Este trabalho foi apoiado em parte pelo National Institutes of Health concede 5T32AI7493-20 e 5R01AI089337-03. Os financiadores não tiveram nenhum papel no desenho do estudo, coleta de dados e análise, decisão de publicar ou preparação do manuscrito.

A Universidade de Alabama em Birmingham Institucional Uso de Animais e Cuidados Comissão aprovou o uso de ratos como aqui descrito sob o número de protocolo aprovado 101.109.272. 1. Genético Construção de um plasmídeo modificado pAd5 / H5-HVR1-Kwas-HVR5-His 6 com a Estratégia Capsid-Incorporação Antigen <ol><li> Construção do plasmídeo de transporte 6 / pH5S Seus HVR1-Kwas-HVR5- <ol><li> Peça um plasmídeo contendo a sequência de ADN sintetizada HVR1-Kwas entre a locais de enzimas de restrição Agel para Accl do gene hexon5. </li><li> Digerir 6 ug do fragmento sintetizado (HVR1-Kwas) com as enzimas de AgeI (6 unidades) e Accl (6 unidades) durante 3 horas a 37 ° C. Resolver o fragmento digerido em um 2% de gel de agarose por electroforese, e purifica-se o fragmento com um kit de extracção de gel de ADN de acordo com o protocolo do fabricante. </li><li> Com base na razão molar de inserto para vector a 3: 1, utilizar ligase de ADN T4 e ligase de bpode ser prejudicado para ligar 12 ng do fragmento (HVR1-Kwas) em 100 ng de um plasmídeo de transporte previamente construído HVR5-His 6 / pH5S 17 num volume de 10 ul à temperatura ambiente durante 2 horas, através dos locais de AgeI e Accl. </li><li> Transformar 1 ul dos 10 ul do produto de ligação em 50 ul de células DH5a electrocompetentes num electroporador (a 1800 V). Adicionar 950 ul de meio SOC para as células DH5a transformadas e incubar a mistura durante 1 hora a 37 ° C, com 300 rpm. Espalhe 100-200 ul da mistura de 1 mL de ágar Luria-Bertani (LB) contendo canamicina e incubar O / N a 37 ° C. <ol><li> À tela ~ 10 colônias por PCR visando o fragmento HVR1-Kwas, misturar o iniciador directo (TATGTGTGTCATGTATGCGT), primário (GGAGGCCCACTTGTCCAGCTC) e uma única colônia DH5ct reverter em uma solução de mistura principal PCR (de acordo com o protocolo do fabricante). Amostras em um termociclador executado por referindo-se ao manual fornecido com a solução de PCR mistura principal. </li><li> Use o primer forward (TATGTGTGTCATGTATGCGT) para sequenciar o fragmento HVR1-Kwas nos clones selecionados na seção 1.1.4.1. </li></ol></li></ol></li><li> Construção do plasmídeo pAd5 / H5-HVR1-Kwas HVR5-6-His <ol><li> Digest 6 ug de HVR1-Kwas HVR5-His-6 / pH5S com as enzimas EcoRI (6 unidades) e PmeI (6 unidades) durante 3 horas a 37 ° C, e purifica-se o fragmento contendo braços de recombinação homóloga e o gene modificado hexon5 dupla, tal como indicado no passo 1.1.2. Linearizar o plasmídeo backbone pAd5 / ΔH5 (GL) com 16 SwaI. </li><li> A co-transformar a 100 ng do fragmento de alvo a partir do plasmídeo de transporte e 100 ng do esqueleto linearizado pAd5 / ΔH5 (GL) em 50 ul de células BJ5183 electrocompetentes para a recombinação homóloga num electroporador (a 1800 V). Adicionar 950 ul de meio SOC para as células transformadas e incubar a mistura durante 1 hora a 37 ° C, 300 rpm. Espalhe 100-200 uL da mistura de 1 mLno agar LB contendo canamicina (Final 50 ug / ml) de O / N incubação a 37 ° C. <ol><li> Escolha ~ 10 pequenas colónias em 3 ml de LB líquido contendo canamicina (final de 50 ug / ml) de O / N a incubação num agitador (250 rpm, 37 ° C). Extrair plasmídeos a partir da cultura. Use análise de PCR para rastrear as 10 colónias por alvo o fragmento HVR1-Kwas, como ilustrado no passo 1.1.4.1. </li><li> Para rastrear os mesmos colónias por análise de PCR para o fragmento pIX do genoma espinha dorsal, misturar o iniciador directo (AGCTGTTGGATCTGCGCCAGCAGGTT), iniciador inverso (CCAAACAGAGTCTGGTTTTTTATTTAT) e uma única colónia BJ5183 em uma solução de mistura principal de PCR (de acordo com o protocolo do fabricante). Amostras executado em um termociclador, referindo-se o manual fornecido com a solução de mistura principal PCR. </li><li> Designar as colônias de PCR duplo-positivas como pAd5 / H5-HVR1-Kwas-HVR5-His 6. </li></ol></li><li> Transformar 100 ng do plasmídeo pAd5 / H5-HVR1-Kwas-HVR5-His 6 nopara células DH5a tal como ilustrado no passo 1.1.4. <ol><li> Use a análise PCR para rastrear ~ 10 colônias visando o fragmento HVR1-Kwas, conforme ilustrado na etapa 1.1.4.1. </li><li> Use análise de PCR para rastrear os mesmos colónias por alvo o fragmento pIX do genoma de espinha dorsal, como ilustrado no passo 1.2.2.2. </li><li> Use o primer forward (TATGTGTGTCATGTATGCGT) para sequenciar o fragmento HVR1-Kwas em pAd5 / H5-HVR1-Kwas-HVR5-His 6. </li></ol></li></ol></li></ol> 2. Preparação de modificação Ad5 Viral Vector Ad5 / H5-HVR1-Kwas-HVR5-His 6 <ol><li> Constituem o meio completo por adição de FBS (final de 10%), 100X não-aminoácidos essenciais (final de 0,1 mM), 200 mM de L-glutamina (final 2 mM) e penicilina / estreptomicina solução (final de 1%) em DMEM com glucose elevada . Manter rim embrionário (HEK293) células humanas em meio completo numa incubadora de cultura (37 ° C e 5% de CO2 sob condições humidificadas a 85%). </li><li> Resgate de viral vector Ad5 / H5-HVR1-Kwas-HVR5-His 6 <ol><li> Semente de 3,0 x 10 6 de células HEK293 em um frasco T-25 contendo 5 ml de meio completo e a cultura O / N para obter uma monocamada com 80% de confluência. </li><li> Linearizar 15 ug de pAd5 / H5-HVR1-Kwas HVR5-6-His num volume de 100 ul com a enzima de restrição PacI (15 unidades) a 37 ° C durante 3 horas. <ol><li> Extrair linearizado pAd5 / H5-HVR1-Kwas-HVR5-His 6 por centrifugação a reacção duas vezes (10.000 x g durante 1 min) com um volume igual de fenol: clorofórmio: álcool isoamílico (rácio a 25: 24: 1) numa hotte , e por centrifugação sequencial (10.000 xg durante 10 min) com uma solução mista (300 ul de etanol a 100% e 10 ul de acetato de sódio) e 700 ul de etanol a 70%. Elimine o sobrenadante em cada etapa de centrifugação. </li></ol></li><li> Ressuspender o plasmídeo purificado em ~ 40 mL de água destilada ou de Tris-EDTA (TE) de tampão. Quantificar o ADN de plasmídeo por medição da óptica density (OD) a 260 nm. </li><li> Transfectar 3 ug do plasmídeo linearizado com reagente de transfecção lipossómica comercial no frasco T-25, de acordo com o manual do fabricante. Alterar o meio de transfecção com meio completo a 6 horas após a transfecção e incubação subsequente na incubadora cultura. Manter as células transfectadas, substituindo meio completo a cada dois a três dias, até à formação de placas virais individuais. </li><li> Ao desenvolver placas para efeito citopático total (ECP), raspar as células restantes fora do balão num hote estéril, e lisado celular colheita por centrifugação meio a 300 xg durante 10 min a 4 ° C. Suspende-se o sedimento celular em ~ 1 ml de meio contendo 2% de FBS, e romper as células por congelamento-descongelamento de quatro vezes. Recolhe-se o sobrenadante contendo vírus resgatados após centrifugação lisado a 10.000 xg durante 10 min a 4 ° C. </li></ol></li><li> Propagação em larga escala do vetor viral Ad5 / H5-HVR1-Kwas-HVR5-His 6 <ol><li> Propagar the vírus num frasco T-75 contendo células HEK293 na capa estéril através da infecção com 1/3 de lisado total do frasco T-25. Permitir CPE completo para desenvolver dentro de dois a três dias na incubadora cultura. Colher o sobrenadante ligado como indicado na etapa 2.2.5. </li><li> Propagar o vírus em 1-3 frascos T-175 do capuz estéril através da infecção com 1/2 de lisado total do frasco T-75, de acordo com as condições de propagação do vírus. Permitir CPE completo para desenvolver dentro de dois a três dias na incubadora cultura. Colher o sobrenadante ligado como indicado na etapa 2.2.5. </li><li> Propagar o vírus em uma dúzia ou mais frascos T-175 na capa estéril através da infecção com 1/2 de lisado total do frasco T-175 (s) anterior. Determinar a quantidade de utilização balão com base nas condições de propagação de vírus e a quantidade de vírus em necessidade. Colheita do sobrenadante lisado como indicado no passo 2.2.5 CPE completo quando ocorre dentro de dois a três dias no incubador de cultura. </li></ol></li><li> Purificação de Ad5 / H5-HVR1-Kwas-HVR5-His 6 por cloreto de césio <ol><li> Prepare duas densidades de soluções de CsCl em HEPES 5 mM: 1,33 g / ml e 1,45 g / ml, evitando ao mesmo tempo o contacto com CsCl. </li><li> Carga de 4 ml de CsCl (1,33 g / ml) em um tubo de ultracentrífuga estéril, e carregar suavemente 4 ml de CsCl (1,45 g / ml) contra o fundo do tubo. Carga de 4 ml de sobrenadante lisado lentamente na parte superior dos gradientes na hote estéril. </li><li> Centrifuga-se o tubo a 110.000 xg durante 3 horas a 4 ° C para separar a banda de vírus maduro / inferior da banda de vírus defeituoso / superior. Recolha a banda inferior usando uma seringa de 3 ml munido com uma agulha G 33 e dilui-se a banda com HEPES a 5 mM a um volume de 4 ml na hote estéril. </li><li> Carregar um outro tubo com duas densidades de soluções de CsCl e a banda de vírus diluído tal como descrito no passo 2.4.2. Centrifuga-se o tubo a 110.000 xg O / N a 4 ° C. Recolha a banda virai, tal como descrito no passo 2.4.3. </li><li> Injectar a solução de vírus coletadas em um dialysé cassete por uma seringa de 3 ml armado com uma agulha G 33 no capô estéril. </li><li> Coloque a gaveta em 700 ml de tampão de diálise 1x (1 L receita: 100 ml de 10x PBS, 100 ml de glicerol a 100% e 800 ml de água destilada; filtrar o tampão através de um filtro de 0,22 um) e substituir o tampão de diálise a cada 3 hrs por 4 vezes. Aspirar a solução de vírus dialisado usando uma seringa com agulha. </li></ol></li></ol> 3. Validação do vetor viral salvei <ol><li> Viral Vector titulações <ol><li> Para a titulação do vírus físico, diluir tanto vírus e tampão de diálise (controlo de fundo) a 1: 10 e 1: 20 em tampão de lise do vírus (10% SDS em Tris-EDTA) em pequenos tubos, e incubar todos os tubos a 56 ° C durante 10 min. </li><li> Ligue um BioPhotometer e definir o modo de absorção a OD 260 nm. Utilize o tampão de diálise diluído (1: 10) para equilibrar o sinal de fundo, clicando no fundo &quot;em branco&quot;. Tipo &quot;10 + 90&quot; na scr BioPhotometereen, e ler o sinal de vírus diluído (1: 10). </li><li> Leia o sinal de vírus diluído (1: 20), seguindo o método na etapa 3.1.2, mas em vez digite &quot;5 + 95&quot; na tela de BioPhotometer. Multiplicar os dois números de leitura por vírus 1,1x10 12 e calcular o título médio com uma unidade como VP / ml, com base nas duas títulos individuais das duas diluições. </li><li> Para a titulação infecciosa do vírus (IP / ml), utilizar o Karber TCID estatística 50 14 método para determinar a profundidade a infecção em células HEK293 que aos 10 dias pós infecção (dpi) </li></ol></li><li> Avaliação do ecrã de exposição antigénica em que o vector viral <ol><li> Revestir o vector viral, em uma placa de ELISA e prosseguir com o restante das etapas de um método ELISA convencional 14. Use anti-gp41 (2F5) anticorpo humano monoclonal (mAb) e de ratinho anti-His Tag mAb para a detecção de antigénios correspondentes incorporados 14. </li><li> Resolver o vector viral num denatueletroforese em gel de proteína vermelha (SDS-PAGE) e prosseguir com o restante das etapas em um método western blot-padrão 14. Use anti-gp41 (2F5) anticorpo humano monoclonal (mAb) e de ratinho anti-His Tag mAb para a detecção de antigénios correspondentes incorporados 14. </li></ol></li><li> Avaliação in vitro do vetor sobre a capacidade de ignorar soros Ad5-positve <ol><li> Manter as células HeLa em meio completo na incubadora de cultura (37 ° C e 5% de CO 2 sob condições humidificadas a 85%). Constituem o meio completo por adição de FBS (final de 10%), 200 mM de L-glutamina (final de 2 mM) e solução de penicilina / estreptomicina (final de 1%) em Meio Essencial Mínimo de Eagle (MEME). </li><li> Semente células HeLa em placas de 6 poços a 1x10 6 células / poço, e incubam-se as placas na incubadora de cultura (37 ° C e 5% de CO2 sob condições humidificadas 85%) durante 2 horas. Incubar soros Ad5-positivo (0,1 l ou 0 ul) com 5 IP / célula de vetor viral (Ad5 ou Ad5 / H5-HVR1-Kwas HVR5-6-His) na incubadora de cultura durante 1 h antes de se adicionar as misturas em placas de 6 poços contendo células. </li><li> Ao fim de 24 horas após a infecção (hpi), lavar as células uma vez com PBS e as células lisam em 0,5 ml de tampão de lise. Centrifugar a 15.000 xg durante 5 minutos e recolher o sobrenadante. Misturar 20 uL do sobrenadante com 100 ul de substrato de luciferase para a leitura do sinal da luciferase, uma vez que os vírus contém o gene da luciferase. </li></ol></li></ol> 4. Avaliação imunológica do vector viral salvados <ol><li> Prepare dois grupos de imunização: Ad5 e Ad5 / H5-HVR1-Kwas-HVR5-His 6. <ol><li> Injetar camundongos (n = 8 / grupo) por via intramuscular com vírus em 1x10 10 VP / rato, em um &quot;prime-boost&quot; regime de imunização homóloga, com um intervalo de 2 semanas. </li><li> Em 2 semanas após cada injecção, os ratos sangrar sem anestesia pelo rosto sangrando com lancetas animais (5 mm de comprimento ponta) paracoleta de sangue em tubos de 1,5 ml. </li></ol></li><li> Misturar o sangue nos tubos por inversão cima e para baixo, e incuba-se o sangue à temperatura ambiente durante 30 min. Girar os tubos a 10.000 xg durante 5 min a 4 ° C e os soros de transferência (camada superior) para novos tubos de 1,5 ml. <ol><li> Girar os novos tubos a 10.000 xg durante 5 min a 4 ° C e transferência para recém-soros marcados tubos de 1,5 ml para armazenamento a -80 ° C. </li></ol></li><li> Avaliação de imunidade humoral especifica para o antigénio por ELISA à base de soro <ol><li> Diluir Sua peptídeo (estoque em 1 mM) e HIV-1 peptídeo (estoque em 1 mM) separadamente em 100. </li><li> tampão carbonato mM (pH 9,5) para atingir a concentração de revestimento de péptido em 10 ^ M. Revestir as placas de ELISA com os péptidos diluídos em separado pela adição de 100 ul por cavidade e incubando as placas de O / N a 4 ° C. </li><li> Lavar as placas com PBST, quatro vezes em 200 ul / poço e bloqueio durante 1 hora em 5% de BSA em PBST. Aplicar soros de murganhos das placas a diluição 1: 100 no bloqueio de buffer, 100 ul / poço. Incubar durante 2 horas de incubação à temperatura ambiente. </li><li> Lavar as placas com PBST, quatro vezes. Bloquear as placas por incubação à temperatura ambiente durante 30 min em tampão de bloqueio a 100 ul / poço. </li><li> Aplique de cabra anti-IgG de ratinho-HRP (1: 5000 no tampão de bloqueio), a 100 ul / poço de ambas as placas revestidas com o seu peptídeo de HIV-1 e de péptidos individualmente. Incubar durante 2 horas à temperatura ambiente. Lavar as placas com PBST. </li><li> Ler as placas a DO450 nm após incubação com substrato de HRP durante 30 min. </li></ol></li></ol>

<ol>
	<li>Cheng, S. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Coexpression+of+the+simian+immunodeficiency+virus+Env+and+Rev+proteins+by+a+recombinant+human+adenovirus+host+range+mutant.">Coexpression of the simian immunodeficiency virus Env and Rev proteins by a recombinant human adenovirus host range mutant.</a> Journal of virology. 66, 6721-6727 (1992).</li><li>Matthews, Q. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=HIV+antigen+incorporation+within+adenovirus+hexon+hypervariable+2+for+a+novel+HIV+vaccine+approach.">HIV antigen incorporation within adenovirus hexon hypervariable 2 for a novel HIV vaccine approach.</a> PloS one. 5, e11815 (2010).</li><li>DeMatteo, R. P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Long-lasting+adenovirus+transgene+expression+in+mice+through+neonatal+intrathymic+tolerance+induction+without+the+use+of+immunosuppression.">Long-lasting adenovirus transgene expression in mice through neonatal intrathymic tolerance induction without the use of immunosuppression.</a> Journal of virology. 71, 5330-5335 (1997).</li><li>Gu, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+recombinant+adenovirus-based+vector+elicits+a+specific+humoral+immune+response+against+the+V3+loop+of+HIV-1+gp120+in+mice+through+the+'Antigen+Capsid-Incorporation'+strategy.">A recombinant adenovirus-based vector elicits a specific humoral immune response against the V3 loop of HIV-1 gp120 in mice through the 'Antigen Capsid-Incorporation' strategy.</a> Virology journal. 11, 112 (2014).</li><li>Matthews, Q. L., Krendelchtchikov, A. L. G., Li, Z. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Viral+Vectors+for+Vaccine+Development.">Viral Vectors for Vaccine Development.</a> INTECH. , (2013).</li><li>Tang, D. C., Zhang, J., Toro, H., Shi, Z., Van Kampen, K. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Adenovirus+as+a+carrier+for+the+development+of+influenza+virus-free+avian+influenza+vaccines.">Adenovirus as a carrier for the development of influenza virus-free avian influenza vaccines.</a> Expert review of vaccines. 8, 469-481 (2009).</li><li>Flatt, J. W., Kim, R., Smith, J. G., Nemerow, G. R., Stewart, P. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+intrinsically+disordered+region+of+the+adenovirus+capsid+is+implicated+in+neutralization+by+human+alpha+defensin+5.">An intrinsically disordered region of the adenovirus capsid is implicated in neutralization by human alpha defensin 5.</a> PloS one. 8, e61571 (2013).</li><li>Bradley, R. R., Lynch, D. M., Iampietro, M. J., Borducchi, E. N., Barouch, D. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Adenovirus+serotype+5+neutralizing+antibodies+target+both+hexon+and+fiber+following+vaccination+and+natural+infection.">Adenovirus serotype 5 neutralizing antibodies target both hexon and fiber following vaccination and natural infection.</a> Journal of virology. 86, 625-629 (2012).</li><li>Zaiss, A. K., Machado, H. B., Herschman, H. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+influence+of+innate+and+pre-existing+immunity+on+adenovirus+therapy.">The influence of innate and pre-existing immunity on adenovirus therapy.</a> Journal of cellular biochemistry. 108, 778-790 (2009).</li><li>Sumida, S. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Neutralizing+antibodies+and+CD8++T+lymphocytes+both+contribute+to+immunity+to+adenovirus+serotype+5+vaccine+vectors.">Neutralizing antibodies and CD8+ T lymphocytes both contribute to immunity to adenovirus serotype 5 vaccine vectors.</a> Journal of virology. 78, 2666-2673 (2004).</li><li>Sumida, S. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Neutralizing+antibodies+to+adenovirus+serotype+5+vaccine+vectors+are+directed+primarily+against+the+adenovirus+hexon+protein.">Neutralizing antibodies to adenovirus serotype 5 vaccine vectors are directed primarily against the adenovirus hexon protein.</a> Journal of immunology. 174, 7179-7185 (2005).</li><li>Bradley, R. R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Adenovirus+serotype+5-specific+neutralizing+antibodies+target+multiple+hexon+hypervariable+regions.">Adenovirus serotype 5-specific neutralizing antibodies target multiple hexon hypervariable regions.</a> Journal of virology. 86, 1267-1272 (2012).</li><li>Gahery-Segard, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Immune+response+to+recombinant+capsid+proteins+of+adenovirus+in+humans:+antifiber+and+anti-penton+base+antibodies+have+a+synergistic+effect+on+neutralizing+activity.">Immune response to recombinant capsid proteins of adenovirus in humans: antifiber and anti-penton base antibodies have a synergistic effect on neutralizing activity.</a> Journal of virology. 72, 2388-2397 (1998).</li><li>Gu, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Using+multivalent+adenoviral+vectors+for+HIV+vaccination.">Using multivalent adenoviral vectors for HIV vaccination.</a> PloS one. 8, e60347 (2013).</li><li>Tian, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Protection+against+enterovirus+71+with+neutralizing+epitope+incorporation+within+adenovirus+type+3+hexon.">Protection against enterovirus 71 with neutralizing epitope incorporation within adenovirus type 3 hexon.</a> PloS one. 7, e41381 (2012).</li><li>Wu, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Construction+and+characterization+of+adenovirus+serotype+5+packaged+by+serotype+3+hexon.">Construction and characterization of adenovirus serotype 5 packaged by serotype 3 hexon.</a> Journal of virology. 76, 12775-12782 (2002).</li><li>Wu, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Identification+of+sites+in+adenovirus+hexon+for+foreign+peptide+incorporation.">Identification of sites in adenovirus hexon for foreign peptide incorporation.</a> Journal of virology. 79, 3382-3390 (2005).</li><li>Qiu, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Serotype-specific+neutralizing+antibody+epitopes+of+human+adenovirus+type+3+(HAdV-3)+and+HAdV-7+reside+in+multiple+hexon+hypervariable+regions.">Serotype-specific neutralizing antibody epitopes of human adenovirus type 3 (HAdV-3) and HAdV-7 reside in multiple hexon hypervariable regions.</a> Journal of. 86, 7964-7975 (2012).</li><li>Parker, C. E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Fine+definition+of+the+epitope+on+the+gp41+glycoprotein+of+human+immunodeficiency+virus+type+1+for+the+neutralizing+monoclonal+antibody+2F5.">Fine definition of the epitope on the gp41 glycoprotein of human immunodeficiency virus type 1 for the neutralizing monoclonal antibody 2F5.</a> Journal of virology. 75, 10906-10911 (2001).</li><li>Farrow, A. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Immunization+with+Hexon+Modified+Adenoviral+Vectors+Integrated+with+gp83+Epitope+Provides+Protection+against+Trypanosoma+cruzi+Infection.">Immunization with Hexon Modified Adenoviral Vectors Integrated with gp83 Epitope Provides Protection against Trypanosoma cruzi Infection.</a> PLoS neglected tropical diseases. 8, e3089 (2014).</li><li>Krause, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Epitopes+expressed+in+different+adenovirus+capsid+proteins+induce+different+levels+of+epitope-specific+immunity.">Epitopes expressed in different adenovirus capsid proteins induce different levels of epitope-specific immunity.</a> Journal of virology. 80, 5523-5530 (2006).</li><li>Omori, N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Modification+of+a+fiber+protein+in+an+adenovirus+vector+improves+in+vitro+gene+transfer+efficiency+to+the+mouse+microglial+cell+line.">Modification of a fiber protein in an adenovirus vector improves in vitro gene transfer efficiency to the mouse microglial cell line.</a> Neuroscience letters. 324, 145-148 (2002).</li><li>Dmitriev, I. P., Kashentseva, E. A., Curiel, D. T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Engineering+of+adenovirus+vectors+containing+heterologous+peptide+sequences+in+the+C+terminus+of+capsid+protein+IX.">Engineering of adenovirus vectors containing heterologous peptide sequences in the C terminus of capsid protein IX.</a> Journal of virology. 76, 6893-6899 (2002).</li><li>Xue, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Construction+and+characterization+of+a+recombinant+human+adenovirus+type+3+vector+containing+two+foreign+neutralizing+epitopes+in+hexon.">Construction and characterization of a recombinant human adenovirus type 3 vector containing two foreign neutralizing epitopes in hexon.</a> Virus research. 183, 67-74 (2014).</li><li>Tian, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Construction+and+characterization+of+human+adenovirus+serotype+3+packaged+by+serotype+7+hexon.">Construction and characterization of human adenovirus serotype 3 packaged by serotype 7 hexon.</a> Virus research. 160, 214-220 (2011).</li><li>Kim, J. W., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+adenovirus+vector+incorporating+carbohydrate+binding+domains+utilizes+glycans+for+gene+transfer.">An adenovirus vector incorporating carbohydrate binding domains utilizes glycans for gene transfer.</a> PloS one. 8, e55533 (2013).</li><li>Vasconcelos, J. R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Pathogen-induced+proapoptotic+phenotype+and+high+CD95+(Fas)+expression+accompany+a+suboptimal+CD8++T-cell+response:+reversal+by+adenoviral+vaccine.">Pathogen-induced proapoptotic phenotype and high CD95 (Fas) expression accompany a suboptimal CD8+ T-cell response: reversal by adenoviral vaccine.</a> PLoS pathogens. 8, e1002699 (2012).</li><li>Matthews, Q. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genetic+incorporation+of+a+herpes+simplex+virus+type+1+thymidine+kinase+and+firefly+luciferase+fusion+into+the+adenovirus+protein+IX+for+functional+display+on+the+virion.">Genetic incorporation of a herpes simplex virus type 1 thymidine kinase and firefly luciferase fusion into the adenovirus protein IX for functional display on the virion.</a> Molecular imaging. 5, 510-519 (2006).</li></ol>

Os autores não têm nada a revelar.

A aplicação da estratégia do transgene tradicional em Ad5 modificação para o desenvolvimento de vacinas tem sido diminuído, principalmente devido ao estrangulamento associada com o Ad5 de PEI 4,6. Este gargalo pode ser parcialmente diminuída pela aplicação da estratégia alternativa antígeno do capsídeo-Incorporation (Figura 1A), uma vez que esta estratégia pode fugir neutralização por Ad5 NAbs substituindo neutralizantes epítopos de Ad5 com antígenos-de-interesse, e facilitar...

Adenovírus humano (Ad) é, um vírus de tamanho médio não encapsulado com uma nucleocápside icosaédrica que contém um genoma de ADN de cadeia dupla. Ad pertence à família Adenoviridae, com uma classificação em sete grupos (A a G). Cada grupo contém vírus de diferentes serótipos. Dos quais, adenovírus serotipo 5 (Ad5) do grupo C tem sido o mais extensamente estudado e o mais amplamente aplicado para abordagens vectored como terapia genética e vacinação. A estratégia transgene tradicional tem sido desenvolvido e aplicado para modificações de Ad5, que se caracteriza por o deslocamento dos genes precoces do vírus com um gene de interesse, e a expressão do gene focado de interesse num hospedeiro. Exemplos são a construção de pENV9 / Ad5hrΔE3 por substituição do gene inicial 3 (E3) com o gene rev de Simian Vírus da Imunodeficiência 1, a construção de AdCMVGag através da substituição do gene precoce 1 (E1) com o gene gag de Imunodeficiência HumanaVirus (HIV) 2, e a construção de lac Z por Ad substituindo E1 com o gene lac Z 3. A ampla aplicação da estratégia tradicional transgene em Ad5 depende dos seguintes méritos: a ampla gama de hospedeiros para Ad5, a engenharia genética viável sobre o vírus e propagação de vírus, o grande alojamento de inserção de genes estranhos ea segurança de Ad5 4,5. No entanto, as eficiências reduzidas de terapias clínicas Ad5-vectored por utilização desta estratégia tem sido um importante ponto de estrangulamento, que tem sido mapeada para ser associado principalmente com Ad5 PEI, uma vez que o Ad5 é tão prevalente entre a maioria de crianças e adultos 4,6. Para vencer o principal estrangulamento de Ad5, o objetivo principal é desenvolver uma estratégia alternativa contornar Ad5 PEI. A imunidade inata 7, a imunidade adaptativa, tais como anticorpos neutralizantes (NAbs) 8-10 e CD8 + T respostas de células 10 contra Ad5 têm sido mostrados para contribute ao Ad5 PEI, com Ad5 NAbs aparecendo para desempenhar o papel dominante nas contribuições para Ad5 PEI 10,11. Além disso, Ad5 NABS epítopos alvo situadas em proteínas do capsídeo, incluindo o principal hexon proteínas, fibras e base penton. Dos quais, hexon é o principal alvo de Ad5 NAbs 8,11-13. Com base nestes resultados, uma estratégia de incorporação de antigénio da cápside inovadora foi introduzida. Esta nova estratégia destaca a substituição ou incorporação de proteínas-de-juros sobre proteínas do capsídeo de Ad5, que desloca ou mascara os epítopos neutralizantes Ad5, levando à diminuição do reconhecimento pelo NAbs e eficientes administrações vetor Ad5. É de salientar que esta estratégia é competitivo, porque ele também pode ajudar anfitriões provocar imunidade humoral robusta e imunidade celular potente diretamente por apresentar antígenos de interesse para o sistema imunológico 4,14,15. Com base nesta estratégia, a clonagem molecular e salvamento recombinante Ad vetor viral pode ser estruturalmente divididaem quatro etapas principais: (a) a preparação de fragmento do gene de interesse por qualquer reação em cadeia da polimerase (PCR) ou síntese; (B) a ligação do fragmento do gene num plasmídeo de transporte que contém o fragmento do gene de interesse e os braços homólogas a uma espinha dorsal adenovírus; (C) a recombinação homóloga por co-transformação do plasmideo de transporte contendo o fragmento do gene de interesse com a espinha dorsal do plasmídeo linearizado pAd5 / ΔH5 (GL) 16; (D) a transfecção de plasmídeo linearizado adenovírus recombinante para resgatar o vector Ad recombinante incorporado com antigénios-de-interesse. O nosso grupo e alguns outros já estendeu essa estratégia alternativa incorporação anúncio para Ad desenvolvimento da vacina vetorizada contra diferentes agentes infecciosos. Nós relataram a geração de um vector Ad recombinantes Ad-HVR1-LGS-His 6 -v3 por incorporação de um marcada com His de HIV-1 de antigénio para a região V3 de Ad5 HVR1 hexon (hexon5). Este vector gerado desencadeada strong resposta imunitária humoral específica para o epítopo V3 4. Também relatou o desenvolvimento de Ad5 / HVR2-MPER-L15ΔE1 através da incorporação de HIV-1 de membrana região ectodomï¿½io proximal (MPER) na localidade de HVR2 hexon5 2. Além disso, o grupo do Dr. Zhou utilizou os benefícios desta estratégia de incorporação de anúncios para desenvolver serotipo ad 3 (Ad3) vacinas vetoriais, isto é., A geração do vector viral R1SP70A3 por incorporação de um epitopo neutralizante de SP70 Enterovírus 71 na HVR1 de Ad3 hexon (hexon3). R1SP70A3 gerado NAbs fortes e produção de IFN-γ específicos para o epitopo SP70, que levam à alta taxa de protecção contra o desafio 15 71 Enterovírus. Para efeitos de referência técnica, nosso estudo se aproveitou da estratégia de antígeno do capsídeo-Incorporação qualitativa para se concentrar na geração de um bivalente Ad5 vetor Ad5 / H5-HVR1-Kwas-HVR5-His 6, incorporando um antígeno HIV-1 em HVR1 umda sua tag em HVR5 de hexon5. O vector viral gerada foi também avaliada imunologicamente. A estratégia de antigénio da cápside-A incorporação pode ser utilizada para o desenvolvimento de abordagens de vacinação contra o Ad5-vectored doenças infecciosas diferentes.

<table border="0" cellpadding="0" cellspacing="0">
	<tbody>
		<tr>
			<td>1x DPBS</td>
			<td>Thermo Scientific</td>
			<td>SH30256.01</td>
			<td>for cell spliting&#160;</td>
		</tr>
		<tr>
			<td>10x DPBS</td>
			<td>Thermo Scientific</td>
			<td>SH30378.02</td>
			<td>for dialysis buffer preparation</td>
		</tr>
		<tr>
			<td>glycerol</td>
			<td>SIGMA</td>
			<td>G5516-1L</td>
			<td>for dialysis buffer preparation</td>
		</tr>
		<tr>
			<td>SDS</td>
			<td>BIO-RAD</td>
			<td>161-0301</td>
			<td>for virus lysis buffer preparation</td>
		</tr>
		<tr>
			<td>Fetal Bovine Serum (FBS)</td>
			<td>Thermo Scientific</td>
			<td>SH30910.03</td>
			<td>component of culture medium</td>
		</tr>
		<tr>
			<td>100X Non-Essential Amino Acids&#160;</td>
			<td>Thermo Scientific</td>
			<td>SH30238.01</td>
			<td>component of culture medium</td>
		</tr>
		<tr>
			<td>200mM/L L-glutamine</td>
			<td>Cellgro</td>
			<td>25-005-CI</td>
			<td>component of culture medium</td>
		</tr>
		<tr>
			<td>penicillin/streptomycin solution&#160;</td>
			<td>Cellgro</td>
			<td>30-002-CI</td>
			<td>component of culture medium</td>
		</tr>
		<tr>
			<td>DMEM with high glucose</td>
			<td>Thermo Scientific</td>
			<td>SH30081.01</td>
			<td>for HEK293 cell culture</td>
		</tr>
		<tr>
			<td>Minimum Essential Medium Eagle</td>
			<td>SIGMA</td>
			<td>M5650</td>
			<td>for HeLa cell culture</td>
		</tr>
		<tr>
			<td>phenol:chloroform:isoamyl alcohol&#160;</td>
			<td>SIGMA</td>
			<td>P3803-100ML</td>
			<td>for large size of DNA purification</td>
		</tr>
		<tr>
			<td>cesium chloride&#160;</td>
			<td>Research Products International Corp.</td>
			<td>C68050</td>
			<td>for virus purificiation</td>
		</tr>
		<tr>
			<td>HEPES</td>
			<td>Cellgro</td>
			<td>25-060-CI</td>
			<td>for CsCl solution preparation</td>
		</tr>
		<tr>
			<td>HEK293</td>
			<td>ATCC</td>
			<td>51-0036</td>
			<td>for virus rescue and upscale</td>
		</tr>
		<tr>
			<td>HeLa</td>
			<td>ATCC</td>
			<td>CCL-2</td>
			<td>for neutralization assay</td>
		</tr>
		<tr>
			<td>T-25 flask</td>
			<td>Thermo Scientific</td>
			<td>156367</td>
			<td>for cell culture&#160;</td>
		</tr>
		<tr>
			<td>T-75 flask</td>
			<td>CORNING</td>
			<td>430641</td>
			<td>for cell culture&#160;</td>
		</tr>
		<tr>
			<td>T-175 flask</td>
			<td>Thermo Scientific</td>
			<td>159910</td>
			<td>for cell culture&#160;</td>
		</tr>
		<tr>
			<td>Ultracentrifuge</td>
			<td>BECKMAN</td>
			<td>NA</td>
			<td>for virus purification</td>
		</tr>
		<tr>
			<td>Ultracentrifuge tube</td>
			<td>BECKMAN</td>
			<td>344059</td>
			<td>for virus purification</td>
		</tr>
		<tr>
			<td>dialysis cassette&#160;</td>
			<td>Thermo Scientific</td>
			<td>66380</td>
			<td>for virus dialysis</td>
		</tr>
		<tr>
			<td>ELISA plate</td>
			<td>Thermo Scientific</td>
			<td>442404</td>
			<td>for ELISA</td>
		</tr>
		<tr>
			<td>human anti-gp41 (2F5) mAb</td>
			<td>NIH AIDS Reagent Program</td>
			<td>1475</td>
			<td>for immunological assays</td>
		</tr>
		<tr>
			<td>mouse anti-His tag mAb</td>
			<td>GenScript</td>
			<td>A00186</td>
			<td>for immunological assays</td>
		</tr>
		<tr>
			<td>SOC medium</td>
			<td>CORNING</td>
			<td>46-003-CR</td>
			<td>for transformation</td>
		</tr>
		<tr>
			<td>PCR master mix solution</td>
			<td>QIAGEN</td>
			<td>201445</td>
			<td>for PCR</td>
		</tr>
		<tr>
			<td>Animal lancet (point length at 5mm)</td>
			<td>MEDIpoint</td>
			<td></td>
			<td>for mice bleeding&#160;</td>
		</tr>
		<tr>
			<td>Biophotometer</td>
			<td>Eppendorf</td>
			<td></td>
			<td>for virus physical titer titration</td>
		</tr>
	</tbody>
</table>

utilizing the antigen capsid-incorporation strategy for the development of adenovirus serotype 5-vectored vaccine approaches

O adenovírus serotipo 5 (Ad5) tem sido extensivamente modificado com métodos tradicionais de transgenes para o desenvolvimento de vacinas. As eficiências reduzidas destes vectores Ad5 tradicionalmente modificados em ensaios clínicos que se correlacionam principalmente com Ad5 imunidade pré-existente (PEI) entre a maioria da população. Para promover o desenvolvimento da vacina vetorizada-Ad5, resolvendo a preocupação de Ad5 PEI, tem sido utilizada a inovadora estratégia de antígeno do capsídeo-Incorporação. Por mérito desta estratégia, Ad5-vectored que primeiro construiu o shuttle hexon plasmídeo HVR1-Seus Kwas-HVR5-6 / pH5S por subclonagem da região hipervariável (HVR) 1 de hexon num plasmídeo de transporte previamente construído HVR5-His 6 / pH5S, que tinha Sua 6 tag incorporada no HVR5. Este fragmento de DNA contendo um epitopo HVR1 ELDKWAS HIV foi sintetizado. 6 / pH5S Seus HVR1-Kwas-HVR5-se então linearizado e co-transformada com o plasmídeo linearizado pAd5 backbone / ΔH5 (GL),para recombinação homóloga. Este plasmídeo recombinado pAd5 / H5-HVR1-Kwas HVR5-6-His foi transfectado em células para gerar o vector viral Ad5 / H5-HVR1-Kwas HVR5-6-His. Este vector foi validado para ter aptidão qualitativa indicado pelo título viral física (VP / ml), título infeccioso (IP / ml) e correspondente rácio / IP VP. Tanto o epitopo HIV e Sua 6 tag foram sobre a cápside de Ad5 expostos à superfície, e manteve-epítopo específico antigenicidade da sua própria. Um ensaio de neutralização indicada a capacidade deste vector para contornar divalente de neutralização pelo soro de Ad5-positiva, in vitro. A imunização de camundongos demonstraram a geração de robusta imunidade humoral específica para o epitopo HIV e Sua 6. Este estudo de prova de princípio sugerido que o protocolo associado com a estratégia de antigénio da cápside-Incorporação poderia ser viável utilizado para a geração de vacinas de Ad5-vectored diferentes, modificando as proteínas da cápside. Este protocolo poderia até ser futros modificado para a geração de rara do serotipo vacinas em vector-adenovírus.

A estratégia de antigénio da cápside-Incorporação (Figura 1A), foi utilizada para gerar o vector viral Ad5 divalente Ad5 / H5-HVR1-Kwas HVR5-6-His. Em primeiro lugar, o ônibus plasmídeo HVR1-Kwas-HVR5-His 6 / pH5S foi construído por subclonagem HVR1-Kwas fragmento no plasmídeo anterior shuttle construído HVR5-His 6 / pH5S 17. Em segundo lugar, o plasmídeo pAd5 / H5-HVR1-Kwas HVR5-His-6 14 foi construído através da recombinaç...

Watch this Scientific Journal Video about Utilizing the Antigen Capsid-Incorporation Strategy for the Development of Adenovirus Serotype 5-Vectored Vaccine Approaches at JoVE.com

Utilizing the Antigen Capsid-Incorporation Strategy for the Development of Adenovirus Serotype 5-Vectored Vaccine Approaches

Aqui, apresentamos um protocolo para gerar um bivalente adenovírus tipo 5 (Ad5) vector de prova de princípio Ad5 / H5-HVR1-Kwas-HVR5-His 6, utilizando a estratégia de antígeno do capsídeo-Incorporação. Este vector foi demonstrado que exibem aptidão qualitativa, a capacidade de escapar soros Ad5-positiva, in vitro, e a antigenicidade, bem como a imunogenicidade dos antigénios incorporados.

Utilizando a estratégia Capsid-Incorporação Antigen para o desenvolvimento de abordagens adenovírus subtipo 5-Vectored de vacinas

Adenovirus serotype 5 (Ad5) has been extensively modified with traditional transgene methods for the vaccine development. The reduced efficacies of these ...

utilizing-antigen-capsid-incorporation-strategy-for-development

Research

JoVE Journal

Immunology and Infection

10.3K visualizações.  University of Alabama at Birmingham.  Aqui, apresentamos um protocolo para gerar um bivalente adenovírus tipo 5 (Ad5) vector de prova de princípio Ad5 / H5-HVR1-Kwas-HVR5-His 6, utilizando a estratégia de antígeno do capsídeo-Incorporação. Este vector foi demonstrado que exibem aptidão qualitativa, a capacidade de escapar soros Ad5-positiva, in vitro, e a antigenicidade, bem como a imunogenicidade dos antigénios incorporados. 

Vídeo: Utilizing the Antigen Capsid-Incorporation Strategy for the Development of Adenovirus Serotype 5-Vectored Vaccine Approaches

Efficient Recombinant Parvovirus Production with the Help of Adenovirus-derived Systems

Rodent parvoviruses (PV) such as rat H-1PV and MVM, are small icosahedral, single stranded, DNA viruses. Their genome includes two promoters P4 and P38 which regulate the expression of non-structural (NS1 and NS2) and capsid proteins (VP1 and VP2) respectively1. They attract high interest as anticancer agents for their oncolytic and oncosuppressive abilities while being non-pathogenic for humans2. NS1 is the major effector of viral cytotoxicity3. In order to further enhance their natural antineoplastic activities, derivatives from these vectors have been generated by replacing the gene encoding for the capsid proteins with a therapeutic transgene (e.g. a cytotoxic polypeptide, cytokine, chemokine, tumour suppressor gene etc.)4. The recombinant parvoviruses (recPVs) vector retains the NS1/2 coding sequences and the PV genome telomeres which are necessary for viral DNA amplification and packaging. Production of recPVs occurs only in the producer cells (generally HEK293T), by co-transfecting the cells with a second vector (pCMV-VP) expressing the gene encoding for the VP proteins (Fig. 1)4. The recPV vectors generated in this way are replication defective. Although recPVs proved to possess enhanced oncotoxic activities with respect to the parental viruses from which they have been generated, their production remains a major challenge and strongly hampers the use of these agents in anti-cancer clinical applications.
We found that introduction of an Ad-5 derived vector containing the E2a, E4(orf6) and the VA RNA genes (e.g. pXX6 plasmid) into HEK293T improved the production of recPVs by more than 10 fold in comparison to other protocols in use. Based on this finding, we have constructed a novel Ad-VP-helper that contains the genomic adenoviral elements necessary to enhance recPVs production as well as the parvovirus VP gene unit5. The use of Ad-VP-helper, allows production of rec-PVs using a protocol that relies entirely on viral infection steps (as opposed to plasmid transfection), making possible the use of cell lines that are difficult to transfect (e.g. NB324K) (Fig. 2). We present a method that greatly improves the amount of recombinant virus produced, reducing both the production time and costs, without affecting the quality of the final product5. In addition, large scale production of recPV (in suspension cells and bioreactors) is now conceivable.

Here we describe a protocol based only on cell infection, which improves the efficiency of recombinant parvovirus production by more than 100 fold in comparison to other protocols in use. This protocol relies on the use of a novel adenovirus 5-based helper containing the parvovirus VP transcription unit (Ad-VP).

Produção Parvovirus eficiente recombinante com a ajuda de Adenovirus sistemas derivados

Rodent parvoviruses (PV) such as rat H-1PV and MVM, are small icosahedral, single stranded, DNA viruses. Their genome includes two promoters P4 and P38 ...

Imunologia e Infecção

Generation of Recombinant Arenavirus for Vaccine Development in FDA-Approved Vero Cells

The development and implementation of arenavirus reverse genetics represents a significant breakthrough in the arenavirus field 4. The use of cell-based arenavirus minigenome systems together with the ability to generate recombinant infectious arenaviruses with predetermined mutations in their genomes has facilitated the investigation of the contribution of viral determinants to the different steps of the arenavirus life cycle, as well as virus-host interactions and mechanisms of arenavirus pathogenesis 1, 3, 11 . In addition, the development of trisegmented arenaviruses has permitted the use of the arenavirus genome to express additional foreign genes of interest, thus opening the possibility of arenavirus-based vaccine vector applications 5 . Likewise, the development of single-cycle infectious arenaviruses capable of expressing reporter genes provides a new experimental tool to improve the safety of research involving highly pathogenic human arenaviruses 16 . The generation of recombinant arenaviruses using plasmid-based reverse genetics techniques has so far relied on the use of rodent cell lines 7,19 , which poses some barriers for the development of Food and Drug Administration (FDA)-licensed vaccine or vaccine vectors. To overcome this obstacle, we describe here the efficient generation of recombinant arenaviruses in FDA-approved Vero cells.

Rescue of recombinant arenaviruses from cloned cDNAs, an approach referred to as reverse genetics, allows researchers to investigate the role of specific viral gene products, as well as the contribution of their different specific domains and residues, to many different aspects of the biology of arenavirus. Likewise, reverse genetics techniques in FDA-approved cell lines (Vero) for vaccine development provides novel possibilities for the generation of effective and safe vaccines to combat human pathogenic arenaviruses.

Geração de Arenavirus recombinante de Desenvolvimento de Vacinas no FDA-approved células Vero

The development and implementation of arenavirus reverse genetics represents a significant breakthrough in the arenavirus field  4. The use of cell-based ...

Using Click Chemistry to Measure the Effect of Viral Infection on Host-Cell RNA Synthesis

Many RNA viruses have evolved the ability to inhibit host cell transcription as a means to circumvent cellular defenses. For the study of these viruses, it is therefore important to have a quick and reliable way of measuring transcriptional activity in infected cells. Traditionally, transcription has been measured either by incorporation of radioactive nucleosides such as 3H-uridine followed by detection via autoradiography or scintillation counting, or incorporation of halogenated uridine analogs such as 5-bromouridine (BrU) followed by detection via immunostaining. The use of radioactive isotopes, however, requires specialized equipment and is not feasible in a number of laboratory settings, while the detection of BrU can be cumbersome and may suffer from low sensitivity.
The recently developed click chemistry, which involves a copper-catalyzed triazole formation from an azide and an alkyne, now provides a rapid and highly sensitive alternative to these two methods. Click chemistry is a two step process in which nascent RNA is first labeled by incorporation of the uridine analog 5-ethynyluridine (EU), followed by detection of the label with a fluorescent azide. These azides are available as several different fluorophores, allowing for a wide range of options for visualization.
This protocol describes a method to measure transcriptional suppression in cells infected with the Rift Valley fever virus (RVFV) strain MP-12 using click chemistry. Concurrently, expression of viral proteins in these cells is determined by classical intracellular immunostaining. Steps 1 through 4 detail a method to visualize transcriptional suppression via fluorescence microscopy, while steps 5 through 8 detail a method to quantify transcriptional suppression via flow cytometry. This protocol is easily adaptable for use with other viruses.

This method describes the use of click chemistry to measure changes in host cell transcription after infection with the Rift Valley fever virus (RVFV) strain MP-12. Results can be visualized qualitatively via fluorescence microscopy or obtained quantitatively through flow cytometry. This method is adaptable for use with other viruses.

Usando Click Chemistry medir o efeito da infecção viral sobre a síntese de RNA do Host-Cell

Many RNA viruses have evolved the ability to inhibit host cell transcription as a means to circumvent cellular defenses. For the study of these viruses, ...

In Vitro Analysis of Myd88-mediated Cellular Immune Response to West Nile Virus Mutant Strain Infection

An attenuated West Nile virus (WNV), a nonstructural (NS) 4B-P38G mutant, induced higher innate cytokine and T cell responses than the wild-type WNV in mice. Recently, myeloid differentiation factor 88 (MyD88) signaling was shown to be important for initial T cell priming and memory T cell development during WNV NS4B-P38G mutant infection. In this study, two flow cytometry-based methods &#8211; an in vitro T cell priming assay and an intracellular cytokine staining (ICS) &#8211; were utilized to assess dendritic cells (DCs) and T cell functions. In the T cell priming assay, cell proliferation was analyzed by flow cytometry following co-culture of DCs from both groups of mice with carboxyfluorescein succinimidyl ester (CFSE) - labeled CD4+ T cells of OTII transgenic mice. This approach provided an accurate determination of the percentage of proliferating CD4+ T cells with significantly improved overall sensitivity than the traditional assays with radioactive reagents. A microcentrifuge tube system was used in both cell culture and cytokine staining procedures of the ICS protocol. Compared to the traditional tissue culture plate-based system, this modified procedure was easier to perform at biosafety level (BL) 3 facilities. Moreover, WNV- infected cells were treated with paraformaldehyde in both assays, which enabled further analysis outside BL3 facilities. Overall, these in vitro immunological assays can be used to efficiently assess cell-mediated immune responses during WNV infection.

In Vitro Analysis of Myd88-mediated Cellular Immune Response to West Nile Virus Mutant Strain Infection

Two flow cytometry-based methods &#8211; an in vitro T cell priming assay and intracellular cytokine staining were utilized to measure antigen presenting capacity of dendritic cells and antigen-specific T cell responses to a West Nile virus mutant infection in mice.

In Vitro Análise do mediada por Myd88 Cellular resposta imune a vírus do Nilo Ocidental Mutant Strain Infection

An attenuated West Nile virus (WNV), a nonstructural (NS) 4B-P38G mutant, induced higher innate cytokine and T cell responses than the wild-type WNV in ...

Detection of Human Leukocyte Antigen Biomarkers in Breast Cancer Utilizing Label-free Biosensor Technology

According to the American Cancer Society, more than 200,000 women will be diagnosed with invasive breast cancer each year and approximately 40,000 will die from the disease. The human leukocyte antigen (HLA) class I samples peptides derived from proteasomal degradation of cellular proteins and presents these fragments on the cell surface for interrogation by circulating cytotoxic T lymphocytes (CTL). Generation of T-cell receptor mimic (TCRm) monoclonal antibodies (mAbs) which recognize breast cancer specific peptide/HLA-A*02:01 complexes such as those derived from macrophage migration inhibitory factor (MIF19-27) and NY-ESO-1157-165 enable detection and destruction of breast cancer cells in the absence of an effective anti-tumor CTL response. Intact class I HLA/peptide complexes are shed by breast cancer cells and represent potentially relevant cancer biomarkers. In this work, a breakthrough biomarker screening system for cancer diagnostics incorporating T-cell receptor mimic monoclonal antibodies combined with a novel, label-free biosensor utilizing guided-mode resonance (GMR) sensor technology is presented. Detection of shed MIF/HLA-A*02:01 complexes in MDA-MB-231 cell supernatants, spiked human serum, and patient plasma is demonstrated. The impact of this work could revolutionize personalized medicine through development of companion disease diagnostics for targeted immunotherapies.

Intact class I HLA/peptide complexes are shed by cancer cells, representing a potential relevant cancer biomarker. Utilizing label-free sensor technology and T-cell receptor mimicking monoclonal antibodies, detection of shed MIF/HLA-A*02:01 complexes in MDA-MB-231 cell supernatants, spiked human serum, and patient plasma is demonstrated, enabling development of a novel cancer diagnostic platform.

Detecção de Leucócitos Humanos Antigen Biomarkers no cancro da mama Utilizando tecnologia de biossensores livre-Label

According to the American Cancer Society, more than 200,000 women will be diagnosed with invasive breast cancer each year and approximately 40,000 will ...

Development of an in vitro model system for studying the interaction of Equus caballus IgE with its high-affinity receptor Fc&#949;RI

The interaction of IgE with its high-affinity Fc receptor (Fc&#949;RI) followed by an antigenic challenge is the principal pathway in IgE mediated allergic reactions. As a consequence of the high affinity binding between IgE and Fc&#949;RI, along with the continuous production of IgE by B cells, allergies usually persist throughout life, with currently no permanent cure available. Horses, especially race horses, which are commonly inbred, are a species of mammals that are very prone to the development of hypersensitivity responses, which can seriously affect their performance. Physiological responses to allergic sensitization in horses mirror that observed in humans and dogs. In this paper we describe the development of an in situ assay system for the quantitative assessment of the release of mediators of the allergic response pertaining to the equine system. To this end, the gene encoding equine Fc&#949;RI&#945; was transfected into and expressed onto the surface of parental Rat Basophil Leukemia (RBL-2H3.1) cells. The gene product of the transfected equine &#945;-chain formed a functional receptor complex with the endogenous rat &#946;- and &#947;-chains 1. The resultant assay system facilitated an assessment of the quantity of mediator secreted from equine Fc&#949;RI&#945; transfected RBL-2H3.1 cells following sensitization with equine IgE and antigenic challenge using &#946;-hexosaminidase release as a readout 2, 3. Mediator release peaked at 36.68% &#177; 4.88% at 100 ng ml-1 of antigen. This assay was modified from previous assays used to study human and canine allergic responses 4, 5. We have also shown that this type of assay system has multiple applications for the development of diagnostic tools and the safety assessment of potential therapeutic intervention strategies in allergic disease 6, 2, 3.

Development of an &lt;em&gt;in vitro&lt;/em&gt; model system for studying the interaction of &lt;em&gt;Equus&lt;/em&gt; &lt;em&gt;caballus&lt;/em&gt; IgE with its high-affinity receptor Fc&amp;#949;RI

The current study describes the development and applications of a genetically engineered assay system based on the transfection of rat basophilic leukemia cells with the equine Fc&#949;RI&#945; gene. Transfected cells express a functional receptor where the release of mediators of the allergic response can be activated by IgE and antigen.

Desenvolvimento de um<em&gt; In vitro</em&gt; Sistema modelo para estudar a interacção de<em&gt; Equus</em&gt;<em&gt; Caballus</em&gt; IgE ao seu receptor de elevada afinidade FceRI

The interaction of IgE with its high-affinity Fc receptor (Fc&#949;RI) followed by an antigenic challenge is the principal pathway in IgE mediated ...

Imaging CD4 T Cell Interstitial Migration in the Inflamed Dermis

The ability of CD4 T cells to carry out effector functions is dependent upon the rapid and efficient migration of these cells in inflamed peripheral tissues through an as-yet undefined mechanism. The application of multiphoton microscopy to the study of the immune system provides a tool to measure the dynamics of immune responses within intact tissues. Here we present a protocol for non-invasive intravital multiphoton imaging of CD4 T cells in the inflamed mouse ear dermis. Use of a custom imaging platform and a venous catheter allows for the visualization of CD4 T cell dynamics in the dermal interstitium, with the ability to interrogate these cells in real-time via the addition of blocking antibodies to key molecular components involved in motility. This system provides advantages over both in vitro models and surgically invasive imaging procedures. Understanding the pathways used by CD4 T cells for motility may ultimately provide insight into the basic function of CD4 T cells as well as the pathogenesis of both autoimmune diseases and pathology from chronic infections.

The mechanisms that govern the interstitial motility of CD4 effector T cells at sites of inflammation are relatively unknown. We present a non-invasive approach to visualize and manipulate in vitro-primed CD4 T cells in the inflamed ear dermis, allowing for study of the dynamic behavior of these cells in situ.

Migração intersticial imagens de células CD4 T na derme inflamadas

The ability of CD4 T cells to carry out effector functions is dependent upon the rapid and efficient migration of these cells in inflamed peripheral ...

Development of Stem Cell-derived Antigen-specific Regulatory T Cells Against Autoimmunity

Autoimmune diseases arise due to the loss of immunological self-tolerance. Regulatory T cells (Tregs) are important mediators of immunologic self-tolerance. Tregs represent about 5 - 10% of the mature CD4+ T cell subpopulation in mice and humans, with about 1 - 2% of those Tregs circulating in the peripheral blood. Induced pluripotent stem cells (iPSCs) can be differentiated into functional Tregs, which have a potential to be used for cell-based therapies of autoimmune diseases. Here, we present a method to develop antigen (Ag)-specific Tregs from iPSCs (i.e., iPSC-Tregs). The method is based on incorporating the transcription factor FoxP3 and an Ag-specific T cell receptor (TCR) into iPSCs and then differentiating on OP9 stromal cells expressing Notch ligands delta-like (DL) 1 and DL4. Following in vitro differentiation, the iPSC-Tregs express CD4, CD8, CD3, CD25, FoxP3, and Ag-specific TCR and are able to respond to Ag stimulation. This method has been successfully applied to cell-based therapy of autoimmune arthritis in a murine model. Adoptive transfer of these Ag-specific iPSC-Tregs into Ag-induced arthritis (AIA)-bearing mice has the ability to reduce joint inflammation and swelling and to prevent bone loss.

We present here a method to develop functional antigen (Ag)-specific regulatory T cells (Tregs) from induced pluripotent stem cells (iPSCs) for immunotherapy of autoimmune arthritis in a murine model.

Desenvolvimento de Células-Tronco de derivados de células T regulatórias antígeno específico da Contra Auto-imunidade

Autoimmune diseases arise due to the loss of immunological self-tolerance. Regulatory T cells (Tregs) are important mediators of immunologic ...

Evaluation of Host-Pathogen Responses and Vaccine Efficacy in Mice

Vaccines are a 20th century medical marvel. They have dramatically reduced the morbidity and mortality caused by infectious diseases and contributed to a striking increase in life expectancy around the globe. Nonetheless, determining vaccine efficacy remains a challenge. Emerging evidence suggests that the current acellular vaccine (aPV) for Bordetella pertussis (B. pertussis) induces suboptimal immunity. Therefore, a major challenge is designing a next-generation vaccine that induces protective immunity without the adverse side effects of a whole-cell vaccine (wPV). Here we describe a protocol that we used to test the efficacy of a promising, novel adjuvant that skews immune responses to a protective Th1/Th17 phenotype and promotes a better clearance of a B. pertussis challenge from the murine respiratory tract. This article describes the protocol for mouse immunization, bacterial inoculation, tissue harvesting, and analysis of immune responses. Using this method, within our model, we have successfully elucidated crucial mechanisms elicited by a promising, next-generation acellular pertussis vaccine. This method can be applied to any infectious disease model in order to determine vaccine efficacy.

Here we present an elegant protocol for in vivo evaluation of vaccine effectiveness and host immune responses. This protocol can be adapted for vaccine models that study viral, bacterial, or parasitic pathogens.

Avaliação das respostas do hospedeiro-patógeno e eficácia da vacina em camundongos

Vaccines are a 20th century medical marvel. They have dramatically reduced the morbidity and mortality caused by infectious diseases and contributed to a ...

Use of an Influenza Antigen Microarray to Measure the Breadth of Serum Antibodies Across Virus Subtypes

The influenza virus remains a significant cause of mortality worldwide due to the limited effectiveness of currently available vaccines. A key challenge to the development of universal influenza vaccines is high antigenic diversity resulting from antigenic drift. Overcoming this challenge requires novel research tools to measure the breadth of serum antibodies directed against many virus strains across different antigenic subtypes. Here, we present a protocol for analyzing the breadth of serum antibodies against diverse influenza virus strains using a protein microarray of influenza antigens.
This influenza antigen microarray is constructed by printing purified hemagglutinin and neuraminidase antigens onto a nitrocellulose-coated membrane using a microarray printer. Human sera are incubated on the microarray to bind antibodies against the influenza antigens. Quantum-dot-conjugated secondary antibodies are used to simultaneously detect IgG and IgA antibodies binding to each antigen on the microarray. Quantitative antibody binding is measured as fluorescence intensity using a portable imager. Representative results are shown to demonstrate assay reproducibility in measuring subtype-specific and cross-reactive influenza antibodies in human sera.
Compared to traditional methods such as ELISA, the influenza antigen microarray provides a high throughput multiplexed approach capable of testing hundreds of sera for multiple antibody isotypes against hundreds of antigens in a short time frame, and thus has applications in sero-surveillance and vaccine development. A limitation is the inability to distinguish binding antibodies from neutralizing antibodies.

We present a protocol for using a protein microarray constructed by printing influenza antigens onto nitrocellulose-coated slides to simultaneously probe serum for multiple antibody isotypes against over 250 antigens from different virus strains, thus allowing measurement of the breadth of serum antibodies across virus subtypes.

Uso de um microarray do antígeno da gripe para medir a amplitude de anticorpos do soro através dos subtypes do vírus

The influenza virus remains a significant cause of mortality worldwide due to the limited effectiveness of currently available vaccines. A key challenge ...