroporation and the subsequent visualization of protein expression using fluorescence microscopy.

Memeli İskelet Kaslar kullanarak DNA Transfeksiyon In Vivo Elektroporasyon

 A growing interest in cell biology is to express transgenically modified forms of essential proteins (e.g. fluorescently tagged constructs and/or mutant ...

In vivo and in vitro Studies of Adaptor-clathrin Interaction

A major endocytic pathway initiates with the formation of clathrin-coated vesicles (CCVs) that transport cargo from the cell surface to endosomes1-6. CCVs are distinguished by a polyhedral lattice of clathrin that coats the vesicle membrane and serves as a mechanical scaffold. Clathrin coats are assembled during vesicle formation from individual clathrin triskelia , the soluble form of clathrin composed of three heavy and three light chain subunits7,8. Because the triskelion does not have the ability to bind to the membrane directly, clathrin-binding adaptors are critical to link the forming clathrin lattice to the membrane through association with lipids and/or membrane proteins9. Adaptors also package transmembrane protein cargo, such as receptors, and can interact with each other and with other components of the CCV formation machinery9.
Over twenty clathrin adaptors have been described, several are involved in clathrin mediated endocytosis and others localize to the trans Golgi network or endosomes9. With the exception of HIP1R (yeast Sla2p), all known clathrin adaptors bind to the N-terminal -propeller domain of the clathrin heavy chain9. Clathrin adaptors are modular proteins consisting of folded domains connected by unstructured flexible linkers. Within these linker regions, short binding motifs mediate interactions with the clathrin N-terminal domain or other components of the vesicle formation machinery9. Two distinct clathrin-binding motifs have been defined: the clathrin-box and the W-box9. The consensus clathrin-box sequence was originally defined as L[L/I][D/E/N][L/F][D/E]10 but variants have been subsequently discovered11. The W-box conforms to the sequence PWxxW (where x is any residue).
Sla1p (Synthetic Lethal with Actin binding protein-1) was originally identified as an actin associated protein and is necessary for normal actin cytoskeleton structure and dynamics at endocytic sites in yeast cells12. Sla1p also binds the NPFxD endocytic sorting signal and is critical for endocytosis of cargo bearing the NPFxD signal13,14. More recently, Sla1p was demonstrated to bind clathrin through a motif similar to the clathrin box, LLDLQ, termed a variant clathrin-box (vCB), and to function as an endocytic clathrin adaptor15. In addition, Sla1p has become a widely used marker for the endocytic coat in live cell fluorescence microscopy studies16. Here we use Sla1p as a model to describe approaches for adaptor-clathrin interaction studies. We focus on live cell fluorescence microscopy, GST-pull down, and co-immunoprecipitation methods.

In vivo and in vitro Studies of Adaptor-clathrin Interaction

Clathrin-mediated endocytosis depends on adaptor proteins that coordinate cargo selection and clathrin coat assembly. Here we describe procedures to study adaptor-clathrin physical interaction and live cell imaging approaches using as a model the yeast endocytic adaptor protein Sla1p.

In vivo ve in vitro Adaptör-clathrin Etkileşim Çalışmaları

A major endocytic pathway initiates with the formation of clathrin-coated vesicles (CCVs) that transport cargo from the cell surface to endosomes1-6. CCVs ...

Visualization of MG53-mediated Cell Membrane Repair Using in vivo and in vitro Systems

Repair of acute injury to the cell membrane is an elemental process of normal cellular physiology, and defective membrane repair has been linked to many degenerative human diseases. The recent discovery of MG53 as a key component of the membrane resealing machinery allows for a better molecular understanding of the basic biology of tissue repair, as well as for potential translational applications in regenerative medicine. Here we detail the experimental protocols for exploring the in vivo function of MG53 in repair of muscle injury using treadmill exercise protocols on mouse models, for testing the ex vivo membrane repair capacity by measuring dye entry into isolated muscle fibers, and for monitoring the dynamic process of MG53-mediated vesicle trafficking and cell membrane repair in cultured cells using live cell confocal microscopy.

Visualization of MG53-mediated Cell Membrane Repair Using in vivo and in vitro Systems

Described here are protocols used to visualize the dynamic process of MG53-mediated cell membrane repair in whole animals and at the cellular level. These methods can be applied to investigate the cell biology of plasma membrane resealing and regenerative medicine.

MG53-aracılı Hücre Zarı Tamiri Görselleştirme In vivo Ve In vitro Sistemleri

Repair of acute injury to the cell membrane is an elemental process of normal cellular physiology, and defective membrane repair has been linked to many ...

Activation of Apoptosis by Cytoplasmic Microinjection of Cytochrome c

Apoptosis, or programmed cell death, is a conserved and highly regulated pathway by which cells die1. Apoptosis can be triggered when cells encounter a wide range of cytotoxic stresses. These insults initiate signaling cascades that ultimately cause the release of cytochrome c from the mitochondrial intermembrane space to the cytoplasm2. The release of cytochrome c from mitochondria is a key event that triggers the rapid activation of caspases, the key cellular proteases which ultimately execute cell death3-4.
The pathway of apoptosis is regulated at points upstream and downstream of cytochrome c release from mitochondria5. In order to study the post-mitochondrial regulation of caspase activation, many investigators have turned to direct cytoplasmic microinjection of holocytochrome c (heme-attached) protein into cells6-9. Cytochrome c is normally localized to the mitochondria where attachment of a heme group is necessary to enable it to activate apoptosis10-11. Therefore, to directly activate caspases, it is necessary to inject the holocytochrome c protein instead of its cDNA, because while the expression of cytochrome c from cDNA constructs will result in mitochondrial targeting and heme attachment, it will be sequestered from cytosolic caspases. Thus, the direct cytosolic microinjection of purified heme-attached cytochrome c protein is a useful tool to mimic mitochondrial cytochrome c release and apoptosis without the use of toxic insults which cause cellular and mitochondrial damage.
In this article, we describe a method for the microinjection of cytochrome c protein into cells, using mouse embryonic fibroblasts (MEFs) and primary sympathetic neurons as examples. While this protocol focuses on the injection of cytochrome c for investigations of apoptosis, the techniques shown here can also be easily adapted for microinjection of other proteins of interest.

Activation of Apoptosis by Cytoplasmic Microinjection of Cytochrome c

In this protocol, we describe the direct cytoplasmic microinjection of cytochrome c protein into fibroblasts and primary sympathetic neurons. This technique allows for the introduction of cytochrome c protein into the cytoplasm of cells and mimics the release of cytochrome c from mitochondria, which occurs during apoptosis.

Sitokrom Sitoplazmik Mikroenjeksiyon Apoptoz aktivasyonu C</em

Apoptosis, or programmed cell death, is a conserved and highly regulated pathway by which cells die1.  Apoptosis can be triggered when cells encounter a ...

Isolation of Ribosome Bound Nascent Polypeptides in vitro to Identify Translational Pause Sites Along mRNA

The rate of translational elongation is non-uniform. mRNA secondary structure, codon usage and mRNA associated proteins may alter ribosome movement on the messagefor review see 1. However, it's now widely accepted that synonymous codon usage is the primary cause of non-uniform translational elongation rates1. Synonymous codons are not used with identical frequency. A bias exists in the use of synonymous codons with some codons used more frequently than others2. Codon bias is organism as well as tissue specific2,3. Moreover, frequency of codon usage is directly proportional to the concentrations of cognate tRNAs4. Thus, a frequently used codon will have higher multitude of corresponding tRNAs, which further implies that a frequent codon will be translated faster than an infrequent one. Thus, regions on mRNA enriched in rare codons (potential pause sites) will as a rule slow down ribosome movement on the message and cause accumulation of nascent peptides of the respective sizes5-8. These pause sites can have functional impact on the protein expression, mRNA stability and protein foldingfor review see 9. Indeed, it was shown that alleviation of such pause sites can alter ribosome movement on mRNA and subsequently may affect the efficiency of co-translational (in vivo) protein folding1,7,10,11. To understand the process of protein folding in vivo, in the cell, that is ultimately coupled to the process of protein synthesis it is essential to gain comprehensive insights into the impact of codon usage/tRNA content on the movement of ribosomes along mRNA during translational elongation.
Here we describe a simple technique that can be used to locate major translation pause sites for a given mRNA translated in various cell-free systems6-8. This procedure is based on isolation of nascent polypeptides accumulating on ribosomes during in vitro translation of a target mRNA. The rationale is that at low-frequency codons, the increase in the residence time of the ribosomes results in increased amounts of nascent peptides of the corresponding sizes. In vitro transcribed mRNA is used for in vitro translational reactions in the presence of radioactively labeled amino acids to allow the detection of the nascent chains. In order to isolate ribosome bound nascent polypeptide complexes the translation reaction is layered on top of 30% glycerol solution followed by centrifugation. Nascent polypeptides in polysomal pellet are further treated with ribonuclease A and resolved by SDS PAGE. This technique can be potentially used for any protein and allows analysis of ribosome movement along mRNA and the detection of the major pause sites. Additionally, this protocol can be adapted to study factors and conditions that can alter ribosome movement and thus potentially can also alter the function/conformation of the protein.

Isolation of Ribosome Bound Nascent Polypeptides in vitro to Identify Translational Pause Sites Along mRNA

A technique to identify translational pause sites on mRNA is described. This procedure is based on isolation of nascent polypeptides accumulating on ribosomes during in vitro translation of a target mRNA, followed by the size analysis of the nascent chains using a denaturing gel electrophoresis.

Ribozom Bağlı Doğan Polipeptitler İzolasyonu<em&gt; In vitro</em&gt; MRNA boyunca Translasyonel Duraklat Siteleri Belirleme

The rate of translational elongation is non-uniform. mRNA secondary structure, codon usage and mRNA associated proteins may alter ribosome movement on the ...

The c-FOS Protein Immunohistological Detection: A Useful Tool As a Marker of Central Pathways Involved in Specific Physiological Responses In Vivo and Ex Vivo

Many studies seek to identify and map the brain regions involved in specific physiological regulations. The proto-oncogene c-fos, an immediate early gene, is expressed in neurons in response to various stimuli. The protein product can be readily detected with immunohistochemical techniques leading to the use of c-FOS detection to map groups of neurons that display changes in their activity. In this article, we focused on the identification of brainstem neuronal populations involved in the ventilatory adaptation to hypoxia or hypercapnia. Two approaches were described to identify involved neuronal populations in vivo in animals and ex vivo in deafferented brainstem preparations. In vivo, animals were exposed to hypercapnic or hypoxic gas mixtures. Ex vivo, deafferented preparations were superfused with hypoxic or hypercapnic artificial cerebrospinal fluid. In both cases, either control in vivo animals or ex vivo preparations were maintained under normoxic and normocapnic conditions. The comparison of these two approaches allows the determination of the origin of the neuronal activation i.e., peripheral and/or central. In vivo and ex vivo, brainstems were collected, fixed, and sliced into sections. Once sections were prepared, immunohistochemical detection of the c-FOS protein was made in order to identify the brainstem groups of cells activated by hypoxic or hypercapnic stimulations. Labeled cells were counted in brainstem respiratory structures. In comparison to the control condition, hypoxia or hypercapnia increased the number of c-FOS labeled cells in several specific brainstem sites that are thus constitutive of the neuronal pathways involved in the adaptation of the central respiratory drive.

The c-FOS Protein Immunohistological Detection: A Useful Tool As a Marker of Central Pathways Involved in Specific Physiological Responses In Vivo and Ex Vivo

Here, we present a protocol based on c-FOS protein immunohistological detection, a classical technique used for the identification of neuronal populations involved in specific physiological responses in vivo and ex vivo.

c-FOS Protein Immünohistolojik Algılama: Belirli Fizyolojik Yanıtları ilgilendim Merkez Pathways bir Marker Olarak Faydalı Aracı<em&gt; İn Vivo</em&gt; ve<em&gt; Ex Vivo</em

Many studies seek to identify and map the brain regions involved in specific physiological regulations. The proto-oncogene c-fos, an immediate early gene, ...

Filtration Isolation of Nucleic Acids:  A Simple and Rapid DNA Extraction Method

FINA, filtration isolation of nucleic acids, is a novel extraction method which utilizes vertical filtration via a separation membrane and absorbent pad to extract cellular DNA from whole blood in less than 2 min. The blood specimen is treated with detergent, mixed briefly and applied by pipet to the separation membrane. The lysate wicks into the blotting pad due to capillary action, capturing the genomic DNA on the surface of the separation membrane. The extracted DNA is retained on the membrane during a simple wash step wherein PCR inhibitors are wicked into the absorbent blotting pad. The membrane containing the entrapped DNA is then added to the PCR reaction without further purification. This simple method does not require laboratory equipment and can be easily implemented with inexpensive laboratory supplies. Here we describe a protocol for highly sensitive detection and quantitation of HIV-1 proviral DNA from 100 &#181;l whole blood as a model for early infant diagnosis of HIV that could readily be adapted to other genetic targets.

We describe here a simple and rapid paper-based DNA extraction method of HIV proviral DNA from whole blood detected by quantitative PCR. This protocol can be extended for use in detecting other genetic markers or using alternative amplification methods.

Nükleik Asitlerin süzülmesi İzolasyonu: basit ve hızlı DNA izolasyonu,

FINA, filtration isolation of nucleic acids, is a novel extraction method which utilizes vertical filtration via a separation membrane and absorbent pad ...

Glucose Uptake Measurement and Response to Insulin Stimulation in In Vitro Cultured Human Primary Myotubes

Skeletal muscle is the largest glucose deposit in mammals and largely contributes to glucose homeostasis. Assessment of insulin sensitivity of muscle cells is of major relevance for all studies dedicated to exploring muscle glucose metabolism and characterizing metabolic alterations. In muscle cells, glucose transporter type 4 (GLUT4) proteins translocate to the plasma membrane in response to insulin, thus allowing massive entry of glucose into the cell. The ability of muscle cells to respond to insulin by increasing the rate of glucose uptake is one of the standard readouts to quantify muscle cell sensitivity to insulin. Human primary myotubes are a suitable in vitro model, as the cells maintain many features of the donor phenotype, including insulin sensitivity. This in vitro model is also suitable for the test of any compounds that could impact insulin responsiveness. Measurements of the glucose uptake rate in differentiated myotubes reflect insulin sensitivity.
In this method, human primary muscle cells are cultured in vitro to obtain differentiated myotubes, and glucose uptake rates with and without insulin stimulation are measured. We provide a detailed protocol to quantify passive and active glucose transport rates using radiolabeled [3H] 2-deoxy-D-Glucose ([3H]2dG). Calculation methods are provided to quantify active basal and insulin-stimulated rates, as well as stimulation fold.

Glucose Uptake Measurement and Response to Insulin Stimulation in In Vitro Cultured Human Primary Myotubes

In this method, human primary muscle cells are cultured in vitro to obtain differentiated myotubes and glucose uptake rates are measured. We provide a detailed protocol to quantify rates in basal and insulin-stimulated states using radiolabeled [3H] 2-deoxy-D-Glucose.

Glikoz Alımı Ölçümü ve İnsülin Uyarıcısına Yanıt<em&gt; In vitro</em&gt; Kültürlü İnsan Primer Miyotları

Skeletal muscle is the largest glucose deposit in mammals and largely contributes to glucose homeostasis. Assessment of insulin sensitivity of muscle ...

In Vitro and In Vivo Approaches to Determine Intestinal Epithelial Cell Permeability

The intestinal barrier defends against pathogenic microorganism and microbial toxin. Its function is regulated by tight junction permeability and epithelial cell integrity, and disruption of the intestinal barrier function contributes to progression of gastrointestinal and systemic disease. Two simple methods are described here to measure the permeability of intestinal epithelium. In vitro, Caco-2BBe cells are plated in tissue culture wells as a monolayer and transepithelial electrical resistance (TER) can be measured by an epithelial (volt/ohm) meter. This method is convincing because of its user-friendly operation and repeatability. In vivo, mice are gavaged with 4 kDa fluorescein isothiocyanate (FITC)-dextran, and the FITC-dextran concentrations are measured in collected serum samples from mice to determine the epithelial permeability. Oral gavage provides an accurate dose, and therefore is the preferred method to measure the intestinal permeability in vivo. Taken together, these two methods can measure the permeability of the intestinal epithelium in vitro and in vivo, and hence be used to study the connection between diseases and barrier function.

In Vitro and In Vivo Approaches to Determine Intestinal Epithelial Cell Permeability

Two methods are presented here to determine intestinal barrier function. An epithelial meter (volt/ohm) is used for measurements of transepithelial electrical resistance of cultured epithelia directly in tissue culture wells. In mice, the FITC-dextran gavage method is used to determine the intestinal permeability in vivo.