저자는 수신 확인이 없습니다.

1 Concatemerization <ol><li> 재현 탁 프라이머의 Fw 및 오락 용 차 (RV)은 분자 생물학 학년 H 2 O에서 10 μg / μL의 농도로 (프라이머 서열 재료의 표 참조) 그런 다음의 Fw의 5 μL와 1.5 ㎖의 microcentrifuge 관에서, 계 프라이머의 5 μl를 섞는다. </li><li> 15 분 (여기에 설명 된 프라이머 75 ° C) 정확한 열처리 온도에 가열하여 단련 프라이머 믹스. 실온 (RT)에서 냉각 벤치에 둡니다. DDH 2 O.에 용해하여 배양 중에 60 % PEG8000 준비 </li><li> 60 % PEG8000의 50 μL를 추가 배 폴리 뉴클레오티드 키나제 (PNK) 버퍼, H 2 O 27 μL 및 프라이머 믹스 PNK 3 μL의 10 μL (30 %의 최종 농도를 달성하기 위해). 2 시간 동안 37 ° C에서 품어. </li><li> 실온에서 냉각 및 DNA 리가 아제 버퍼의 11 μl를 추가합니다. 그런 다음 DNA 리가 아제의 3 U를 추가하고 밤새 37 ° C에서 배양. </li></ol> 2 DNA 정제및 분석 <ol><li> 결찰 믹스의 볼륨을 높이는 H 2 O의 300 μl를 추가합니다. 참고 : 클로로포름 증기 : 인해 페놀의 독성 흄 후드에서 진행합니다. </li><li> 페놀 1 볼륨 (400 μL) 추가 : 클로로포름을 힘차게 흔들어 섞는다. </li><li> 탁상의 microcentrifuge에서 1 분 동안 최대 속도로 원심 분리기. 수성 및 솔벤트 층 위에 수성 층 두 층 사이에 침전 된 단백질의 흰색 층으로 분리됩니다. </li><li> 주의 피펫 팅하여 새 튜브에 상위 레이어로 이동 (중간 묻지 않도록, 흰색 층) </li><li> 반복 2.2과 2.3의 두 배 이상이나 더 침전 된 단백질을 원심 분리 한 후이 없을 때까지 단계를 반복합니다. </li><li> 클로로포름 1 볼륨 (400 μl를) 추가를 반복 2.3-2.4 단계를 반복합니다. </li><li> 백퍼센트 미리 냉각 에탄올이 볼륨 (800 μL)를 추가하고 적어도 1 시간 또는 하룻​​밤 -20 ° C에서 배양한다. 참고 :이 단계는 DNA의 concatemers을 침전. </li><li> 최대 속도와 대기음 공중으로에 스핀 다운rnatant. 70 % 에탄올 1 ㎖를 추가하여 한 번 세척하고 흄 후드에서 자연 건조 할 수 있습니다. </li><li> 독소 무료 DDH 2 O.의 50 μL에서 재현 탁의 DNA 주 : 엔도톡신 자유 시약의 사용은 세포와 생체 내에서 특정 DNA 선천성 면역 반응을 생성하기에 중요하다. </li><li> 신선한 튜브에 concatemerized DNA의 2 μL 나누어지는를 제거하고 1 ml의 DNA 젤 로딩 버퍼를 추가합니다. </li><li> (오븐과 볼륨의 전력에 적합한 또는 시간) 2 분 동안 전자 레인지에서 최대 전력에 의해 가열 TAE 버퍼의 1 % 아가로 오스를 녹인다. </li><li> , 주조 장치에 젤을 부어 형광 DNA 킬레이트 염료의 4 μl를 추가, 빗 삽입 한 겔 설정하는 약 20 분 동안 실온에 둡니다. </li><li> 일단 설정되면, TAE 버퍼를 포함하는 전기 영동 탱크에 빗과 장소 젤을 제거합니다. 부하의 우물에 DNA 샘플 또는 크기 마커의 3 μL. </li><li> 정전류 90 V에서 30 ~ 40 분 동안 전기 영동을 실행합니다. Visuali&#39;제 자외선 아래에있는 DNA는 concatemerization (그림 1A)를 준수합니다. </li><li> UV 흡광 분광법에 의한 샘플의 나머지 부분에서의 DNA 농도를 측정한다. DNA를 재현 탁하고 200-300 nm 내지 흡광도 스펙트럼을 측정하는 데 사용 된 동일한 DDH 2 O 빈 분광계. 주 : DNA 농도는 흡광도 인 맥주 램버트 법칙, A = 전자 * C 형 * 리터를 사용하여 계산 될 수 있고, 광 경로의 거리를 흡광 계수를 E 및 L. DNA를 측정하기위한 측정해야 260 nm에서 흡광도 0.027 (μg / ㎖)의 흡광 계수 -1 cm -1을 사용 농도. 광경 거리, 난, 분광 광도계에 따라 달라질 수 있습니다. 농도를 측정하는 동안, DNA 순도의 표시로 280 분의 260 nm의 흡광도 비율의 주를 가지고; 위의 2.00의이 비율의 값을 권장합니다. </li></ol> 바이올렛에서 dsDNA Concatemers의 3 형질접근 금지 <ol><li> 조직 배양 접시 또는 접시에 씨앗 세포는 자극의 시간에 70 % 합류한다. </li><li> 1-10 μg / ML의 최종 농도를 이용하여 세포의 자극에 필요한 DNA의 질량을 계산한다. DNA의 요구 질량은 다음과 X로 기록 될 것입니다. 예를 들어 다음, 5 ㎍ / ㎖가 DNA의 DNA의 농도가 2 * 5 = 10 μg의 질량에 배지 2 ㎖과 함께 6 - 웰 플레이트 중 하나의 잘 세포를 자극하는 것이 요구되는 경우. </li><li> 적당한 크기의 멸균 튜브에 혈청 배지의 50 * X μl를 추가합니다. 피펫 조심스럽게 매체의 중심에, 튜브, 2 * X 양이온 성 지질 형질 전환 시약 ㎕의 5 분간 방치의면을 만지지 않고. </li><li> 튜브와 소용돌이 살짝 DNA의 X의 μg을 추가합니다. 적어도 20 분 동안 실온에서 둡니다. 체외 형질은 세포질 DNA 감지 경로를 자극하는 세포에 직접 혼합물을 추가합니다. </li></ol> dsDNA Concatemers I의 4 형질N 비보 <ol><li> 3.1-3.5가 1 μg의 DNA, 2 ㎕의 지질 형질 전환 시약 및 18 ㎕의 혈청 마우스 귀 당 배지를 자극 할을 사용하여 설명에 따라 형질 믹스를 준비합니다. 멸균 된 30 G 바늘 멸균 20 μL 해밀턴 주사기, 모자를 준비하고, DNA 형질 믹스로드합니다. </li><li> 1 ~ 2 % 이소 플루 란 (isoflurane)을 이용 C57BL / 6 마​​우스를 마취. 운동과 일정한 호흡의 손실에 의해 필요한 경우 핀치 반사 검사로 마취를 확인합니다. 마취 중에 동물의 눈을 모니터링하고 과도한 건조를 방지하기 위해 필요에 따라 연고를 사용합니다. </li><li> 멸균 기법을 사용하여 귀 귓바퀴에주의 액체의 단일 &#39;기포&#39;귀의 피부 층 사이에 형성되도록 형질 전환 혼합물의 10 μl를 주입. 주 : 바늘 귀 귓바퀴의 피부의 첫 층을 관통되도록 예각, 엄지 손가락 또는 인덱스에 고무 골무를 사용하여 그 위에 귀를 스트레칭하고, 주사. </li><li> 고삐가 생깁니다 마우스가 다시 케이지에 정기적으로 후 마취 회복을 모니터링 할 수 있습니다. 마취 된 쥐의 과도하게 냉각되지 않도록 가열 램프를 사용한다. 그들은 흉골 드러 누움을 유지하기 위해 충분한 의식을 회복 할 때까지 무인 쥐를 두지 마십시오. </li><li> 플래시는 2 분 동안 액체 질소에 침지 microcentrifuge 관에서 전체 귀 귓바퀴를 동결. </li></ol> 정량 PCR에 의한 DNA 자극 샘플 및 분석의 5 처리 (qPCR에) <ol><li> 흡인 피펫 매체 및 폐기물을 폐기 : 세포 배양에서. </li><li> 멸균 PBS 1 ㎖를 추가합니다. 5.1 및 5.2을 두 번 반복하고 5.3 단계로 진행 </li><li> 귀 조직에서 : 살균 세라믹 봉과 박격포를 사용하여 액체 질소에서 조직을 분쇄 멸균 주걱을 사용하여 microcentrifuge 관에 지상 조직을 전송하고, 5.4 단계로 진행 </li><li> 350 μL 용해 버퍼를 추가 및 상업 RNA 추출 키트 프로토콜로 진행합니다. 추출 키트 정화에서 용출 RNA40 ㎕의 DDH 2 O.에서 열 참고 : 상업 RNA 추출 키트는 아주 잘 작동 (재료 / 장비 표 참조); 다른 기술은 평균 이하의 결과를 테스트되었습니다. </li><li> (2.13) 이상 DNA에 대하여 기술 된 바와 같이 UV 분광법에 의한 RNA 정량화. 주 : RNA에 대한 흡광 계수는 0.025 (μg / ㎖) -1 cm -1이다. </li><li> 올리고 (DT) 프라이머의 멸균 PCR 튜브 1 μl를 추가, 10 밀리미터의 dNTP의 한 UL 혼합하고, 250 μg의 RNA. 멸균 DDH 2 O. 11 μL의 볼륨을 확인 </li><li> 65 ° C에서 5 분 동안 품어. 그런 다음 4 μL 먼저 스트랜드 버퍼, 1 ㎕의 0.1 M 디티 오 트레이 톨을 추가, 0.25 μL 튜브에 효소와 1.75 μL DDH 2 O 역. 15 분 동안 72 ° C 다음에 1 시간 동안 50 ° C에서 품어. O. DDH 2를 사용하여 5 : 임의로, 하나의 cDNA 생성물을 희석 </li><li> 정량 PCR을 사용하여 2 μL의 cDNA, 2 μL의 DDH 2 O, 5 ㎕의 qPCR에 마스터 믹스, 그리고 일에 대한앞으로 10 μM의 각 μL 선택의 유전자 (들)을 증폭하는 프라이머 주식을 역으로 수행하십시오. 96 웰 플레이트에 혼합하고 정량적 PCR 기계 (그림 1B와 1C)를 사용하여 분석 할 수 있습니다. </li></ol>

<ol>
	<li>Yoshida, H., Okabe, Y., Kawane, K., Fukuyama, H., Nagata, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Lethal+anemia+caused+by+interferon-beta+produced+in+mouse+embryos+carrying+undigested+DNA.">Lethal anemia caused by interferon-beta produced in mouse embryos carrying undigested DNA.</a> Nat. Immunol. 6, 49-56 (2005).</li><li>Ishikawa, H., Ma, Z., Barber, G. N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=STING+regulates+intracellular+DNA-mediated,+type+I+interferon-dependent+innate+immunity.">STING regulates intracellular DNA-mediated, type I interferon-dependent innate immunity.</a> Nature. 461, 788-792 (2009).</li><li>Ishii, K. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=TANK-binding+kinase-1+delineates+innate+and+adaptive+immune+responses+to+DNA+vaccines.">TANK-binding kinase-1 delineates innate and adaptive immune responses to DNA vaccines.</a> Nature. 451, 725-729 (2008).</li><li>Stetson, D. B., Medzhitov, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Recognition+of+cytosolic+DNA+activates+an+IRF3-dependent+innate+immune+response.">Recognition of cytosolic DNA activates an IRF3-dependent innate immune response.</a> Immunity. 24, 93-103 (2006).</li><li>Pichlmair, A., Reise Sousa, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Innate+recognition+of+viruses.">Innate recognition of viruses.</a> Immunity. 27, 370-383 (2007).</li><li>Unterholzner, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=IFI16+is+an+innate+immune+sensor+for+intracellular+DNA.">IFI16 is an innate immune sensor for intracellular DNA.</a> Nat. Immunol. 11, 997-1004 (2010).</li><li>Ferguson, B. J., Mansur, D. S., Peters, N. E., Ren, H., Smith, G. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=DNA-PK+is+a+DNA+sensor+for+IRF-3-dependent+innate+immunity.">DNA-PK is a DNA sensor for IRF-3-dependent innate immunity.</a> Elife. 1, e00047 (2012).</li><li>Sun, L., Wu, J., Du, F., Chen, X., Chen, Z. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cyclic+GMP-AMP+synthase+is+a+cytosolic+DNA+sensor+that+activates+the+type+I+interferon+pathway.">Cyclic GMP-AMP synthase is a cytosolic DNA sensor that activates the type I interferon pathway.</a> Science. 339, 786-791 (2013).</li><li>Honda, K., Taniguchi, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=IRFs:+master+regulators+of+signalling+by+Toll-like+receptors+and+cytosolic+pattern-recognition+receptors.">IRFs: master regulators of signalling by Toll-like receptors and cytosolic pattern-recognition receptors.</a> Nat. Rev. Immunol. 6, 644-658 (2006).</li><li>Karayel, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+TLR-independent+DNA+recognition+pathway+in+murine+macrophages:+Ligand+features+and+molecular+signature.">The TLR-independent DNA recognition pathway in murine macrophages: Ligand features and molecular signature.</a> Eur. J. Immunol. 39, 1929-1936 (2009).</li></ol>

The authors have nothing to disclose.

여기에 설명 된 프로토콜은 세포 유형의 넓은 범위에서와 생체 내에서 재현 가능한 결과와 세포질 선천성 면역 반응을 자극하는 dsDNA를 생성하는 데 사용된다. 사용 된 주 기판 시약 합성 올리고 뉴클레오티드이므로, 다른 DNA 서열 또는 화학적 변형을 이용하여 본 시스템의 유연성이있다. 그것은 예를 들어 형광 라벨 또는 현지화를 추적 또는 다른 생체 분자와의 상호 작용을 평가하기 위해...

DNA는 진핵 생물이 특정 구획 유지 모든 생물 세포의 중요한 구성 요소입니다. 이러한 구획화가 고장 경우 또는 선천성 면역 시스템의 한 기능을 확인하는 것입니다 이물질은 실제 외부 장벽의 위반을 통해 생물체에 도입 될 때. 인체 올바른 구획화 벗어날 수도 DNA의 소량이 저하 돕기 위해 존재하는 단백질들이있다; DNase의 I, II 및 III는 각각, 플라즈마, 엔도 솜 및 세포질에서 DNA를 분해. 그러나, 선천성 면역 시스템이 추가 핵 DNA에 응답하는지 DNase의 II를 결핍 된 마우스는 제안 인터페론 하나의 과도한 생산으로 인한 심한 빈혈 죽는 것이 보였다. 이 응답은 심지어 수신자 같은 수용체 신호 용량을 완전히 결핍 아르 쥐에서 발생합니다. 많은 연구는 지금 인터페론 유전자 (STING) 2 TANK 결합 키나제 1 (TB의 자극을 보여 주었다K1) 3은 세포질에서 DNA의 검출에이 신호 전달 경로는 인터페론 조절 인자 (IRF) -3 사를 활성화하는 것이 포함된다. 사이토 카인, 케모카인, 및 인터페론 유전자의 후속 IRF3 의존적 전사가 병원체 또는 위험 관련 분자 패턴 (PAMP 또는 DAMP) (5) 중 하나에 대한 선천성 면역 반응의 특징이다. 세포 내 핵산 검출 경로를 연구하는 욕구는 다른 선천성 면역 반응을 활성화하지 않고 세포 내로 DNA 또는 RNA를 도입하여 세포를 자극 견고하고 재생 가능한 방법을 개발할 필요하게되었다. STING / TBK1 / IRF3 경로를 자극 할 수있는 한 가지 방법은이 같은 DNA-PK, IFI16 및 CGAS 6-8로 DNA 센서에 의해 액세스 할 수있는 세포질로 핵산을 제공하는 양이온 성 지질 형질 전환 시약을 사용하는 것입니다. 현재 EFF을 허용하는 것으로 이해되는 DNA의 특성다른 경로의 자극없이 세포질 선천성 면역 반응의 icient 활성화 된 CpG의 길이, 질량, 순도, 및 부족 4,7,9 모티프입니다. 합성 올리고 뉴클레오티드가 DNA 서열 최적화 및 순수한 화학 종으로 제조 할 수 있도록 같은 선천성 면역 반응을 생성하는 목적에 매우 적합하다. 45 염기쌍 면역 자극 DNA (ISD) 서열은 이러한 목적에 적합 된 CpG 서열이없는 것으로 홍길동 외. (4)에 의해 확인되었다. 이 dsDNA 순서는, 그렇지 않으면 무작위와의 CpG 모티프의 부족을 넘어 특별한 기능이 없습니다. 우리는 훨씬 더 긴 가닥으로 ISD 올리고 뉴클레오타이드를 concatemerizing 의해 자극 (7)의 크기를 증가 시킨다는 것을 발견 하였다. concatemerized ISD의 세대는 세포질 선천성 면역 반응을 자극하므로 유용합니다. 여기에서는이 시약을 제조하는 프로토콜을 제시하고는 DNA에서 감지 경로를 활성화 할 수있는 방법생체 내에서뿐만 아니라 체외. 참고 : 모든 동물 연구 승인 기관 프로토콜 및 동물 관리 지침에 따라 수행된다.

<table border="0" cellpadding="0" cellspacing="0" width="1066">
	<tbody>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">Forward Primer</td>
			<td style="width:221px;">Integrated DNA technologies</td>
			<td style="width:144px;">n/a</td>
			<td style="width:407px;">TACAGATCTACTAGTGATCTATGACTGATCTGTACATGATCTACA</td>
		</tr>
		<tr height="19">
			<td height="19" style="height:19px;width:295px;">Reverse Primer</td>
			<td style="width:221px;">Integrated DNA technologies</td>
			<td style="width:144px;">n/a</td>
			<td>TGTAGATCATGTACAGATCAGTCATAGATCACTAGTAGATCTGTA</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">PEG8000</td>
			<td style="width:221px;">Sigma-Aldrich</td>
			<td style="width:144px;">P-4463</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">Molecular biology grade water</td>
			<td style="width:221px;">Sigma-Aldrich</td>
			<td style="width:144px;">W4502-1L</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">T4 Polynucleotide Kinase</td>
			<td style="width:221px;">Promega</td>
			<td style="width:144px;">M4101</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">T4 DNA Ligase</td>
			<td style="width:221px;">Promega</td>
			<td style="width:144px;">M1801</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">Phenol:Chloroform</td>
			<td style="width:221px;">Fisher Chemical</td>
			<td style="width:144px;">BPE1752p-400</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">Chloroform</td>
			<td style="width:221px;">Fisher Chemical</td>
			<td style="width:144px;">C/4960/PB08</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">Ethanol</td>
			<td style="width:221px;">Sigma-Aldrich</td>
			<td style="width:144px;">32221-2.5L</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">DNA gel loading buffer</td>
			<td style="width:221px;">New England biolabs</td>
			<td style="width:144px;">B7021S</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">Agarose</td>
			<td style="width:221px;">Bioline</td>
			<td style="width:144px;">BIO-41025</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">Optimem</td>
			<td style="width:221px;">Life Technologies</td>
			<td style="width:144px;">11058021</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">TransIT-LT1&#160;</td>
			<td style="width:221px;">Mirus Bioscience</td>
			<td style="width:144px;">MIR 2300</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">Hamilton Syringe</td>
			<td style="width:221px;">Hamilton</td>
			<td style="width:144px;">80901 Model 1705</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">30G needles&#160;</td>
			<td style="width:221px;">BD bioscience</td>
			<td style="width:144px;">304000</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">SYBR Safe DNA gel stain</td>
			<td style="width:221px;">Life Technologies</td>
			<td style="width:144px;">S33102</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">Rneasy Plus Mini Kit</td>
			<td style="width:221px;">Qiagen</td>
			<td style="width:144px;">74134</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">Oligo(dT) primer</td>
			<td style="width:221px;">Thermo Scientific</td>
			<td style="width:144px;">SO131</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">dNTP mix</td>
			<td style="width:221px;">Fermentas</td>
			<td style="width:144px;">R0192</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">Super Script III reverse transcriptase</td>
			<td style="width:221px;">Life Technologies</td>
			<td align="right" style="width:144px;">56575</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">First strand cDNA synthesis buffer</td>
			<td style="width:221px;">Life Technologies</td>
			<td style="width:144px;">y02321</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">SybrGreen qPCR Fast master mix</td>
			<td style="width:221px;">Applied Biosystems</td>
			<td align="right" style="width:144px;">4385612</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">cxcl10 murine forward primer&#160;</td>
			<td style="width:221px;">Integrated DNA technologies</td>
			<td style="width:144px;">n/a</td>
			<td>ACTGCATCCATATCGATGAC</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">cxcl10 murine reverse primer</td>
			<td style="width:221px;">Integrated DNA technologies</td>
			<td style="width:144px;">n/a</td>
			<td>TTCATCGTGGCAATGATCTC</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">il6 murine forward primer&#160;</td>
			<td style="width:221px;">Integrated DNA technologies</td>
			<td style="width:144px;">n/a</td>
			<td>GTAGCTATGGTACTCCAGAAGAC</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">il6 murine forward primer&#160;</td>
			<td style="width:221px;">Integrated DNA technologies</td>
			<td style="width:144px;">n/a</td>
			<td>GTAGCTATGGTACTCCAGAAGAC</td>
		</tr>
	</tbody>
</table>

stimulation of cytoplasmic dna sensing pathways in vitro and in vivo

효율적 선천성 면역 반응을 자극하기 위해, DNA는 충분한 길이 여야 순도. 우리는 필요한 특성을 갖는 이중 가닥 DNA (dsDNA)를 검출 경로가 저렴하고 용이하게 생성 할 수있는 세포 내 DNA를 자극하는 방법을 제시한다. 단, 합성 올리고 뉴클레오티드 (않은 CpG 모티프를 결여한다)의 concatemerization으로 dsDNA는 세포질 DNA 감지 경로를 활성화하기에 충분한 길이로 생성 될 수있다. 이 프로토콜은 효율적인 결찰 발생하기위한 환경을 제공하는 폴리에틸렌 글리콜의 존재 (PEG)의 올리고 뉴클레오티드의 블런트 엔드 라이 게이션을 포함한다. dsDNA concatemers의 표준 프로토콜에 의해 형질 전환 체외에서 선천성 면역 반응을 시뮬레이션하기 위해, 페놀 / 클로로포름 추출에 의해 정제하여 다음을 사용할 수있다. 이 DNA는 또한 예를 들어, 마우스의 귀에 귓바퀴에 피내 주사함으로써 생체 내에서의 선천성 면역을 자극하는 데 사용될 수있다. 으로concatemerization 프로세스 및 후속 자극 프로토콜을 표준화하고, 선천성 면역계의 신뢰성 및 재현성 활성화가 제조 될 수있다.

<html> 아래 결과는 concatemerized DNA가 상대적으로 쉽게 생성 세포와 마우스에서 강력한 선천성 면역 반응을 자극 할 수 있음을 나타낸다. PEG8000의 사용으로, 명확 생성되는 DNA의 길이가 상당히 길어 CXCL10의 전사를 유도 할 수있는 동등 함을 알 수있다. 아가 로즈 겔 분석으로 알 수있는 바와 같이 PEG8000과 샘플, DNA의 길이가 10000 BP (도 1a)을 초과하는 가닥을 포함하는 반면, 표준 concatemerizati...

Watch this Scientific Journal Video about Stimulation of Cytoplasmic DNA Sensing Pathways In Vitro and In Vivo at JoVE.com

Stimulation of Cytoplasmic DNA Sensing Pathways In Vitro and In Vivo

프로토콜의 목적은 세포 및 생체 내에서 세포 내 DNA의 촬상 경로를 자극하는 최적의 방법을 사용하는 것이다. 이것은 블런트 엔드 라이 게이션시 긴 이중 가닥 DNA의 생성을 향상시킴으로써 달성된다. 세포 또는 마우스는 지질 형질 감염 시약을 이용하여 형질 전환된다.

세포질 DNA 검출 진학의 자극<em&gt; 체외</em&gt;와<em&gt; 생체</em

In order to efficiently stimulate an innate immune response, DNA must be of sufficient length and purity. We present a method where double stranded DNA ...

stimulation-of-cytoplasmic-dna-sensing-pathways-in-vitro-and-in-vivo

Research

JoVE Journal

Biology

Stimulation of Cytoplasmic DNA Sensing Pathways In Vitro and In Vivo

8.8K 조회수.  University of Cambridge.  프로토콜의 목적은 세포 및 생체 내에서 세포 내 DNA의 촬상 경로를 자극하는 최적의 방법을 사용하는 것이다. 이것은 블런트 엔드 라이 게이션시 긴 이중 가닥 DNA의 생성을 향상시킴으로써 달성된다. 세포 또는 마우스는 지질 형질 감염 시약을 이용하여 형질 전환된다. 

비디오: Stimulation of Cytoplasmic DNA Sensing Pathways In Vitro and In Vivo

In vitro and in vivo Bioluminescence Reporter Gene Imaging of Human Embryonic Stem Cells

The discovery of human embryonic stem cells (hESCs) has dramatically increased the tools available to medical scientists interested in regenerative medicine. However, direct injection of hESCs, and cells differentiated from hESCs, into living organisms has thus far been hampered by significant cell death, teratoma formation, and host immune rejection. Understanding the in vivo hESC behavior after transplantation requires novel imaging techniques to longitudinally monitor hESC localization, proliferation, and viability. Molecular imaging has given investigators a high-throughput, inexpensive, and sensitive means for tracking in vivo cell proliferation over days, weeks, and even months. This advancement has significantly increased the understanding of the spatio-temporal kinetics of hESC engraftment, proliferation, and teratoma-formation in living subjects.

A major advance in molecular imaging has been the extension of noninvasive reporter gene assays from molecular and cellular biology into in vivo multi-modality imaging platforms. These reporter genes, under control of engineered promoters and enhancers that take advantage of the host cell s transcriptional machinery, are introduced into cells using a variety of vector and non-vector methods. Once in the cell, reporter genes can be transcribed either constitutively or only under specific biological or cellular conditions, depending on the type of promoter used. Transcription and translation of reporter genes into bioactive proteins is then detected with sensitive, noninvasive instrumentation (e.g., CCD cameras) using signal-generating probes such as D-luciferin.

To avoid the need for excitatory light to track stem cells in vivo as is required for fluorescence imaging, bioluminescence reporter gene imaging systems require only an exogenously administered probe to induce light emission. Firefly luciferase, derived from the firefly Photinus pyralis, encodes an enzyme that catalyzes D-luciferin to the optically active metabolite, oxyluciferin. Optical activity can then be monitored with an external CCD camera. Stably transduced cells that carry the reporter construct within their chromosomal DNA will pass the reporter construct DNA to daughter cells, allowing for longitudinal monitoring of hESC survival and proliferation in vivo. Furthermore, because expression of the reporter gene product is required for signal generation, only viable parent and daughter cells will create bioluminescence signal; apoptotic or dead cells will not. 

In this video, the specific materials and methods needed for tracking stem cell proliferation and teratoma formation with bioluminescence imaging will be described.

With the growing interest in stem cell therapies, molecular imaging techniques are ideal for monitoring stem cell behavior after transplantation. Luciferase reporter genes have enabled non-invasive, repetitive assessment of cell survival, location, and proliferation in vivo. This video will demonstrate how to track hESC proliferation in a living mouse.

체외에서 인간 배아 줄기 세포의 생체내의 Bioluminescence 리포터 진 영상에

The discovery of human embryonic stem cells (hESCs) has dramatically increased the tools available to medical scientists interested in regenerative ...

연구

생물학

DNA Transfection of Mammalian Skeletal Muscles using In Vivo Electroporation

A growing interest in cell biology is to express transgenically modified forms of essential proteins (e.g. fluorescently tagged constructs and/or mutant variants) in order to investigate their endogenous distribution and functional relevance. An interesting approach that has been implemented to fulfill this objective in fully differentiated cells is the in vivo transfection of plasmids by various methods into specific tissues such as liver1, skeletal muscle2,3, and even the brain4. We present here a detailed description of the steps that must be followed in order to efficiently transfect genetic material into fibers of the flexor digitorum brevis (FDB) and interosseus (IO) muscles of adult mice using an in vivo electroporation approach. The experimental parameters have been optimized so as to maximize the number of muscle fibers transfected while minimizing tissue damages that may impair the quality and quantity of the proteins expressed in individual fibers. We have verified that the implementation of the methodology described in this paper results in a high yield of soluble proteins, i.e. EGFP and ECFP3, calpain, FKBP12, &beta;2a-DHPR, etc. ; structural proteins, i.e. minidystrophin and &alpha;-actinin; and membrane proteins, i.e. &alpha;1s-DHPR, RyR1, cardiac Na/Ca2+ exchanger , NaV1.4 Na channel, SERCA1, etc., when applied to FDB, IO and other muscles of mice and rats. The efficient expression of some of these proteins has been verified with biochemical3 and functional evidence5. However, by far the most common confirmatory approach used by us are standard fluorescent microscopy and 2-photon laser scanning microscopy (TPLSM), which permit to identify not only the overall expression, but also the detailed intracellular localization, of fluorescently tagged protein constructs. The method could be equally used to transfect plasmids encoding for the expression of proteins of physiological relevance (as shown here), or for interference RNA (siRNA) aiming to suppress the expression of normally expressed proteins (not tested by us yet). It should be noted that the transfection of FDB and IO muscle fibers is particularly relevant for the investigation of mammalian muscle physiology since fibers enzymatically dissociated from these muscles are currently one of the most suitable models to investigate basic mechanisms of excitability and excitation-contraction coupling under current or voltage clamp conditions2,6-8.

DNA Transfection of Mammalian Skeletal Muscles using In Vivo Electroporation

We describe detailed procedures for the efficient transfection of plasmid DNA into the fibers of foot muscles of live mice using electroporation and the subsequent visualization of protein expression using fluorescence microscopy.

사용 포유류 골격 근육의 유전자 Transfection VIVO에서 Electroporation

 A growing interest in cell biology is to express transgenically modified forms of essential proteins (e.g. fluorescently tagged constructs and/or mutant ...

In vivo and in vitro Studies of Adaptor-clathrin Interaction

A major endocytic pathway initiates with the formation of clathrin-coated vesicles (CCVs) that transport cargo from the cell surface to endosomes1-6. CCVs are distinguished by a polyhedral lattice of clathrin that coats the vesicle membrane and serves as a mechanical scaffold. Clathrin coats are assembled during vesicle formation from individual clathrin triskelia , the soluble form of clathrin composed of three heavy and three light chain subunits7,8. Because the triskelion does not have the ability to bind to the membrane directly, clathrin-binding adaptors are critical to link the forming clathrin lattice to the membrane through association with lipids and/or membrane proteins9. Adaptors also package transmembrane protein cargo, such as receptors, and can interact with each other and with other components of the CCV formation machinery9.
Over twenty clathrin adaptors have been described, several are involved in clathrin mediated endocytosis and others localize to the trans Golgi network or endosomes9. With the exception of HIP1R (yeast Sla2p), all known clathrin adaptors bind to the N-terminal -propeller domain of the clathrin heavy chain9. Clathrin adaptors are modular proteins consisting of folded domains connected by unstructured flexible linkers. Within these linker regions, short binding motifs mediate interactions with the clathrin N-terminal domain or other components of the vesicle formation machinery9. Two distinct clathrin-binding motifs have been defined: the clathrin-box and the W-box9. The consensus clathrin-box sequence was originally defined as L[L/I][D/E/N][L/F][D/E]10 but variants have been subsequently discovered11. The W-box conforms to the sequence PWxxW (where x is any residue).
Sla1p (Synthetic Lethal with Actin binding protein-1) was originally identified as an actin associated protein and is necessary for normal actin cytoskeleton structure and dynamics at endocytic sites in yeast cells12. Sla1p also binds the NPFxD endocytic sorting signal and is critical for endocytosis of cargo bearing the NPFxD signal13,14. More recently, Sla1p was demonstrated to bind clathrin through a motif similar to the clathrin box, LLDLQ, termed a variant clathrin-box (vCB), and to function as an endocytic clathrin adaptor15. In addition, Sla1p has become a widely used marker for the endocytic coat in live cell fluorescence microscopy studies16. Here we use Sla1p as a model to describe approaches for adaptor-clathrin interaction studies. We focus on live cell fluorescence microscopy, GST-pull down, and co-immunoprecipitation methods.

In vivo and in vitro Studies of Adaptor-clathrin Interaction

Clathrin-mediated endocytosis depends on adaptor proteins that coordinate cargo selection and clathrin coat assembly. Here we describe procedures to study adaptor-clathrin physical interaction and live cell imaging approaches using as a model the yeast endocytic adaptor protein Sla1p.

생체내 및 아답터 - clathrin 상호 작용의 체외 연구에서

A major endocytic pathway initiates with the formation of clathrin-coated vesicles (CCVs) that transport cargo from the cell surface to endosomes1-6. CCVs ...

Visualization of MG53-mediated Cell Membrane Repair Using in vivo and in vitro Systems

Repair of acute injury to the cell membrane is an elemental process of normal cellular physiology, and defective membrane repair has been linked to many degenerative human diseases. The recent discovery of MG53 as a key component of the membrane resealing machinery allows for a better molecular understanding of the basic biology of tissue repair, as well as for potential translational applications in regenerative medicine. Here we detail the experimental protocols for exploring the in vivo function of MG53 in repair of muscle injury using treadmill exercise protocols on mouse models, for testing the ex vivo membrane repair capacity by measuring dye entry into isolated muscle fibers, and for monitoring the dynamic process of MG53-mediated vesicle trafficking and cell membrane repair in cultured cells using live cell confocal microscopy.

Visualization of MG53-mediated Cell Membrane Repair Using in vivo and in vitro Systems

Described here are protocols used to visualize the dynamic process of MG53-mediated cell membrane repair in whole animals and at the cellular level. These methods can be applied to investigate the cell biology of plasma membrane resealing and regenerative medicine.

사용 MG53 - 중재 세포막 수리의 시각화 생체내에과 체외에서 시스템

Repair of acute injury to the cell membrane is an elemental process of normal cellular physiology, and defective membrane repair has been linked to many ...

Activation of Apoptosis by Cytoplasmic Microinjection of Cytochrome c

Apoptosis, or programmed cell death, is a conserved and highly regulated pathway by which cells die1. Apoptosis can be triggered when cells encounter a wide range of cytotoxic stresses. These insults initiate signaling cascades that ultimately cause the release of cytochrome c from the mitochondrial intermembrane space to the cytoplasm2. The release of cytochrome c from mitochondria is a key event that triggers the rapid activation of caspases, the key cellular proteases which ultimately execute cell death3-4.
The pathway of apoptosis is regulated at points upstream and downstream of cytochrome c release from mitochondria5. In order to study the post-mitochondrial regulation of caspase activation, many investigators have turned to direct cytoplasmic microinjection of holocytochrome c (heme-attached) protein into cells6-9. Cytochrome c is normally localized to the mitochondria where attachment of a heme group is necessary to enable it to activate apoptosis10-11. Therefore, to directly activate caspases, it is necessary to inject the holocytochrome c protein instead of its cDNA, because while the expression of cytochrome c from cDNA constructs will result in mitochondrial targeting and heme attachment, it will be sequestered from cytosolic caspases. Thus, the direct cytosolic microinjection of purified heme-attached cytochrome c protein is a useful tool to mimic mitochondrial cytochrome c release and apoptosis without the use of toxic insults which cause cellular and mitochondrial damage.
In this article, we describe a method for the microinjection of cytochrome c protein into cells, using mouse embryonic fibroblasts (MEFs) and primary sympathetic neurons as examples. While this protocol focuses on the injection of cytochrome c for investigations of apoptosis, the techniques shown here can also be easily adapted for microinjection of other proteins of interest.

Activation of Apoptosis by Cytoplasmic Microinjection of Cytochrome c

In this protocol, we describe the direct cytoplasmic microinjection of cytochrome c protein into fibroblasts and primary sympathetic neurons. This technique allows for the introduction of cytochrome c protein into the cytoplasm of cells and mimics the release of cytochrome c from mitochondria, which occurs during apoptosis.

시토크롬의 세포질 Microinjection 의한 Apoptosis의 활성화 C</em

Apoptosis, or programmed cell death, is a conserved and highly regulated pathway by which cells die1.  Apoptosis can be triggered when cells encounter a ...

Isolation of Ribosome Bound Nascent Polypeptides in vitro to Identify Translational Pause Sites Along mRNA

The rate of translational elongation is non-uniform. mRNA secondary structure, codon usage and mRNA associated proteins may alter ribosome movement on the messagefor review see 1. However, it's now widely accepted that synonymous codon usage is the primary cause of non-uniform translational elongation rates1. Synonymous codons are not used with identical frequency. A bias exists in the use of synonymous codons with some codons used more frequently than others2. Codon bias is organism as well as tissue specific2,3. Moreover, frequency of codon usage is directly proportional to the concentrations of cognate tRNAs4. Thus, a frequently used codon will have higher multitude of corresponding tRNAs, which further implies that a frequent codon will be translated faster than an infrequent one. Thus, regions on mRNA enriched in rare codons (potential pause sites) will as a rule slow down ribosome movement on the message and cause accumulation of nascent peptides of the respective sizes5-8. These pause sites can have functional impact on the protein expression, mRNA stability and protein foldingfor review see 9. Indeed, it was shown that alleviation of such pause sites can alter ribosome movement on mRNA and subsequently may affect the efficiency of co-translational (in vivo) protein folding1,7,10,11. To understand the process of protein folding in vivo, in the cell, that is ultimately coupled to the process of protein synthesis it is essential to gain comprehensive insights into the impact of codon usage/tRNA content on the movement of ribosomes along mRNA during translational elongation.
Here we describe a simple technique that can be used to locate major translation pause sites for a given mRNA translated in various cell-free systems6-8. This procedure is based on isolation of nascent polypeptides accumulating on ribosomes during in vitro translation of a target mRNA. The rationale is that at low-frequency codons, the increase in the residence time of the ribosomes results in increased amounts of nascent peptides of the corresponding sizes. In vitro transcribed mRNA is used for in vitro translational reactions in the presence of radioactively labeled amino acids to allow the detection of the nascent chains. In order to isolate ribosome bound nascent polypeptide complexes the translation reaction is layered on top of 30% glycerol solution followed by centrifugation. Nascent polypeptides in polysomal pellet are further treated with ribonuclease A and resolved by SDS PAGE. This technique can be potentially used for any protein and allows analysis of ribosome movement along mRNA and the detection of the major pause sites. Additionally, this protocol can be adapted to study factors and conditions that can alter ribosome movement and thus potentially can also alter the function/conformation of the protein.

Isolation of Ribosome Bound Nascent Polypeptides in vitro to Identify Translational Pause Sites Along mRNA

A technique to identify translational pause sites on mRNA is described. This procedure is based on isolation of nascent polypeptides accumulating on ribosomes during in vitro translation of a target mRNA, followed by the size analysis of the nascent chains using a denaturing gel electrophoresis.

Ribosome 바운드 초기 Polypeptides의 분리<em&gt; 체외에서</em&gt; mRNA 함께 Translational 일시 중지 사이트를 식별하려면

The rate of translational elongation is non-uniform. mRNA secondary structure, codon usage and mRNA associated proteins may alter ribosome movement on the ...

The c-FOS Protein Immunohistological Detection: A Useful Tool As a Marker of Central Pathways Involved in Specific Physiological Responses In Vivo and Ex Vivo

Many studies seek to identify and map the brain regions involved in specific physiological regulations. The proto-oncogene c-fos, an immediate early gene, is expressed in neurons in response to various stimuli. The protein product can be readily detected with immunohistochemical techniques leading to the use of c-FOS detection to map groups of neurons that display changes in their activity. In this article, we focused on the identification of brainstem neuronal populations involved in the ventilatory adaptation to hypoxia or hypercapnia. Two approaches were described to identify involved neuronal populations in vivo in animals and ex vivo in deafferented brainstem preparations. In vivo, animals were exposed to hypercapnic or hypoxic gas mixtures. Ex vivo, deafferented preparations were superfused with hypoxic or hypercapnic artificial cerebrospinal fluid. In both cases, either control in vivo animals or ex vivo preparations were maintained under normoxic and normocapnic conditions. The comparison of these two approaches allows the determination of the origin of the neuronal activation i.e., peripheral and/or central. In vivo and ex vivo, brainstems were collected, fixed, and sliced into sections. Once sections were prepared, immunohistochemical detection of the c-FOS protein was made in order to identify the brainstem groups of cells activated by hypoxic or hypercapnic stimulations. Labeled cells were counted in brainstem respiratory structures. In comparison to the control condition, hypoxia or hypercapnia increased the number of c-FOS labeled cells in several specific brainstem sites that are thus constitutive of the neuronal pathways involved in the adaptation of the central respiratory drive.

The c-FOS Protein Immunohistological Detection: A Useful Tool As a Marker of Central Pathways Involved in Specific Physiological Responses In Vivo and Ex Vivo

Here, we present a protocol based on c-FOS protein immunohistological detection, a classical technique used for the identification of neuronal populations involved in specific physiological responses in vivo and ex vivo.

은 C-FOS 단백질 면역 조직 검색 : 특정 생리적 반응에 관여 중앙 진학의 마커로서 유용한 도구<em&gt; 생체</em&gt; 및<em&gt; 전의 VIVO</em

Many studies seek to identify and map the brain regions involved in specific physiological regulations. The proto-oncogene c-fos, an immediate early gene, ...

Filtration Isolation of Nucleic Acids:  A Simple and Rapid DNA Extraction Method

FINA, filtration isolation of nucleic acids, is a novel extraction method which utilizes vertical filtration via a separation membrane and absorbent pad to extract cellular DNA from whole blood in less than 2 min. The blood specimen is treated with detergent, mixed briefly and applied by pipet to the separation membrane. The lysate wicks into the blotting pad due to capillary action, capturing the genomic DNA on the surface of the separation membrane. The extracted DNA is retained on the membrane during a simple wash step wherein PCR inhibitors are wicked into the absorbent blotting pad. The membrane containing the entrapped DNA is then added to the PCR reaction without further purification. This simple method does not require laboratory equipment and can be easily implemented with inexpensive laboratory supplies. Here we describe a protocol for highly sensitive detection and quantitation of HIV-1 proviral DNA from 100 &#181;l whole blood as a model for early infant diagnosis of HIV that could readily be adapted to other genetic targets.

We describe here a simple and rapid paper-based DNA extraction method of HIV proviral DNA from whole blood detected by quantitative PCR. This protocol can be extended for use in detecting other genetic markers or using alternative amplification methods.

핵산의 여과 분리 : 간단하고 신속한 DNA 추출 방법

FINA, filtration isolation of nucleic acids, is a novel extraction method which utilizes vertical filtration via a separation membrane and absorbent pad ...

Glucose Uptake Measurement and Response to Insulin Stimulation in In Vitro Cultured Human Primary Myotubes

Skeletal muscle is the largest glucose deposit in mammals and largely contributes to glucose homeostasis. Assessment of insulin sensitivity of muscle cells is of major relevance for all studies dedicated to exploring muscle glucose metabolism and characterizing metabolic alterations. In muscle cells, glucose transporter type 4 (GLUT4) proteins translocate to the plasma membrane in response to insulin, thus allowing massive entry of glucose into the cell. The ability of muscle cells to respond to insulin by increasing the rate of glucose uptake is one of the standard readouts to quantify muscle cell sensitivity to insulin. Human primary myotubes are a suitable in vitro model, as the cells maintain many features of the donor phenotype, including insulin sensitivity. This in vitro model is also suitable for the test of any compounds that could impact insulin responsiveness. Measurements of the glucose uptake rate in differentiated myotubes reflect insulin sensitivity.
In this method, human primary muscle cells are cultured in vitro to obtain differentiated myotubes, and glucose uptake rates with and without insulin stimulation are measured. We provide a detailed protocol to quantify passive and active glucose transport rates using radiolabeled [3H] 2-deoxy-D-Glucose ([3H]2dG). Calculation methods are provided to quantify active basal and insulin-stimulated rates, as well as stimulation fold.

Glucose Uptake Measurement and Response to Insulin Stimulation in In Vitro Cultured Human Primary Myotubes

In this method, human primary muscle cells are cultured in vitro to obtain differentiated myotubes and glucose uptake rates are measured. We provide a detailed protocol to quantify rates in basal and insulin-stimulated states using radiolabeled [3H] 2-deoxy-D-Glucose.

포도당 섭취량 측정 및 인슐린 자극에 대한 반응<em&gt; In Vitro</em&gt; 배양 된 사람의 주요 근육 세포

Skeletal muscle is the largest glucose deposit in mammals and largely contributes to glucose homeostasis. Assessment of insulin sensitivity of muscle ...

In Vitro and In Vivo Approaches to Determine Intestinal Epithelial Cell Permeability

The intestinal barrier defends against pathogenic microorganism and microbial toxin. Its function is regulated by tight junction permeability and epithelial cell integrity, and disruption of the intestinal barrier function contributes to progression of gastrointestinal and systemic disease. Two simple methods are described here to measure the permeability of intestinal epithelium. In vitro, Caco-2BBe cells are plated in tissue culture wells as a monolayer and transepithelial electrical resistance (TER) can be measured by an epithelial (volt/ohm) meter. This method is convincing because of its user-friendly operation and repeatability. In vivo, mice are gavaged with 4 kDa fluorescein isothiocyanate (FITC)-dextran, and the FITC-dextran concentrations are measured in collected serum samples from mice to determine the epithelial permeability. Oral gavage provides an accurate dose, and therefore is the preferred method to measure the intestinal permeability in vivo. Taken together, these two methods can measure the permeability of the intestinal epithelium in vitro and in vivo, and hence be used to study the connection between diseases and barrier function.

In Vitro and In Vivo Approaches to Determine Intestinal Epithelial Cell Permeability

Two methods are presented here to determine intestinal barrier function. An epithelial meter (volt/ohm) is used for measurements of transepithelial electrical resistance of cultured epithelia directly in tissue culture wells. In mice, the FITC-dextran gavage method is used to determine the intestinal permeability in vivo.