Questo lavoro è stato supportato in parte dal National Institutes of Health concede 5T32AI7493-20 e 5R01AI089337-03. I finanziatori avevano alcun ruolo nel disegno dello studio, la raccolta e l&#39;analisi dei dati, la decisione di pubblicare, o preparazione del manoscritto.

L&#39;Università di Alabama a Birmingham Istituzionale uso di animali e Comitato Cura ha approvato l&#39;uso di topi, come descritto qui sotto il numero di protocollo approvato 101.109.272. 1. genetica Costruzione di un plasmide modificato pAd5 / H5-HVR1-Kwas-HVR5-His 6 con la strategia Antigen Capside-Incorporation <ol><li> Costruzione del plasmide shuttle HVR1-Kwas-HVR5-I suoi 6 / pH5S <ol><li> Ordina un plasmide contenente la sequenza di DNA sintetizzato HVR1-Kwas tra i siti di enzimi di restrizione AGEI per ACCI di gene hexon5. </li><li> Digest 6 mg del frammento sintetizzato (HVR1-Kwas) con enzimi AGEI (6 unità) e ACCI (6 unità) per 3 ore a 37 ° C. Risolvere il frammento digerito in un gel di agarosio al 2% mediante elettroforesi, e purificare il frammento con un kit di estrazione DNA gel secondo il protocollo del produttore. </li><li> Sulla base del rapporto molare di inserto di vettore a 3: 1, utilizzare ligasi T4 DNA ligasi, bUffer per legare 12 ng del frammento (HVR1-Kwas) in 100 ng di plasmide shuttle precedentemente costruito HVR5-His 6 / pH5S 17 in un volume di 10 ml a temperatura ambiente per 2 ore, tramite i siti di AGEI e ACCI. </li><li> Transform 1 ml di 10 ml di prodotto legatura in 50 microlitri di cellule DH5α electrocompetent in elettroporatore (a 1800 V). Aggiungere 950 pl di mezzo SOC alle cellule trasformate DH5α e incubare la miscela per 1 ora a 37 ° C, con 300 rpm. Distribuire 100-200 microlitri della miscela di 1 ml sull&#39;agar Luria-Bertani (LB) contenente kanamicina e incubare O / N a 37 ° C. <ol><li> Per lo screening ~ 10 colonie mediante PCR rivolte frammento HVR1-Kwas, mescolare il primer in avanti (TATGTGTGTCATGTATGCGT), inversione di primer (GGAGGCCCACTTGTCCAGCTC) e una singola colonia DH5α in una soluzione master mix PCR (secondo il protocollo del produttore). Eseguire campioni su un termociclatore facendo riferimento al manuale fornito con la soluzione di PCR master mix. </li><li> Utilizzare il primer in avanti (TATGTGTGTCATGTATGCGT) per sequenziare il frammento HVR1-Kwas nei cloni proiettati nella sezione 1.1.4.1. </li></ol></li></ol></li><li> Costruzione del plasmide pAd5 / H5-HVR1-Kwas-HVR5-His 6 <ol><li> Digest 6 mg di HVR1-Kwas-HVR5-Il suo 6 / pH5S con enzimi EcoRI (6 unità) e PMEI (6 unità) per 3 ore a 37 ° C, e purificare il frammento contenente armi ricombinazione omologa e il doppio gene hexon5 modificato, come indicato al punto 1.1.2. Linearizzare il plasmide dorsale pAd5 / ΔH5 (GL) 16 con Swai. </li><li> Co-transform 100 ng del frammento di destinazione dal plasmide shuttle e 100 ng del backbone linearizzato pAd5 / ΔH5 (GL) in 50 ml di cellule BJ5183 electrocompetent per la ricombinazione omologa in elettroporatore (a 1800 V). Aggiungere 950 pl di mezzo SOC alle cellule trasformate e incubare la miscela per 1 ora a 37 ° C, 300 rpm. Distribuire 100-200 microlitri della miscela di 1 mlsulla agar LB contenente kanamicina (finale 50 mg / ml) per O / N incubazione a 37 ° C. <ol><li> Raccogliere ~ 10 minuscole colonie in 3 ml di LB liquido contenente kanamicina (finale 50 mg / ml) per O / N incubazione a un agitatore (250 rpm, 37 ° C). Estrarre plasmidi della cultura. Utilizzare l&#39;analisi PCR per lo screening delle 10 colonie di mira il frammento HVR1-Kwas, come illustrato al punto 1.1.4.1. </li><li> Per schermare le stesse colonie di PCR mira il frammento pix del genoma spina dorsale, mescolare il primer in avanti (AGCTGTTGGATCTGCGCCAGCAGGTT), inversione di primer (CCAAACAGAGTCTGGTTTTTTATTTAT) e un singolo BJ5183 colonia in una soluzione master mix PCR (secondo il protocollo del produttore). Eseguire campioni su un termociclatore facendo riferimento al manuale fornito con la soluzione di master mix PCR. </li><li> Designare le colonie doppio positive PCR come pAd5 / H5-HVR1-Kwas-HVR5-His 6. </li></ol></li><li> Trasforma 100 ng del plasmide pAd5 / H5-HVR1-Kwas-HVR5-His 6 ina DH5α cellule, come illustrato al punto 1.1.4. <ol><li> Utilizzare l&#39;analisi PCR per lo screening ~ 10 colonie di mira il frammento HVR1-Kwas, come illustrato al punto 1.1.4.1. </li><li> Utilizzare l&#39;analisi PCR per schermare le stesse colonie di mira il frammento pix del genoma spina dorsale, come illustrato al punto 1.2.2.2. </li><li> Utilizzare il primer in avanti (TATGTGTGTCATGTATGCGT) per sequenziare il frammento HVR1-Kwas in pAd5 / H5-HVR1-Kwas-HVR5-His 6. </li></ol></li></ol></li></ol> 2. Preparazione di Modified Ad5 Viral Vector Ad5 / H5-HVR1-Kwas-HVR5-His 6 <ol><li> Costituiscono il mezzo completo con l&#39;aggiunta di FBS (finale il 10%), 100X non essenziali Aminoacidi (finale 0,1 mm), 200 mm L-glutammina (finale 2 mm) e la penicillina / streptomicina soluzione (finale 1%) in DMEM con alte concentrazioni di glucosio . Mantenere rene embrionale (HEK293), le cellule umane in terreno completo in un incubatore culturale (37 ° C e 5% di CO2 sotto l&#39;85% condizioni umidificati). </li><li> Salvataggio di virale vector Ad5 / H5-HVR1-Kwas-HVR5-His 6 <ol><li> Seed 3.0 x 10 6 cellule HEK293 in uno T-25 pallone contenente 5 ml di mezzo completo e coltura O / N per ottenere un monostrato con 80% di confluenza. </li><li> Linearizzare 15 mg di pAd5 / H5-HVR1-Kwas-HVR5-His 6 in un volume di 100 ml con enzima di restrizione Paci (15 unità) a 37 ° C per 3 ore. <ol><li> Estrarre linearizzato pAd5 / H5-HVR1-Kwas-HVR5-His 6 centrifugando reazione due volte (10.000 xg per 1 min) con un volume uguale di fenolo: cloroformio: alcool isoamilico (rapporto a 25: 24: 1) in una cappa aspirante , e per centrifugazione sequenziale (10.000 xg per 10 min) con una soluzione mista (300 ml di etanolo al 100% e 10 ml di acetato di sodio) e 700 ml di etanolo al 70%. Gettare il surnatante in ogni fase di centrifugazione. </li></ol></li><li> Risospendere il plasmide purificato in ~ 40 ml di acqua distillata o Tris-EDTA (TE) buffer. Quantificare il DNA plasmidico misurando la de otticansity (OD) a 260 nm. </li><li> Trasfettare 3 pg di plasmide linearizzato con commerciale reagente liposomiale trasfezione nel pallone T-25, in base al manuale del costruttore. Cambiare il medio trasfezione con terreno completo a 6 ore dopo la trasfezione e successiva incubazione nell&#39;incubatrice cultura. Mantenere cellule trasfettate sostituendo terreno completo ogni due o tre giorni, fino al singolo modello placche virali. </li><li> Quando placche sviluppano a pieno effetto citopatico (CPE), raschiare le rimanenti celle esterne matraccio in una cappa sterile, lisato cellulare raccolta mediante centrifugazione media a 300 xg per 10 min a 4 ° C. Sospendere il pellet cellulare in ~ 1 ml di terreno contenente 2% FBS, e rompere le cellule da congelamento-scongelamento quattro volte. Raccogliere il surnatante contenente virus in salvo dopo centrifugazione lisato a 10.000 xg per 10 minuti a 4 ° C. </li></ol></li><li> Propagazione su larga scala del vettore virale Ad5 / H5-HVR1-Kwas-HVR5-His 6 <ol><li> Propagazione the virus in un pallone T-75 contenenti cellule HEK293 nella cappa sterile infettando con 1/3 a pieno lisato dal pallone T-25. Lasciare pieno CPE per sviluppare entro due o tre giorni in incubatrice cultura. Raccogliere il surnatante lisato come indicato al punto 2.2.5. </li><li> Propagare il virus uno a tre T-175 palloni in cappa sterile infettando con 1/2 a pieno lisato dal pallone T-75, a seconda delle condizioni di propagazione del virus. Lasciare pieno CPE per sviluppare entro due o tre giorni in incubatrice cultura. Raccogliere il surnatante lisato come indicato al punto 2.2.5. </li><li> Propagare il virus in un dozzina o più T-175 palloni della cappa sterile infettando con 1/2 a pieno lisato dal pallone T-175 precedente (s). Determinare la quantità di utilizzo della boccetta sulla base delle condizioni di propagazione di virus e la quantità di virus nel bisogno. Raccogliere il surnatante lisato come indicato al punto 2.2.5 quando si verifica completa CPE entro due o tre giorni in incubatrice cultura. </li></ol></li><li> Purificazione di Ad5 / H5-HVR1-Kwas-HVR5-His 6 da cloruro di cesio <ol><li> Preparare due densità di soluzioni CsCl in 5 mM HEPES: 1,33 g / ml e 1,45 g / ml, evitando il contatto con CsCl. </li><li> Carico 4 ml di CsCl (1,33 g / ml) in una provetta sterile ultracentrifuga e caricare delicatamente 4 ml di CsCl (1,45 g / ml) contro fondo della provetta. Carico 4 ml di lisato surnatante lentamente sopra dei gradienti nella cappa sterile. </li><li> Centrifugare la provetta a 110.000 xg per 3 ore a 4 ° C per separare il gruppo di virus maturo / inferiore dalla fascia virus difettoso / alto. Raccogliere la banda inferiore utilizzando una siringa da 3 ml armato con un ago G 33 e diluire la fascia con 5 mM HEPES a un volume di 4 ml nella cappa sterile. </li><li> Caricare un altro tubo a due densità di soluzioni CsCl e la fascia diluita di virus come descritto al punto 2.4.2. Centrifugare la provetta a 110.000 xg O / N a 4 ° C. Raccogliere la band virale come descritto al punto 2.4.3. </li><li> Iniettare la soluzione virus raccolti in un dialysè cassette da una siringa da 3 ml armato di ago G 33 nella cappa sterile. </li><li> Posizionare la cassetta in 700 ml di tampone di dialisi 1x (1 L ricetta: 100 ml di PBS 10x, 100 ml del 100% glicerolo e 800 ml di acqua distillata, filtrare il buffer attraverso un filtro di 0,22 micron) e sostituire il tampone di dialisi ogni 3 ore per 4 volte. Aspirare fuori soluzione virus dializzato mediante siringa agugliato. </li></ol></li></ol> 3. La convalida del vettore virale Rescued <ol><li> Vettore virale titolazioni <ol><li> Per il virus titolo fisica, diluire sia virus e tampone di dialisi (controllo di sfondo) a 1: 10 e 1: 20 in tampone di lisi virus (10% SDS in Tris-EDTA) in tubetti, e incubare tutte le provette a 56 ° C per 10 min. </li><li> Accendere un BioPhotometer e impostare la modalità di assorbanza a OD 260 nm. Utilizzare il buffer di dialisi diluito (1: 10) per bilanciare il segnale di fondo cliccando il fondo &quot;vuoto&quot;. Tipo &quot;10 + 90&quot; nella scr BioPhotometereen, e leggere il segnale di virus diluito (1: 10). </li><li> Leggere il segnale di virus diluito (1: 20) seguendo il metodo in fase 3.1.2, ma invece digitare &quot;5 + 95&quot; nella schermata BioPhotometer. Moltiplicare due numeri lettura virus da 1.1x10 12 e calcolare il titolo medio con un apparecchio come VP / ml, in base ai due titoli individuali delle due diluizioni. </li><li> Per il titolo infettivo del virus (IP / ml), utilizzare il Karber TCID statistico 50 14 metodo per determinare la profondità infezione sulle cellule HEK293 a 10 giorni dopo l&#39;infezione (dpi) </li></ol></li><li> Valutazione della visualizzazione dell&#39;esposizione antigenica sul vettore virale <ol><li> Rivestire la vettore virale in una piastra ELISA e procedere con il resto dei passaggi in un metodo standard ELISA 14. Usa anti-gp41 (2F5) anticorpo umano monoclonale (mAb) e mouse anti-His mAb per la rilevazione di antigeni corrispondenti incorporati 14. </li><li> Risolvere il vettore virale in un denatuelettroforesi su gel di proteine ​​rosso (SDS-PAGE) e procedere con il resto dei passaggi in un metodo western-blot standard 14. Usa anti-gp41 (2F5) anticorpo umano monoclonale (mAb) e mouse anti-His mAb per la rilevazione di antigeni corrispondenti incorporati 14. </li></ol></li><li> Valutazione in vitro del vettore sulla capacità di bypassare sieri Ad5-positivo <ol><li> Mantenere cellule HeLa in terreno completo in incubatrice coltura (37 ° C e 5% di CO 2 in 85% condizioni umidificati). Costituiscono il mezzo completo aggiungendo FBS (finale 10%), 200 mM di L-glutammina (2 mM finale) e soluzione di penicillina / streptomicina (finale 1%) in Minimum Essential medio Eagle (MEME). </li><li> Seed cellule HeLa in piastre da 6 pozzetti a 1x10 6 cellule / pozzetto e incubare le piastre nell&#39;incubatore coltura (37 ° C e 5% CO 2 85% in condizioni umidificati) per 2 ore. Incubare sieri Ad5-positivi (0,1 ml o 0 ml) con 5 IP / cellula di vettore virale (Ad5 o Ad5 / H5-HVR1-Kwas-HVR5-His 6) in incubatrice coltura per 1 ora prima di aggiungere le miscele sulle 6-pozzetti contenenti cellule. </li><li> A 24 ore dopo l&#39;infezione (HPI), lavare le cellule una volta con PBS e le cellule Lisare in 0,5 ml di tampone di lisi. Centrifugare a 15.000 xg per 5 minuti e raccogliere il surnatante. Mescolare 20 ml di surnatante con 100 ml di substrato luciferasi per la lettura del segnale luciferasi, poiché virus contengono il gene della luciferasi. </li></ol></li></ol> 4. immunologico Valutazione del vettore virale Rescued <ol><li> Preparare due gruppi di immunizzazione: Ad5 e Ad5 / H5-HVR1-Kwas-HVR5-His 6. <ol><li> Iniettare topi (n = 8 / gruppo) per via intramuscolare con i virus a 1x10 10 VP / mouse, in un &quot;prime-boost&quot; regime di immunizzazione omologa, con un intervallo di 2 settimane. </li><li> A 2 settimane dopo ogni iniezione, sanguinare topi senza anestesia da guancia sanguinante con lancette animali (5 mm Lunghezza punta) araccogliere il sangue in provette da 1,5 ml. </li></ol></li><li> Mescolare il sangue nei tubi invertendo su e giù, e incubare il sangue a temperatura ambiente per 30 min. Spin le provette a 10.000 xg per 5 minuti a 4 ° C ed i sieri di trasferimento (strato superiore) a nuove provette da 1,5 ml. <ol><li> Spin i nuovi tubi a 10.000 xg per 5 minuti a 4 ° C e trasferimento sieri ora contrassegnati provette da 1,5 ml per la conservazione a -80 ° C. </li></ol></li><li> La valutazione di antigene-specifica immunità umorale dalla società Sera-ELISA <ol><li> Diluire suo peptide (azione a 1 mm) e HIV-1 peptide (azione a 1 mm) separatamente nel 100. </li><li> mM tampone carbonato (pH 9,5) per ottenere la concentrazione di rivestimento peptide a 10 mM. Rivestire le piastre ELISA con i peptidi diluiti separatamente con l&#39;aggiunta di 100 pl per pozzetto e incubare le piastre O / N a 4 ° C. </li><li> Lavare i piatti con PBST per quattro volte a 200 l / pozzetto e blocco per 1 ora a 5% di BSA in PBST. Applicare sieri topi per le piastre a diluizione 1: 100 nel BUF bloccofer, 100 l / pozzetto. Incubare per 2 ore di incubazione a RT. </li><li> Lavare le piastre con PBST per quattro volte. Bloccare le piastre incubando a temperatura ambiente per 30 min in tampone di bloccaggio a 100 microlitri / pozzetto. </li><li> Applicare capra anti-topo IgG-HRP (1: 5000 in tampone bloccante) a 100 ml / pozzetto per entrambe le piastre rivestite con il suo peptide e HIV-1 peptide singolarmente. Incubare per 2 ore a temperatura ambiente. Lavare i piatti con PBST. </li><li> Leggere le piastre a OD450 nm dopo incubazione con il substrato HRP per 30 min. </li></ol></li></ol>

<ol>
	<li>Cheng, S. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Coexpression+of+the+simian+immunodeficiency+virus+Env+and+Rev+proteins+by+a+recombinant+human+adenovirus+host+range+mutant.">Coexpression of the simian immunodeficiency virus Env and Rev proteins by a recombinant human adenovirus host range mutant.</a> Journal of virology. 66, 6721-6727 (1992).</li><li>Matthews, Q. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=HIV+antigen+incorporation+within+adenovirus+hexon+hypervariable+2+for+a+novel+HIV+vaccine+approach.">HIV antigen incorporation within adenovirus hexon hypervariable 2 for a novel HIV vaccine approach.</a> PloS one. 5, e11815 (2010).</li><li>DeMatteo, R. P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Long-lasting+adenovirus+transgene+expression+in+mice+through+neonatal+intrathymic+tolerance+induction+without+the+use+of+immunosuppression.">Long-lasting adenovirus transgene expression in mice through neonatal intrathymic tolerance induction without the use of immunosuppression.</a> Journal of virology. 71, 5330-5335 (1997).</li><li>Gu, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+recombinant+adenovirus-based+vector+elicits+a+specific+humoral+immune+response+against+the+V3+loop+of+HIV-1+gp120+in+mice+through+the+'Antigen+Capsid-Incorporation'+strategy.">A recombinant adenovirus-based vector elicits a specific humoral immune response against the V3 loop of HIV-1 gp120 in mice through the 'Antigen Capsid-Incorporation' strategy.</a> Virology journal. 11, 112 (2014).</li><li>Matthews, Q. L., Krendelchtchikov, A. L. G., Li, Z. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Viral+Vectors+for+Vaccine+Development.">Viral Vectors for Vaccine Development.</a> INTECH. , (2013).</li><li>Tang, D. C., Zhang, J., Toro, H., Shi, Z., Van Kampen, K. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Adenovirus+as+a+carrier+for+the+development+of+influenza+virus-free+avian+influenza+vaccines.">Adenovirus as a carrier for the development of influenza virus-free avian influenza vaccines.</a> Expert review of vaccines. 8, 469-481 (2009).</li><li>Flatt, J. W., Kim, R., Smith, J. G., Nemerow, G. R., Stewart, P. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+intrinsically+disordered+region+of+the+adenovirus+capsid+is+implicated+in+neutralization+by+human+alpha+defensin+5.">An intrinsically disordered region of the adenovirus capsid is implicated in neutralization by human alpha defensin 5.</a> PloS one. 8, e61571 (2013).</li><li>Bradley, R. R., Lynch, D. M., Iampietro, M. J., Borducchi, E. N., Barouch, D. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Adenovirus+serotype+5+neutralizing+antibodies+target+both+hexon+and+fiber+following+vaccination+and+natural+infection.">Adenovirus serotype 5 neutralizing antibodies target both hexon and fiber following vaccination and natural infection.</a> Journal of virology. 86, 625-629 (2012).</li><li>Zaiss, A. K., Machado, H. B., Herschman, H. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+influence+of+innate+and+pre-existing+immunity+on+adenovirus+therapy.">The influence of innate and pre-existing immunity on adenovirus therapy.</a> Journal of cellular biochemistry. 108, 778-790 (2009).</li><li>Sumida, S. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Neutralizing+antibodies+and+CD8++T+lymphocytes+both+contribute+to+immunity+to+adenovirus+serotype+5+vaccine+vectors.">Neutralizing antibodies and CD8+ T lymphocytes both contribute to immunity to adenovirus serotype 5 vaccine vectors.</a> Journal of virology. 78, 2666-2673 (2004).</li><li>Sumida, S. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Neutralizing+antibodies+to+adenovirus+serotype+5+vaccine+vectors+are+directed+primarily+against+the+adenovirus+hexon+protein.">Neutralizing antibodies to adenovirus serotype 5 vaccine vectors are directed primarily against the adenovirus hexon protein.</a> Journal of immunology. 174, 7179-7185 (2005).</li><li>Bradley, R. R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Adenovirus+serotype+5-specific+neutralizing+antibodies+target+multiple+hexon+hypervariable+regions.">Adenovirus serotype 5-specific neutralizing antibodies target multiple hexon hypervariable regions.</a> Journal of virology. 86, 1267-1272 (2012).</li><li>Gahery-Segard, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Immune+response+to+recombinant+capsid+proteins+of+adenovirus+in+humans:+antifiber+and+anti-penton+base+antibodies+have+a+synergistic+effect+on+neutralizing+activity.">Immune response to recombinant capsid proteins of adenovirus in humans: antifiber and anti-penton base antibodies have a synergistic effect on neutralizing activity.</a> Journal of virology. 72, 2388-2397 (1998).</li><li>Gu, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Using+multivalent+adenoviral+vectors+for+HIV+vaccination.">Using multivalent adenoviral vectors for HIV vaccination.</a> PloS one. 8, e60347 (2013).</li><li>Tian, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Protection+against+enterovirus+71+with+neutralizing+epitope+incorporation+within+adenovirus+type+3+hexon.">Protection against enterovirus 71 with neutralizing epitope incorporation within adenovirus type 3 hexon.</a> PloS one. 7, e41381 (2012).</li><li>Wu, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Construction+and+characterization+of+adenovirus+serotype+5+packaged+by+serotype+3+hexon.">Construction and characterization of adenovirus serotype 5 packaged by serotype 3 hexon.</a> Journal of virology. 76, 12775-12782 (2002).</li><li>Wu, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Identification+of+sites+in+adenovirus+hexon+for+foreign+peptide+incorporation.">Identification of sites in adenovirus hexon for foreign peptide incorporation.</a> Journal of virology. 79, 3382-3390 (2005).</li><li>Qiu, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Serotype-specific+neutralizing+antibody+epitopes+of+human+adenovirus+type+3+(HAdV-3)+and+HAdV-7+reside+in+multiple+hexon+hypervariable+regions.">Serotype-specific neutralizing antibody epitopes of human adenovirus type 3 (HAdV-3) and HAdV-7 reside in multiple hexon hypervariable regions.</a> Journal of. 86, 7964-7975 (2012).</li><li>Parker, C. E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Fine+definition+of+the+epitope+on+the+gp41+glycoprotein+of+human+immunodeficiency+virus+type+1+for+the+neutralizing+monoclonal+antibody+2F5.">Fine definition of the epitope on the gp41 glycoprotein of human immunodeficiency virus type 1 for the neutralizing monoclonal antibody 2F5.</a> Journal of virology. 75, 10906-10911 (2001).</li><li>Farrow, A. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Immunization+with+Hexon+Modified+Adenoviral+Vectors+Integrated+with+gp83+Epitope+Provides+Protection+against+Trypanosoma+cruzi+Infection.">Immunization with Hexon Modified Adenoviral Vectors Integrated with gp83 Epitope Provides Protection against Trypanosoma cruzi Infection.</a> PLoS neglected tropical diseases. 8, e3089 (2014).</li><li>Krause, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Epitopes+expressed+in+different+adenovirus+capsid+proteins+induce+different+levels+of+epitope-specific+immunity.">Epitopes expressed in different adenovirus capsid proteins induce different levels of epitope-specific immunity.</a> Journal of virology. 80, 5523-5530 (2006).</li><li>Omori, N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Modification+of+a+fiber+protein+in+an+adenovirus+vector+improves+in+vitro+gene+transfer+efficiency+to+the+mouse+microglial+cell+line.">Modification of a fiber protein in an adenovirus vector improves in vitro gene transfer efficiency to the mouse microglial cell line.</a> Neuroscience letters. 324, 145-148 (2002).</li><li>Dmitriev, I. P., Kashentseva, E. A., Curiel, D. T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Engineering+of+adenovirus+vectors+containing+heterologous+peptide+sequences+in+the+C+terminus+of+capsid+protein+IX.">Engineering of adenovirus vectors containing heterologous peptide sequences in the C terminus of capsid protein IX.</a> Journal of virology. 76, 6893-6899 (2002).</li><li>Xue, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Construction+and+characterization+of+a+recombinant+human+adenovirus+type+3+vector+containing+two+foreign+neutralizing+epitopes+in+hexon.">Construction and characterization of a recombinant human adenovirus type 3 vector containing two foreign neutralizing epitopes in hexon.</a> Virus research. 183, 67-74 (2014).</li><li>Tian, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Construction+and+characterization+of+human+adenovirus+serotype+3+packaged+by+serotype+7+hexon.">Construction and characterization of human adenovirus serotype 3 packaged by serotype 7 hexon.</a> Virus research. 160, 214-220 (2011).</li><li>Kim, J. W., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+adenovirus+vector+incorporating+carbohydrate+binding+domains+utilizes+glycans+for+gene+transfer.">An adenovirus vector incorporating carbohydrate binding domains utilizes glycans for gene transfer.</a> PloS one. 8, e55533 (2013).</li><li>Vasconcelos, J. R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Pathogen-induced+proapoptotic+phenotype+and+high+CD95+(Fas)+expression+accompany+a+suboptimal+CD8++T-cell+response:+reversal+by+adenoviral+vaccine.">Pathogen-induced proapoptotic phenotype and high CD95 (Fas) expression accompany a suboptimal CD8+ T-cell response: reversal by adenoviral vaccine.</a> PLoS pathogens. 8, e1002699 (2012).</li><li>Matthews, Q. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genetic+incorporation+of+a+herpes+simplex+virus+type+1+thymidine+kinase+and+firefly+luciferase+fusion+into+the+adenovirus+protein+IX+for+functional+display+on+the+virion.">Genetic incorporation of a herpes simplex virus type 1 thymidine kinase and firefly luciferase fusion into the adenovirus protein IX for functional display on the virion.</a> Molecular imaging. 5, 510-519 (2006).</li></ol>

Gli autori non hanno nulla da rivelare.

L&#39;applicazione della strategia transgene tradizionale sulla modificazione Ad5 per lo sviluppo di vaccini è stata diminuita principalmente per il collo di bottiglia associato alla Ad5 PEI 4,6. Questo collo di bottiglia può essere parzialmente diminuito applicando il alternativa strategia capside-Incorporation (Figura 1A), poiché questa strategia può sfuggire neutralizzazione da Ad5 NAbs sostituendo neutralizzanti epitopi di Ad5 con antigeni-di interesse, e facilitare la generazione di ...

Adenovirus umano (Ad) è un virus senza involucro di medie dimensioni con un nucleocapside icosaedrica con un letto genoma DNA filamento. Ad appartiene alla famiglia Adenoviridae, con una classificazione in sette gruppi (da A a G). Ciascun gruppo contiene virus di diversi sierotipi. Di cui, adenovirus sierotipo 5 (Ad5) dal gruppo C è stato il più ampiamente studiato e il più ampiamente richiesto approcci Vectored come la terapia genica e le vaccinazioni. La strategia transgene tradizionale è stato sviluppato e applicato per modifiche Ad5, che si caratterizza per lo spostamento dei primi virus geni con un gene di interesse, e l&#39;espressione mirata del gene di interesse in un host. Esempi sono la costruzione di pENV9 / Ad5hrΔE3 sostituendo presto gene 3 (E3) con rev gene di Simian Immunodeficiency Virus 1, la costruzione di AdCMVGag sostituendo presto gene 1 (E1) con il gene gag di immunodeficienza umanaVirus (HIV) 2, e la costruzione di Ad lac Z sostituendo E1 con gene lac Z 3. L&#39;ampia applicazione della strategia transgene tradizionale Ad5 dipende dai seguenti vantaggi: l&#39;ampia gamma di ospiti per Ad5, dell&#39;ingegneria gene fattibile su virus e la propagazione del virus, la grande alloggio dell&#39;inserto gene estraneo e la sicurezza di Ad5 4,5. Tuttavia, i valori di efficacia ridotto di terapie cliniche Ad5-vettorizzate mediante l&#39;uso di questa strategia è stato un collo di bottiglia importante, che è stato mappato per essere associato principalmente Ad5 PEI, dato che Ad5 è così diffuso tra la maggior parte dei bambini e degli adulti 4,6. Per superare il principale collo di bottiglia Ad5, l&#39;obiettivo primario è quello di sviluppare una strategia alternativa aggirare Ad5 PEI. L&#39;immunità innata 7, immunità adattativa come anticorpi neutralizzanti (NABS) 8-10 e CD8 + T risposte delle cellule 10 contro Ad5 hanno dimostrato di collaborarentribute a Ad5 PEI, con Ad5 NAbs che sembra svolgere il ruolo dominante dei contributi per Ad5 PEI 10,11. Inoltre, Ad5 NAB epitopi beneficiarie situate in proteine ​​del capside, tra cui la principale hexon proteine, fibre e base Penton. Di cui, hexon è l&#39;obiettivo principale di Ad5 NAbs 8,11-13. Sulla base di questi risultati, è stato introdotto un innovativo strategia Antigen Capside-incorporazione. Questo romanzo strategia mette in evidenza la sostituzione o integrazione di proteine-di-interessi su proteine ​​del capside Ad5, che sposta o maschere epitopi Ad5 neutralizzanti, che porta alla diminuzione riconoscimento da parte NAbs ed efficienti le amministrazioni vettoriali Ad5. È interessante notare che questa strategia è competitivo, perché può anche aiutare gli host suscitano robusta immunità umorale e dell&#39;immunità cellulare potente da direttamente presentando antigeni di interessi per il sistema immunitario 4,14,15. Sulla base di questa strategia, la clonazione molecolare e ricombinante salvataggio annuncio vettore virale può essere strutturalmente divisoin quattro fasi principali: (a) la preparazione di frammento di gene di interessi da una reazione a catena della polimerasi (PCR) o sintesi; (B) la legatura del frammento di gene in un plasmide navetta che contiene il frammento di gene-di-interesse e braccia omologhe a una backbone adenovirus; (C) la ricombinazione omologa da co-trasformando il plasmide shuttle contenente il frammento di gene di interessi con la spina dorsale plasmide linearizzato pAd5 / ΔH5 (GL) 16; (D) la transfezione di linearizzato plasmide adenovirale ricombinante per salvare il vettore ricombinante annuncio integrato con gli antigeni-di-interessi. Il nostro gruppo e alcuni altri hanno esteso questa strategia incorporazione Annuncio alternativa per annuncio lo sviluppo di vaccini vectored contro diversi agenti patogeni infettivi. Abbiamo riportato la generazione di un annuncio vettore ricombinante Ad-HVR1-lgs-His 6 -v3 incorporando un His-tag HIV-1 antigene V3 nel locale HVR1 di Ad5 hexon (hexon5). Questo vettore generato innescato strong risposta immunitaria umorale specifica per il epitopo V3 4. Abbiamo anche segnalato lo sviluppo di Ad5 / HVR2-MPER-L15ΔE1 incorporando HIV-1 membrana regione ectodomain prossimale (MPER) nel locale HVR2 di hexon5 2. Inoltre, il gruppo del Dr. Zhou ha utilizzato i benefici di questa strategia Ad integrazione di sviluppare annuncio sierotipo 3 (Ad3) vaccini vettorizzate, vale a dire., La generazione di virus vettore R1SP70A3 incorporando un SP70 neutralizzante epitopo di Enterovirus 71 nella HVR1 di Ad3 hexon (hexon3). R1SP70A3 generato NAbs forti e produzione di IFN-γ specifici per la SP70 epitopo, che portano al alto tasso di protezione contro Enterovirus 71 sfida 15. Ai fini di riferimento tecnico, il nostro studio ha approfittato della strategia qualitativa Antigen Capside-incorporazione di concentrarsi sulla generazione di un bivalente Ad5 vettore Ad5 / H5-HVR1-Kwas-HVR5-His 6 incorporando un antigene HIV-1 in HVR1 unda sua tag nel HVR5 di hexon5. Il vettore virale generato è stato anche immunologicamente valutata. La strategia di Antigen Capside-Incorporation potrebbero essere utilizzati per lo sviluppo di approcci di vaccinazione Ad5-vettorizzate contro diverse malattie infettive.

<table border="0" cellpadding="0" cellspacing="0">
	<tbody>
		<tr>
			<td>1x DPBS</td>
			<td>Thermo Scientific</td>
			<td>SH30256.01</td>
			<td>for cell spliting&#160;</td>
		</tr>
		<tr>
			<td>10x DPBS</td>
			<td>Thermo Scientific</td>
			<td>SH30378.02</td>
			<td>for dialysis buffer preparation</td>
		</tr>
		<tr>
			<td>glycerol</td>
			<td>SIGMA</td>
			<td>G5516-1L</td>
			<td>for dialysis buffer preparation</td>
		</tr>
		<tr>
			<td>SDS</td>
			<td>BIO-RAD</td>
			<td>161-0301</td>
			<td>for virus lysis buffer preparation</td>
		</tr>
		<tr>
			<td>Fetal Bovine Serum (FBS)</td>
			<td>Thermo Scientific</td>
			<td>SH30910.03</td>
			<td>component of culture medium</td>
		</tr>
		<tr>
			<td>100X Non-Essential Amino Acids&#160;</td>
			<td>Thermo Scientific</td>
			<td>SH30238.01</td>
			<td>component of culture medium</td>
		</tr>
		<tr>
			<td>200mM/L L-glutamine</td>
			<td>Cellgro</td>
			<td>25-005-CI</td>
			<td>component of culture medium</td>
		</tr>
		<tr>
			<td>penicillin/streptomycin solution&#160;</td>
			<td>Cellgro</td>
			<td>30-002-CI</td>
			<td>component of culture medium</td>
		</tr>
		<tr>
			<td>DMEM with high glucose</td>
			<td>Thermo Scientific</td>
			<td>SH30081.01</td>
			<td>for HEK293 cell culture</td>
		</tr>
		<tr>
			<td>Minimum Essential Medium Eagle</td>
			<td>SIGMA</td>
			<td>M5650</td>
			<td>for HeLa cell culture</td>
		</tr>
		<tr>
			<td>phenol:chloroform:isoamyl alcohol&#160;</td>
			<td>SIGMA</td>
			<td>P3803-100ML</td>
			<td>for large size of DNA purification</td>
		</tr>
		<tr>
			<td>cesium chloride&#160;</td>
			<td>Research Products International Corp.</td>
			<td>C68050</td>
			<td>for virus purificiation</td>
		</tr>
		<tr>
			<td>HEPES</td>
			<td>Cellgro</td>
			<td>25-060-CI</td>
			<td>for CsCl solution preparation</td>
		</tr>
		<tr>
			<td>HEK293</td>
			<td>ATCC</td>
			<td>51-0036</td>
			<td>for virus rescue and upscale</td>
		</tr>
		<tr>
			<td>HeLa</td>
			<td>ATCC</td>
			<td>CCL-2</td>
			<td>for neutralization assay</td>
		</tr>
		<tr>
			<td>T-25 flask</td>
			<td>Thermo Scientific</td>
			<td>156367</td>
			<td>for cell culture&#160;</td>
		</tr>
		<tr>
			<td>T-75 flask</td>
			<td>CORNING</td>
			<td>430641</td>
			<td>for cell culture&#160;</td>
		</tr>
		<tr>
			<td>T-175 flask</td>
			<td>Thermo Scientific</td>
			<td>159910</td>
			<td>for cell culture&#160;</td>
		</tr>
		<tr>
			<td>Ultracentrifuge</td>
			<td>BECKMAN</td>
			<td>NA</td>
			<td>for virus purification</td>
		</tr>
		<tr>
			<td>Ultracentrifuge tube</td>
			<td>BECKMAN</td>
			<td>344059</td>
			<td>for virus purification</td>
		</tr>
		<tr>
			<td>dialysis cassette&#160;</td>
			<td>Thermo Scientific</td>
			<td>66380</td>
			<td>for virus dialysis</td>
		</tr>
		<tr>
			<td>ELISA plate</td>
			<td>Thermo Scientific</td>
			<td>442404</td>
			<td>for ELISA</td>
		</tr>
		<tr>
			<td>human anti-gp41 (2F5) mAb</td>
			<td>NIH AIDS Reagent Program</td>
			<td>1475</td>
			<td>for immunological assays</td>
		</tr>
		<tr>
			<td>mouse anti-His tag mAb</td>
			<td>GenScript</td>
			<td>A00186</td>
			<td>for immunological assays</td>
		</tr>
		<tr>
			<td>SOC medium</td>
			<td>CORNING</td>
			<td>46-003-CR</td>
			<td>for transformation</td>
		</tr>
		<tr>
			<td>PCR master mix solution</td>
			<td>QIAGEN</td>
			<td>201445</td>
			<td>for PCR</td>
		</tr>
		<tr>
			<td>Animal lancet (point length at 5mm)</td>
			<td>MEDIpoint</td>
			<td></td>
			<td>for mice bleeding&#160;</td>
		</tr>
		<tr>
			<td>Biophotometer</td>
			<td>Eppendorf</td>
			<td></td>
			<td>for virus physical titer titration</td>
		</tr>
	</tbody>
</table>

utilizing the antigen capsid-incorporation strategy for the development of adenovirus serotype 5-vectored vaccine approaches

Adenovirus sierotipo 5 (Ad5) è stato ampiamente modificato con metodi tradizionali transgene per lo sviluppo di vaccini. Le efficacies ridotte di questi vettori Ad5 tradizionalmente modificati negli studi clinici potrebbero essere correlati principalmente Ad5 immunità pre-esistente (PEI) tra la maggioranza della popolazione. Per promuovere lo sviluppo di vaccini Ad5 vettorizzate risolvendo la preoccupazione di Ad5 PEI, l&#39;innovativa strategia di Antigen Capside-Incorporation è stato impiegato. Per merito di questa strategia, Ad5 vettorizzate abbiamo costruito la navetta hexon plasmide HVR1-Kwas-HVR5-I suoi 6 / pH5S di subcloning regione ipervariabile (HVR) 1 di hexon in un plasmide shuttle precedentemente costruito HVR5-I suoi 6 / pH5S, che ha avuto il suo tag 6 incorporato nel HVR5. Questo frammento di DNA che contiene una HVR1 HIV epitopo ELDKWAS è stato sintetizzato. HVR1-Kwas-HVR5-I suoi 6 / pH5S era allora linearizzato e co-trasformato con linearizzato dorsale plasmide pAd5 / ΔH5 (GL),per ricombinazione omologa. Questo plasmide ricombinato pAd5 / H5-HVR1-Kwas-HVR5-His 6 è stato trasfettato in cellule per generare il vettore virale Ad5 / H5-HVR1-Kwas-HVR5-His 6. Questo vettore è stato validato per avere idoneità qualitativa indicato dal titolo virale fisico (VP / ml), titolo infettiva (IP / ml) e corrispondenti il ​​rapporto / IP VP. Sia l&#39;epitopo HIV e la sua etichetta 6 erano-superficie esposta sul capside Ad5, e trattenuti specifici epitopi antigenicità di loro. Un saggio di neutralizzazione indicava la capacità di questo bivalente vettore per aggirare la neutralizzazione da sieri Ad5 positivi in vitro. I topi di immunizzazione ha dimostrato la generazione di robusta immunità umorale specifica per l&#39;epitopo HIV e la sua 6. Questo studio di prova di principio suggerito che il protocollo associato alla strategia capside-Incorporation potrebbe essere fattivamente utilizzato per la generazione di vaccini Ad5-vettorizzate modificando diverse proteine ​​del capside. Questo protocollo potrebbe anche essere fn ulteriore modificato per la generazione di rare sierotipo vaccini adenovirus vettorizzate.

La strategia di Antigen Capside-Incorporation (Figura 1A) è stato utilizzato per generare il bivalente Ad5 vettore virale Ad5 / H5-HVR1-Kwas-HVR5-His 6. In primo luogo, la navetta plasmide HVR1-Kwas-HVR5-Il suo 6 / pH5S è stato costruito da subcloning HVR1-Kwas frammento nella precedente plasmide shuttle costruito HVR5-Il suo 6 / pH5S 17. In secondo luogo, il plasmide pAd5 / H5-HVR1-Kwas-HVR5-His 6 14 è stato costruito da una ricombina...

Watch this Scientific Journal Video about Utilizing the Antigen Capsid-Incorporation Strategy for the Development of Adenovirus Serotype 5-Vectored Vaccine Approaches at JoVE.com

Utilizing the Antigen Capsid-Incorporation Strategy for the Development of Adenovirus Serotype 5-Vectored Vaccine Approaches

Qui, vi presentiamo un protocollo per generare una prova di principio di tipo bivalente adenovirus 5 (Ad5) vettore Ad5 / H5-HVR1-Kwas-HVR5-His 6 utilizzando la strategia di Antigen Capside-incorporazione. Questo vettore è stato dimostrato per esporre idoneità qualitativa, la capacità di sfuggire sieri Ad5-positivi in vitro, e l&#39;antigenicità e immunogenicità agli antigeni incorporati.

Utilizzando la strategia di Antigen Capside-Incorporation per lo sviluppo di approcci Adenovirus sierotipo 5 Vectored vaccino

Adenovirus serotype 5 (Ad5) has been extensively modified with traditional transgene methods for the vaccine development. The reduced efficacies of these ...

utilizing-antigen-capsid-incorporation-strategy-for-development

Research

JoVE Journal

Immunology and Infection

10.3K Views.  University of Alabama at Birmingham.  Qui, vi presentiamo un protocollo per generare una prova di principio di tipo bivalente adenovirus 5 (Ad5) vettore Ad5 / H5-HVR1-Kwas-HVR5-His 6 utilizzando la strategia di Antigen Capside-incorporazione. Questo vettore è stato dimostrato per esporre idoneità qualitativa, la capacità di sfuggire sieri Ad5-positivi in vitro, e l'antigenicità e immunogenicità agli antigeni incorporati. 

Video: Utilizing the Antigen Capsid-Incorporation Strategy for the Development of Adenovirus Serotype 5-Vectored Vaccine Approaches

Efficient Recombinant Parvovirus Production with the Help of Adenovirus-derived Systems

Rodent parvoviruses (PV) such as rat H-1PV and MVM, are small icosahedral, single stranded, DNA viruses. Their genome includes two promoters P4 and P38 which regulate the expression of non-structural (NS1 and NS2) and capsid proteins (VP1 and VP2) respectively1. They attract high interest as anticancer agents for their oncolytic and oncosuppressive abilities while being non-pathogenic for humans2. NS1 is the major effector of viral cytotoxicity3. In order to further enhance their natural antineoplastic activities, derivatives from these vectors have been generated by replacing the gene encoding for the capsid proteins with a therapeutic transgene (e.g. a cytotoxic polypeptide, cytokine, chemokine, tumour suppressor gene etc.)4. The recombinant parvoviruses (recPVs) vector retains the NS1/2 coding sequences and the PV genome telomeres which are necessary for viral DNA amplification and packaging. Production of recPVs occurs only in the producer cells (generally HEK293T), by co-transfecting the cells with a second vector (pCMV-VP) expressing the gene encoding for the VP proteins (Fig. 1)4. The recPV vectors generated in this way are replication defective. Although recPVs proved to possess enhanced oncotoxic activities with respect to the parental viruses from which they have been generated, their production remains a major challenge and strongly hampers the use of these agents in anti-cancer clinical applications.
We found that introduction of an Ad-5 derived vector containing the E2a, E4(orf6) and the VA RNA genes (e.g. pXX6 plasmid) into HEK293T improved the production of recPVs by more than 10 fold in comparison to other protocols in use. Based on this finding, we have constructed a novel Ad-VP-helper that contains the genomic adenoviral elements necessary to enhance recPVs production as well as the parvovirus VP gene unit5. The use of Ad-VP-helper, allows production of rec-PVs using a protocol that relies entirely on viral infection steps (as opposed to plasmid transfection), making possible the use of cell lines that are difficult to transfect (e.g. NB324K) (Fig. 2). We present a method that greatly improves the amount of recombinant virus produced, reducing both the production time and costs, without affecting the quality of the final product5. In addition, large scale production of recPV (in suspension cells and bioreactors) is now conceivable.

Here we describe a protocol based only on cell infection, which improves the efficiency of recombinant parvovirus production by more than 100 fold in comparison to other protocols in use. This protocol relies on the use of a novel adenovirus 5-based helper containing the parvovirus VP transcription unit (Ad-VP).

Efficienti di produzione Parvovirus ricombinante con l&#39;aiuto delle Adenovirus sistemi derivati

Rodent parvoviruses (PV) such as rat H-1PV and MVM, are small icosahedral, single stranded, DNA viruses. Their genome includes two promoters P4 and P38 ...

Ricerca

Immunologia e infezioni

Generation of Recombinant Arenavirus for Vaccine Development in FDA-Approved Vero Cells

The development and implementation of arenavirus reverse genetics represents a significant breakthrough in the arenavirus field 4. The use of cell-based arenavirus minigenome systems together with the ability to generate recombinant infectious arenaviruses with predetermined mutations in their genomes has facilitated the investigation of the contribution of viral determinants to the different steps of the arenavirus life cycle, as well as virus-host interactions and mechanisms of arenavirus pathogenesis 1, 3, 11 . In addition, the development of trisegmented arenaviruses has permitted the use of the arenavirus genome to express additional foreign genes of interest, thus opening the possibility of arenavirus-based vaccine vector applications 5 . Likewise, the development of single-cycle infectious arenaviruses capable of expressing reporter genes provides a new experimental tool to improve the safety of research involving highly pathogenic human arenaviruses 16 . The generation of recombinant arenaviruses using plasmid-based reverse genetics techniques has so far relied on the use of rodent cell lines 7,19 , which poses some barriers for the development of Food and Drug Administration (FDA)-licensed vaccine or vaccine vectors. To overcome this obstacle, we describe here the efficient generation of recombinant arenaviruses in FDA-approved Vero cells.

Rescue of recombinant arenaviruses from cloned cDNAs, an approach referred to as reverse genetics, allows researchers to investigate the role of specific viral gene products, as well as the contribution of their different specific domains and residues, to many different aspects of the biology of arenavirus. Likewise, reverse genetics techniques in FDA-approved cell lines (Vero) for vaccine development provides novel possibilities for the generation of effective and safe vaccines to combat human pathogenic arenaviruses.

Generazione di Arenavirus ricombinante per lo sviluppo del vaccino nel approvati dalla FDA cellule Vero

The development and implementation of arenavirus reverse genetics represents a significant breakthrough in the arenavirus field  4. The use of cell-based ...

Using Click Chemistry to Measure the Effect of Viral Infection on Host-Cell RNA Synthesis

Many RNA viruses have evolved the ability to inhibit host cell transcription as a means to circumvent cellular defenses. For the study of these viruses, it is therefore important to have a quick and reliable way of measuring transcriptional activity in infected cells. Traditionally, transcription has been measured either by incorporation of radioactive nucleosides such as 3H-uridine followed by detection via autoradiography or scintillation counting, or incorporation of halogenated uridine analogs such as 5-bromouridine (BrU) followed by detection via immunostaining. The use of radioactive isotopes, however, requires specialized equipment and is not feasible in a number of laboratory settings, while the detection of BrU can be cumbersome and may suffer from low sensitivity.
The recently developed click chemistry, which involves a copper-catalyzed triazole formation from an azide and an alkyne, now provides a rapid and highly sensitive alternative to these two methods. Click chemistry is a two step process in which nascent RNA is first labeled by incorporation of the uridine analog 5-ethynyluridine (EU), followed by detection of the label with a fluorescent azide. These azides are available as several different fluorophores, allowing for a wide range of options for visualization.
This protocol describes a method to measure transcriptional suppression in cells infected with the Rift Valley fever virus (RVFV) strain MP-12 using click chemistry. Concurrently, expression of viral proteins in these cells is determined by classical intracellular immunostaining. Steps 1 through 4 detail a method to visualize transcriptional suppression via fluorescence microscopy, while steps 5 through 8 detail a method to quantify transcriptional suppression via flow cytometry. This protocol is easily adaptable for use with other viruses.

This method describes the use of click chemistry to measure changes in host cell transcription after infection with the Rift Valley fever virus (RVFV) strain MP-12. Results can be visualized qualitatively via fluorescence microscopy or obtained quantitatively through flow cytometry. This method is adaptable for use with other viruses.

Utilizzando Clicca Chimica per misurare l&#39;effetto dell&#39;infezione virale sulla cellula ospite RNA Sintesi

Many RNA viruses have evolved the ability to inhibit host cell transcription as a means to circumvent cellular defenses. For the study of these viruses, ...

In Vitro Analysis of Myd88-mediated Cellular Immune Response to West Nile Virus Mutant Strain Infection

An attenuated West Nile virus (WNV), a nonstructural (NS) 4B-P38G mutant, induced higher innate cytokine and T cell responses than the wild-type WNV in mice. Recently, myeloid differentiation factor 88 (MyD88) signaling was shown to be important for initial T cell priming and memory T cell development during WNV NS4B-P38G mutant infection. In this study, two flow cytometry-based methods &#8211; an in vitro T cell priming assay and an intracellular cytokine staining (ICS) &#8211; were utilized to assess dendritic cells (DCs) and T cell functions. In the T cell priming assay, cell proliferation was analyzed by flow cytometry following co-culture of DCs from both groups of mice with carboxyfluorescein succinimidyl ester (CFSE) - labeled CD4+ T cells of OTII transgenic mice. This approach provided an accurate determination of the percentage of proliferating CD4+ T cells with significantly improved overall sensitivity than the traditional assays with radioactive reagents. A microcentrifuge tube system was used in both cell culture and cytokine staining procedures of the ICS protocol. Compared to the traditional tissue culture plate-based system, this modified procedure was easier to perform at biosafety level (BL) 3 facilities. Moreover, WNV- infected cells were treated with paraformaldehyde in both assays, which enabled further analysis outside BL3 facilities. Overall, these in vitro immunological assays can be used to efficiently assess cell-mediated immune responses during WNV infection.

In Vitro Analysis of Myd88-mediated Cellular Immune Response to West Nile Virus Mutant Strain Infection

Two flow cytometry-based methods &#8211; an in vitro T cell priming assay and intracellular cytokine staining were utilized to measure antigen presenting capacity of dendritic cells and antigen-specific T cell responses to a West Nile virus mutant infection in mice.

In Analisi Vitro di Myd88 mediata Cellular Immune Response to West Nile virus mutante Strain Infezione

An attenuated West Nile virus (WNV), a nonstructural (NS) 4B-P38G mutant, induced higher innate cytokine and T cell responses than the wild-type WNV in ...

Detection of Human Leukocyte Antigen Biomarkers in Breast Cancer Utilizing Label-free Biosensor Technology

According to the American Cancer Society, more than 200,000 women will be diagnosed with invasive breast cancer each year and approximately 40,000 will die from the disease. The human leukocyte antigen (HLA) class I samples peptides derived from proteasomal degradation of cellular proteins and presents these fragments on the cell surface for interrogation by circulating cytotoxic T lymphocytes (CTL). Generation of T-cell receptor mimic (TCRm) monoclonal antibodies (mAbs) which recognize breast cancer specific peptide/HLA-A*02:01 complexes such as those derived from macrophage migration inhibitory factor (MIF19-27) and NY-ESO-1157-165 enable detection and destruction of breast cancer cells in the absence of an effective anti-tumor CTL response. Intact class I HLA/peptide complexes are shed by breast cancer cells and represent potentially relevant cancer biomarkers. In this work, a breakthrough biomarker screening system for cancer diagnostics incorporating T-cell receptor mimic monoclonal antibodies combined with a novel, label-free biosensor utilizing guided-mode resonance (GMR) sensor technology is presented. Detection of shed MIF/HLA-A*02:01 complexes in MDA-MB-231 cell supernatants, spiked human serum, and patient plasma is demonstrated. The impact of this work could revolutionize personalized medicine through development of companion disease diagnostics for targeted immunotherapies.

Intact class I HLA/peptide complexes are shed by cancer cells, representing a potential relevant cancer biomarker. Utilizing label-free sensor technology and T-cell receptor mimicking monoclonal antibodies, detection of shed MIF/HLA-A*02:01 complexes in MDA-MB-231 cell supernatants, spiked human serum, and patient plasma is demonstrated, enabling development of a novel cancer diagnostic platform.

Rilevamento dei leucociti umani Antigen Biomarkers in Breast Cancer Utilizzando libero-Label Biosensor Tecnologia

According to the American Cancer Society, more than 200,000 women will be diagnosed with invasive breast cancer each year and approximately 40,000 will ...

Development of an in vitro model system for studying the interaction of Equus caballus IgE with its high-affinity receptor Fc&#949;RI

The interaction of IgE with its high-affinity Fc receptor (Fc&#949;RI) followed by an antigenic challenge is the principal pathway in IgE mediated allergic reactions. As a consequence of the high affinity binding between IgE and Fc&#949;RI, along with the continuous production of IgE by B cells, allergies usually persist throughout life, with currently no permanent cure available. Horses, especially race horses, which are commonly inbred, are a species of mammals that are very prone to the development of hypersensitivity responses, which can seriously affect their performance. Physiological responses to allergic sensitization in horses mirror that observed in humans and dogs. In this paper we describe the development of an in situ assay system for the quantitative assessment of the release of mediators of the allergic response pertaining to the equine system. To this end, the gene encoding equine Fc&#949;RI&#945; was transfected into and expressed onto the surface of parental Rat Basophil Leukemia (RBL-2H3.1) cells. The gene product of the transfected equine &#945;-chain formed a functional receptor complex with the endogenous rat &#946;- and &#947;-chains 1. The resultant assay system facilitated an assessment of the quantity of mediator secreted from equine Fc&#949;RI&#945; transfected RBL-2H3.1 cells following sensitization with equine IgE and antigenic challenge using &#946;-hexosaminidase release as a readout 2, 3. Mediator release peaked at 36.68% &#177; 4.88% at 100 ng ml-1 of antigen. This assay was modified from previous assays used to study human and canine allergic responses 4, 5. We have also shown that this type of assay system has multiple applications for the development of diagnostic tools and the safety assessment of potential therapeutic intervention strategies in allergic disease 6, 2, 3.

Development of an &lt;em&gt;in vitro&lt;/em&gt; model system for studying the interaction of &lt;em&gt;Equus&lt;/em&gt; &lt;em&gt;caballus&lt;/em&gt; IgE with its high-affinity receptor Fc&amp;#949;RI

The current study describes the development and applications of a genetically engineered assay system based on the transfection of rat basophilic leukemia cells with the equine Fc&#949;RI&#945; gene. Transfected cells express a functional receptor where the release of mediators of the allergic response can be activated by IgE and antigen.

Sviluppo di un<em&gt; In vitro</em&gt; Sistema modello per studiare l&#39;interazione tra<em&gt; Equus</em&gt;<em&gt; Caballus</em&gt; IgE con il suo recettore ad alta affinità FcεRI

The interaction of IgE with its high-affinity Fc receptor (Fc&#949;RI) followed by an antigenic challenge is the principal pathway in IgE mediated ...

Imaging CD4 T Cell Interstitial Migration in the Inflamed Dermis

The ability of CD4 T cells to carry out effector functions is dependent upon the rapid and efficient migration of these cells in inflamed peripheral tissues through an as-yet undefined mechanism. The application of multiphoton microscopy to the study of the immune system provides a tool to measure the dynamics of immune responses within intact tissues. Here we present a protocol for non-invasive intravital multiphoton imaging of CD4 T cells in the inflamed mouse ear dermis. Use of a custom imaging platform and a venous catheter allows for the visualization of CD4 T cell dynamics in the dermal interstitium, with the ability to interrogate these cells in real-time via the addition of blocking antibodies to key molecular components involved in motility. This system provides advantages over both in vitro models and surgically invasive imaging procedures. Understanding the pathways used by CD4 T cells for motility may ultimately provide insight into the basic function of CD4 T cells as well as the pathogenesis of both autoimmune diseases and pathology from chronic infections.

The mechanisms that govern the interstitial motility of CD4 effector T cells at sites of inflammation are relatively unknown. We present a non-invasive approach to visualize and manipulate in vitro-primed CD4 T cells in the inflamed ear dermis, allowing for study of the dynamic behavior of these cells in situ.

Imaging CD4 T cellule interstiziali migrazione nel derma infiammate

The ability of CD4 T cells to carry out effector functions is dependent upon the rapid and efficient migration of these cells in inflamed peripheral ...

Development of Stem Cell-derived Antigen-specific Regulatory T Cells Against Autoimmunity

Autoimmune diseases arise due to the loss of immunological self-tolerance. Regulatory T cells (Tregs) are important mediators of immunologic self-tolerance. Tregs represent about 5 - 10% of the mature CD4+ T cell subpopulation in mice and humans, with about 1 - 2% of those Tregs circulating in the peripheral blood. Induced pluripotent stem cells (iPSCs) can be differentiated into functional Tregs, which have a potential to be used for cell-based therapies of autoimmune diseases. Here, we present a method to develop antigen (Ag)-specific Tregs from iPSCs (i.e., iPSC-Tregs). The method is based on incorporating the transcription factor FoxP3 and an Ag-specific T cell receptor (TCR) into iPSCs and then differentiating on OP9 stromal cells expressing Notch ligands delta-like (DL) 1 and DL4. Following in vitro differentiation, the iPSC-Tregs express CD4, CD8, CD3, CD25, FoxP3, and Ag-specific TCR and are able to respond to Ag stimulation. This method has been successfully applied to cell-based therapy of autoimmune arthritis in a murine model. Adoptive transfer of these Ag-specific iPSC-Tregs into Ag-induced arthritis (AIA)-bearing mice has the ability to reduce joint inflammation and swelling and to prevent bone loss.

We present here a method to develop functional antigen (Ag)-specific regulatory T cells (Tregs) from induced pluripotent stem cells (iPSCs) for immunotherapy of autoimmune arthritis in a murine model.

Lo sviluppo di cellule staminali derivate antigene-specifiche cellule T regolatorie contro autoimmunità

Autoimmune diseases arise due to the loss of immunological self-tolerance. Regulatory T cells (Tregs) are important mediators of immunologic ...

Evaluation of Host-Pathogen Responses and Vaccine Efficacy in Mice

Vaccines are a 20th century medical marvel. They have dramatically reduced the morbidity and mortality caused by infectious diseases and contributed to a striking increase in life expectancy around the globe. Nonetheless, determining vaccine efficacy remains a challenge. Emerging evidence suggests that the current acellular vaccine (aPV) for Bordetella pertussis (B. pertussis) induces suboptimal immunity. Therefore, a major challenge is designing a next-generation vaccine that induces protective immunity without the adverse side effects of a whole-cell vaccine (wPV). Here we describe a protocol that we used to test the efficacy of a promising, novel adjuvant that skews immune responses to a protective Th1/Th17 phenotype and promotes a better clearance of a B. pertussis challenge from the murine respiratory tract. This article describes the protocol for mouse immunization, bacterial inoculation, tissue harvesting, and analysis of immune responses. Using this method, within our model, we have successfully elucidated crucial mechanisms elicited by a promising, next-generation acellular pertussis vaccine. This method can be applied to any infectious disease model in order to determine vaccine efficacy.

Here we present an elegant protocol for in vivo evaluation of vaccine effectiveness and host immune responses. This protocol can be adapted for vaccine models that study viral, bacterial, or parasitic pathogens.

Valutazione delle risposte ospite-patogeno e l'efficacia del vaccino nei topi

Vaccines are a 20th century medical marvel. They have dramatically reduced the morbidity and mortality caused by infectious diseases and contributed to a ...

Use of an Influenza Antigen Microarray to Measure the Breadth of Serum Antibodies Across Virus Subtypes

The influenza virus remains a significant cause of mortality worldwide due to the limited effectiveness of currently available vaccines. A key challenge to the development of universal influenza vaccines is high antigenic diversity resulting from antigenic drift. Overcoming this challenge requires novel research tools to measure the breadth of serum antibodies directed against many virus strains across different antigenic subtypes. Here, we present a protocol for analyzing the breadth of serum antibodies against diverse influenza virus strains using a protein microarray of influenza antigens.
This influenza antigen microarray is constructed by printing purified hemagglutinin and neuraminidase antigens onto a nitrocellulose-coated membrane using a microarray printer. Human sera are incubated on the microarray to bind antibodies against the influenza antigens. Quantum-dot-conjugated secondary antibodies are used to simultaneously detect IgG and IgA antibodies binding to each antigen on the microarray. Quantitative antibody binding is measured as fluorescence intensity using a portable imager. Representative results are shown to demonstrate assay reproducibility in measuring subtype-specific and cross-reactive influenza antibodies in human sera.
Compared to traditional methods such as ELISA, the influenza antigen microarray provides a high throughput multiplexed approach capable of testing hundreds of sera for multiple antibody isotypes against hundreds of antigens in a short time frame, and thus has applications in sero-surveillance and vaccine development. A limitation is the inability to distinguish binding antibodies from neutralizing antibodies.

We present a protocol for using a protein microarray constructed by printing influenza antigens onto nitrocellulose-coated slides to simultaneously probe serum for multiple antibody isotypes against over 250 antigens from different virus strains, thus allowing measurement of the breadth of serum antibodies across virus subtypes.

Uso di un microarray antigeno influenzale per misurare l'ampiezza degli anticorpi del siero attraverso i sottotipi di virus

The influenza virus remains a significant cause of mortality worldwide due to the limited effectiveness of currently available vaccines. A key challenge ...