Sağlık 5T32AI7493-20 ve 5R01AI089337-03 hibe Bu eser Ulusal Sağlık Enstitüleri tarafından kısmen desteklenmiştir. fon çalışma tasarımı, veri toplama ve analizi, yayınlama kararı, ya da yazının hazırlanmasında hiçbir rolü yoktu.

Onaylı protokol numarası 101109272 altında burada tarif edildiği gibi Birmingham Kurumsal Hayvan Kullanımı ve Bakımı Komitesi University of Alabama farelerin kullanımını onayladı. 1. Genetik Construction Modifiye Plazmid pAd5 / H5-HVR1-Kwas-HVR5-His 6 Antijen Kapsid-Ortaklık Stratejisi <ol><li> Mekik plazmid inşaatı HVR1-Kwas-HVR5-His 6 / pH5S <ol><li> Hexon5 geninin Accl için sınırlama enzimi noktalan Agel ile sentezlenen DNA dizisi, HVR1-Kwas ihtiva eden bir plasmid sipariş. </li><li> 37 ° C&#39;de 3 saat enzimler Agel (6 adet) ve Accl (6 adet) sentezlenen parçası (HVR1-Kwas) 6 ug Digest. Elektroforez ile% 2 agaroz jeli içinde dijeste fragmanının gidermek ve üreticinin protokolüne uygun olarak bir DNA jel özütleme kiti ile fragmanı arındırmak. </li><li> Ekin molar oranına göre 3 vektör: 1, T4 DNA ligazı ve ligaz b kullanımıUffer önceden yapılmış mekik plazmidinin 100 ng fragmanı (HVR1-Kwas) 12 ng bağlanması için HVR5-His 6 / pH5S 2 st için oda sıcaklığında bir 10 ul hacim içinde 17, Agel ve Accl siteleri ile. </li><li> (1800 V) bir elektro-içinde elektro DH5α hücreleri 50 ul ligasyon ürünün 10 ul: 1 ul dönüşümü. Dönüştürülmüş DH5α hücrelerine SOC ortamı 950 ul ilave edin ve 300 rpm, 37 ° C&#39;de 1 saat süreyle inkübe karışımı. Kanamisin içeren Luria-Bertani (LB) agar üzerinde 1 mi karışımının 100-200 ul yayıldı ve 37 ° C &#39;de O / N inkübe edin. <ol><li> ~ Fragmanı HVR1-Kwas hedefleme PCR ile 10 koloniler taranması için, ileri primer (TATGTGTGTCATGTATGCGT) karışımı (üreticinin protokolüne göre) bir PCR master karışım çözeltisi içine primer (GGAGGCCCACTTGTCCAGCTC) ve tek bir koloni DH5α tersine çevirir. PCR master mix çözümü ile sağlanan kılavuza bakarak bir termalcycler örnekleri çalıştırın. </li><li> Bölüm 1.1.4.1 gösterildi klonlarda fragmanı HVR1-Kwas sıralamak için ileri primer (TATGTGTGTCATGTATGCGT) kullanın. </li></ol></li></ol></li><li> Plazmid pAd5 / İnşaat H5-HVR1-Kwas-HVR5-His 6 <ol><li> Özet 6 ug HVR1-Kwas-HVR5-His 6/37 ° C &#39;de 3 saat süre ile enzimleri EcoRI (6 adet) ve Pmel (6 adet) ile pH5S ve homolog rekombinasyon kolları ve çift modifiye hexon5 geni ihtiva eden fragmanı saflaştırılması, olarak adım 1.1.2 belirtti. Omurga plazmid SwaI ile pAd5 / ΔH5 (GL) 16 Linearize. </li><li> Servisi plazmidden hedef fragmanın 100 ng ve (1800 V) bir elektro-homolog rekombinasyon için elektro BJ5183 hücreleri 50 ul halinde doğrusallaştırılmış pAd5 / ΔH5 (GL) omurgası 100 ng Co-dönüşümü. Dönüştürülmüş hücreler SOC ortamında 950 ul ilave edin ve 37 ° C, 300 rpm&#39;de 1 saat süreyle inkübe karışımı. 1 ml karışımı 200 ul - 100 Yayılı37 ° C &#39;de O / N inkübasyon için kanamisin (son 50 ug / ml) ihtiva eden LB agar üzerine. <ol><li> Al ~ 3 ml 10 küçük koloniler, bir çalkalayıcı (250 rpm, 37 ° C) O / N inkübasyon için kanamisin (son 50 ug / ml) ihtiva eden sıvı LB. Kültürden plazmidler ekstrakte edin. Aşama 1.1.4.1 &#39;de gösterildiği gibi, bu parçanın HVR1-Kwas hedefleyerek 10 koloniler taranması için PCR analizi kullanın. </li><li> Omurga genomunun pIX fragmanının hedef PCR analizi, aynı koloniler taranması için, ileri primer (AGCTGTTGGATCTGCGCCAGCAGGTT) karışımı, (imalatçının protokolüne göre) bir PCR master karışım çözeltisi içine primer (CCAAACAGAGTCTGGTTTTTTATTTAT) ve tek bir koloni BJ5183 tersine çevirir. PCR master mix çözümü ile sağlanan kılavuza bakarak bir termalcycler örnekleri çalıştırın. </li><li> PAd5 / H5-HVR1-Kwas-HVR5-His 6 PCR çift pozitif koloniler atayın. </li></ol></li><li> Plazmidden pAd5 / H5-HVR1-Kwas-HVR5-His 6 100 ng TransformAşama 1.1.4 &#39;de gösterildiği gibi hücre DH5α için. <ol><li> Aşama 1.1.4.1 &#39;de gösterildiği gibi, parça HVR1-Kwas hedefleyerek ~ 10 koloniler taranması için PCR analizi kullanın. </li><li> Aşama 1.2.2.2 &#39;de gösterildiği gibi, omurga genomunun pIX fragmanının hedef aynı koloniler taranması için PCR analizi kullanın. </li><li> PAd5 / H5-HVR1-Kwas-HVR5-His 6 Parçanın HVR1-Kwas sıralamak için ileri primer (TATGTGTGTCATGTATGCGT) kullanın. </li></ol></li></ol></li></ol> Modifiye Ad5 Viral vektör Ad5 / 2. Hazırlık H5-HVR1-Kwas-HVR5-His 6 <ol><li> Yüksek glukoz DMEM içine FBS (son% 10), 100X Esansiyel Olmayan Amino Asitler (nihai 0.1 mM), 200 mM L-glutamin (son 2 mM), penisilin / streptomisin solüsyonu (son% 1) ilave edilerek tam orta Teşkil . (% 85 nemli koşullar altında 37 ° C ve% 5 CO2), bir kültür inkübatörü içinde tam bir ortam içinde, insan embriyonik böbrek (HEK293) hücreler koruyun. </li><li> Viral ziyaretinde Kurtarmactor Ad5 / H5-HVR1-Kwas-HVR5-His 6 <ol><li> Tam ortam ve kültür O / N 5 ml ihtiva eden bir T-25 balon içinde Tohum HEK293 hücrelerine 3.0 x 10 6% 80 birleştiği bir tek tabaka elde etmek. </li><li> 15 ug Linearize pAd5 / H5-HVR1-Kwas-HVR5-His 6 3 saat süreyle 37 ° C&#39;de sınırlama enzimi Pacl (15 birim) ile 100 ul hacim içinde. <ol><li> Özü doğrusallaştırılmış pAd5 / H5-HVR1-Kwas-HVR5-His 6 fenol eşit hacimde (1 dakika süre ile 10,000 x g) iki kez reaksiyona santrifüjle: kloroform: bir davlumbaz izoamil alkol (: 24: 1 25 ° oranında) ve karışık bir çözelti (% 100 etanol içinde 300 ul sodyum asetat 10 ul) ve% 70 etanol içinde 700 | il ardışık santrifüjleme (10 dakika süre ile 10,000 x g). Her santrifüj adımında süpernatant atın. </li></ol></li><li> Saflaştırılmış plazmid damıtılmış su veya Tris-EDTA (TE) tampon maddesi 40 ul yeniden süspanse edin. Optik DE ölçülmesiyle plazmid DNA Miktarınınnsity 260 nm&#39;de (OD). </li><li> Üreticinin kılavuzuna göre, T-25 balonuna ticari lipozomal transfeksiyon reaktifi ile doğrusallaştırılmış plazmidin 3 ug transfekte. 6 saat kültürü inkübatör post-transfeksiyon ve daha sonraki kuluçka de tam orta transfeksiyon ortamı değiştirin. Bireysel viral plaklar oluşana kadar, her iki veya üç gün tam orta yerine transfekte hücreleri koruyun. </li><li> Plaklar, tam bir sitopatik etki (CPE) geliştirmek zaman, steril bir muhafaza içinde bir şişe üzerinde kalan hücreler kazıma ve 4 ° C&#39;de 10 dakika boyunca 300 x g&#39;de santrifüj ile hasat orta hücre lizatı. % 2 FBS içeren ortama ~ 1 ml hücre pelletini Askıda ve donma-çözülme dört kat hücreleri bölünürler. 4 ° C&#39;de 10 dakika boyunca 10,000 x g&#39;de santrifüje tabi tutulmasımn ardından lizat kurtarılan virüs içeren süpernatan toplamak. </li></ol></li><li> Viral vektör Ad5 / H5-HVR1-Kwas-HVR5-His 6 Büyük ölçekli yayılım <ol><li> Th yaymakT-25 balonuna tam lizat 1/3 ile enfekte steril bir muhafaza içinde HEK293 hücreleri ihtiva eden bir T-75 balon içinde E virüsü. Tam CPE kültürü inkübatör 2-3 gün içinde geliştirmeye olanak sağlar. Adım 2.2.5 belirtildiği gibi lizat süpernatant hasat. </li><li> Virüs yayılma koşullarına bağlı olarak, T-75 balonuna tam lizat 1/2 ile enfekte steril bir muhafaza içinde 1-3, T-175 şişelerinde virüsü yayar. Tam CPE kültürü inkübatör 2-3 gün içinde geliştirmeye olanak sağlar. Adım 2.2.5 belirtildiği gibi lizat süpernatant hasat. </li><li> Önceki T-175 şişesi (lar) tam lizat 1/2 ile enfekte steril bir muhafaza içinde bir düzine veya daha fazla T-175 şişelerinde virüsü yayar. Virüs çoğaltma koşulları ve ihtiyacı olan virüs miktarı göre bir şişe, kullanım miktarını belirler. Tam CPE kültürü inkübatör 2-3 gün içinde meydana geldiğinde adım 2.2.5 belirtildiği gibi lizat süpernatant hasat. </li></ol></li><li> Purifsezyum klorür Ad5 / H5-HVR1-Kwas-HVR5-His 6 ication <ol><li> 5 mM HEPES, CsCl çözümleri iki yoğunlukları hazırlayın: 1.33 mi g / ve 1.45 g / ml CsCl ile temas gelmesini de önler. </li><li> CsCl yük 4 mi steril bir ultra santrifüj tüpüne (1.33 g / ml) ve hafifçe tüpün dibine CsCl 4 ml (ug / ml 1.45) yükleyin. Yük yavaş yavaş steril kaput geçişlerini üstüne lizat süpernatant 4 ml. </li><li> Kusurlu / yüksek virüs banttan olgun / alt virüs bandı ayırmak için 4 ° C&#39;de 3 saat boyunca 110.000 xg&#39;de tüp santrifüj. Bir 33 G iğne ile donanmış bir 3 ml&#39;lik bir şırınga kullanılarak alt bant toplayın ve steril bir muhafaza içinde 4 ml hacim içinde 5 mM HEPES ile bant seyreltin. </li><li> Aşama 2.4.2 de tarif edildiği gibi, iki CsCl çözeltilerinin yoğunlukları ve virüsün seyreltildi bant ile bir tüp yerleştirin. 4 ° C&#39;de 110,000 x g, O / N tüpü santrifüjleyin. Aşama 2.4.3 tarif edildiği gibi viral bant toplayın. </li><li> Bir dialys toplanan virüs çözümü enjekteSteril kaput içinde 33 G iğne ile silahlı 3 ml şırınga ile kaset olduğunu. </li><li> 1x diyaliz tamponu 700 ml kaseti yerleştirin (1 L tarifi: 10x PBS 100 mi,% 100 gliserol, 100 ml damıtılmış su, 800 mi, 0.22 um&#39;lik bir filtreden filtre tamponu) ve diyaliz tamponu yerine her 3 4 kez saat. Iğneli şırınga ile diyaliz virüs çözümü dışarı aspire. </li></ol></li></ol> Kurtarılan Viral Vector 3. Doğrulama <ol><li> Viral vektör Titrasyonları <ol><li> 10 ve 1: Virüs Fiziksel titresi için, virüs ve 1 diyaliz tamponu (arka plan kontrolü) hem seyreltilmiş virüs liziz tamponu içinde 20 (% 10 SDS Tris-EDTA), küçük tüplere ve 56 ° C &#39;de tüm tüpler inkübe 10 dk. </li><li> Bir biophotometer açın ve OD 260 nm&#39;de absorbans modunu ayarlayın. &quot;Boş&quot; altını tıklayarak arka plan sinyalini dengelemek için: seyreltilmiş diyaliz tamponu (10 1) kullanın. Biophotometer scr yazın &quot;10 + 90&quot;een ve seyreltilmiş virüsün sinyali (: 10 1) okuyun. </li><li> Adım 3.1.2 yöntemi takip ederek, ancak bunun yerine biophotometer ekranında &quot;5 + 95&quot; tür: seyreltilmiş virüs sinyali (20 1) okuyun. 1.1x10 12 iki virüs okuma numaraları çarpın ve iki dilüsyonları iki ayrı titreleri göre VP / ml gibi bir birim olup ortalama titresi hesaplanır. </li><li> Virüs bulaşıcı titresi (IP / ml) için, 10 gün sonrası enfeksiyon HEK293 hücreleri üzerinde enfeksiyon derinliğini belirlemek için Karber istatistiksel TCID 50 yöntemi 14 kullanın (dpi) </li></ol></li><li> Viral vektör üzerindeki antijenik maruz ekran Değerlendirilmesi <ol><li> Kat bir ELISA plaka viral vektör, ve standart bir ELISA yöntemi 14 adımların geri kalanı ile devam eder. Dahil antijenler 14 karşılık gelen saptanması için insan anti-gp41 (2F5) monoklonal antikoru (mAb) ve fare anti-His etiket mAb kullanın. </li><li> Bir denatu viral vektör gidermekKırmızı protein jel elektroforezi (SDS-PAGE) ve standart bir Western Blot yöntemi 14 adımların geri kalanı ile devam eder. Dahil antijenler 14 karşılık gelen saptanması için insan anti-gp41 (2F5) monoklonal antikoru (mAb) ve fare anti-His etiket mAb kullanın. </li></ol></li><li> Ad5-Positve serumları atlamasına yeteneği vektörün in vitro değerlendirilmesi <ol><li> Kültür inkübatör (37 ° C ve% 5 CO2 altında 85% nemli koşullar) &#39;de tam bir ortam içinde HeLa hücrelerinin koruyun. FBS (son% 10), 200 mM L-glutamin (son 2 mM) ve minimum gerekli ortam (MEME) içerisine penisilin / streptomisin solüsyonu (son% 1) ilave edilerek tam orta oluşturuyor. </li><li> 1x10 6 hücre 6 oyuklu plakalarda Tohum HeLa hücre / kuyu ve 2 saat süre ile kültürü inkübatör (37 ° C ve% 5 CO2 altında 85% nemli koşullar) &#39;de inkübe edin. (Viral vektör 5 IP / hücre ile Ad5-pozitif serumları (0.1 ul veya 0 ul) inkübeAd5, veya Ad5 / H5-HVR1-Kwas-HVR5-His 1 saat boyunca kültürü inkübatöründe 6) hücreleri ihtiva eden 6 oyuklu plakalar üzerine karışımları ilave edilmeden önce. </li><li> 24 saat (HPI) enfeksiyondan de, liziz tamponu içinde 0.5 ml bir kez PBS ile lize hücreleri ile yıkayın. 5 dakika boyunca 15.000 xg&#39;de Santrifüj ve süpernatant toplamak. Virüsler, lusiferaz genini içerir, çünkü lusiferaz sinyali okumak için lusiferaz alt-tabaka 100 ul süpernatan 20 ul karıştırın. </li></ol></li></ol> Kurtarılan Viral Vector 4. İmmünolojik Değerlendirilmesi <ol><li> Ad5 ve Ad5 / H5-HVR1-Kwas-HVR5-His 6: İki aşı grupları hazırlayın. <ol><li> 2 haftalık bir arayla, bir homolog &quot;ana-yükleme&quot; bağışıklama rejiminde, 1x10 10 VP / fare olarak virüsleri ile kas içinden (n = 8 / grup) fareler enjekte edilir. </li><li> 2 hafta her enjeksiyon sonrası anda, hayvan lancets (5 mm uç uzunluğu) ile birlikte kanama yanak tarafından anestezi olmadan farelerin kanama1.5 ml tüpler kan almak. </li></ol></li><li> Aşağı çevrilerek ve boruların kan karıştırın ve 30 dakika için oda sıcaklığında kan inkübe edilir. 5, 4 ° C&#39;de minimum ve yeni bir 1.5 ml&#39;lik tüplere transfer sera (üst katman) için 10,000 x g&#39;de tüpler dönerler. <ol><li> 5, 4 ° C&#39;de dakikada ve transfer sera için 10,000 x g&#39;de yeni tüplere Spin yeni -80 ° C&#39;de depolama için 1.5 ml tüpler işaretlenmiş. </li></ol></li><li> Sera dayalı ELISA ile antijen-spesifik humoral bağışıklık Değerlendirilmesi <ol><li> His peptit (1 mM stok) ve HIV-1 peptit (1 mM stok), ayrı ayrı 100 içinde seyreltilir. </li><li> mM karbonat tamponu (pH 9.5), 10 uM peptit kaplama konsantrasyonu elde etmek için. Coat ayrı 4 ° C&#39;de plakalar O / N oyuk başına 100 ul ilave edilmesi ve kuluçkalama ile seyreltildi peptidlerle ELISA plakaları. </li><li> PBST içinde% 5 BSA içinde 1 saat süre ile 200 / çukur ul ve blok dört kez PBST ile plakalar, yıkama. 1 de plakalarına fareler sera uygulayın: 100 seyreltme engelleme buf içindefer, 100 ul / yuva. Oda sıcaklığında 2 saat inkübasyondan süreyle inkübe edin. </li><li> Dört kez PBST ile plakalar, yıkama. / Oyuk 100 ul bloke edici tampon içinde, 30 dakika boyunca oda sıcaklığında inkübe edilerek plakalar bloke eder. </li><li> 100 ul / oyuk bireysel His peptid ve HIV-1 peptit ile kaplanmış plakalar hem: (bloke tampon maddesi içinde 5.000 1) keçi anti-fare IgG-HRP uygulanır. Oda sıcaklığında 2 saat süreyle inkübe edin. PBST ile plakalar, yıkama. </li><li> 30 dakika boyunca HRP alt-tabaka ile inkübe edildikten sonra OD450 nm plakaları okuyun. </li></ol></li></ol>

<ol>
	<li>Cheng, S. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Coexpression+of+the+simian+immunodeficiency+virus+Env+and+Rev+proteins+by+a+recombinant+human+adenovirus+host+range+mutant.">Coexpression of the simian immunodeficiency virus Env and Rev proteins by a recombinant human adenovirus host range mutant.</a> Journal of virology. 66, 6721-6727 (1992).</li><li>Matthews, Q. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=HIV+antigen+incorporation+within+adenovirus+hexon+hypervariable+2+for+a+novel+HIV+vaccine+approach.">HIV antigen incorporation within adenovirus hexon hypervariable 2 for a novel HIV vaccine approach.</a> PloS one. 5, e11815 (2010).</li><li>DeMatteo, R. P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Long-lasting+adenovirus+transgene+expression+in+mice+through+neonatal+intrathymic+tolerance+induction+without+the+use+of+immunosuppression.">Long-lasting adenovirus transgene expression in mice through neonatal intrathymic tolerance induction without the use of immunosuppression.</a> Journal of virology. 71, 5330-5335 (1997).</li><li>Gu, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+recombinant+adenovirus-based+vector+elicits+a+specific+humoral+immune+response+against+the+V3+loop+of+HIV-1+gp120+in+mice+through+the+'Antigen+Capsid-Incorporation'+strategy.">A recombinant adenovirus-based vector elicits a specific humoral immune response against the V3 loop of HIV-1 gp120 in mice through the 'Antigen Capsid-Incorporation' strategy.</a> Virology journal. 11, 112 (2014).</li><li>Matthews, Q. L., Krendelchtchikov, A. L. G., Li, Z. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Viral+Vectors+for+Vaccine+Development.">Viral Vectors for Vaccine Development.</a> INTECH. , (2013).</li><li>Tang, D. C., Zhang, J., Toro, H., Shi, Z., Van Kampen, K. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Adenovirus+as+a+carrier+for+the+development+of+influenza+virus-free+avian+influenza+vaccines.">Adenovirus as a carrier for the development of influenza virus-free avian influenza vaccines.</a> Expert review of vaccines. 8, 469-481 (2009).</li><li>Flatt, J. W., Kim, R., Smith, J. G., Nemerow, G. R., Stewart, P. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+intrinsically+disordered+region+of+the+adenovirus+capsid+is+implicated+in+neutralization+by+human+alpha+defensin+5.">An intrinsically disordered region of the adenovirus capsid is implicated in neutralization by human alpha defensin 5.</a> PloS one. 8, e61571 (2013).</li><li>Bradley, R. R., Lynch, D. M., Iampietro, M. J., Borducchi, E. N., Barouch, D. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Adenovirus+serotype+5+neutralizing+antibodies+target+both+hexon+and+fiber+following+vaccination+and+natural+infection.">Adenovirus serotype 5 neutralizing antibodies target both hexon and fiber following vaccination and natural infection.</a> Journal of virology. 86, 625-629 (2012).</li><li>Zaiss, A. K., Machado, H. B., Herschman, H. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+influence+of+innate+and+pre-existing+immunity+on+adenovirus+therapy.">The influence of innate and pre-existing immunity on adenovirus therapy.</a> Journal of cellular biochemistry. 108, 778-790 (2009).</li><li>Sumida, S. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Neutralizing+antibodies+and+CD8++T+lymphocytes+both+contribute+to+immunity+to+adenovirus+serotype+5+vaccine+vectors.">Neutralizing antibodies and CD8+ T lymphocytes both contribute to immunity to adenovirus serotype 5 vaccine vectors.</a> Journal of virology. 78, 2666-2673 (2004).</li><li>Sumida, S. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Neutralizing+antibodies+to+adenovirus+serotype+5+vaccine+vectors+are+directed+primarily+against+the+adenovirus+hexon+protein.">Neutralizing antibodies to adenovirus serotype 5 vaccine vectors are directed primarily against the adenovirus hexon protein.</a> Journal of immunology. 174, 7179-7185 (2005).</li><li>Bradley, R. R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Adenovirus+serotype+5-specific+neutralizing+antibodies+target+multiple+hexon+hypervariable+regions.">Adenovirus serotype 5-specific neutralizing antibodies target multiple hexon hypervariable regions.</a> Journal of virology. 86, 1267-1272 (2012).</li><li>Gahery-Segard, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Immune+response+to+recombinant+capsid+proteins+of+adenovirus+in+humans:+antifiber+and+anti-penton+base+antibodies+have+a+synergistic+effect+on+neutralizing+activity.">Immune response to recombinant capsid proteins of adenovirus in humans: antifiber and anti-penton base antibodies have a synergistic effect on neutralizing activity.</a> Journal of virology. 72, 2388-2397 (1998).</li><li>Gu, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Using+multivalent+adenoviral+vectors+for+HIV+vaccination.">Using multivalent adenoviral vectors for HIV vaccination.</a> PloS one. 8, e60347 (2013).</li><li>Tian, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Protection+against+enterovirus+71+with+neutralizing+epitope+incorporation+within+adenovirus+type+3+hexon.">Protection against enterovirus 71 with neutralizing epitope incorporation within adenovirus type 3 hexon.</a> PloS one. 7, e41381 (2012).</li><li>Wu, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Construction+and+characterization+of+adenovirus+serotype+5+packaged+by+serotype+3+hexon.">Construction and characterization of adenovirus serotype 5 packaged by serotype 3 hexon.</a> Journal of virology. 76, 12775-12782 (2002).</li><li>Wu, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Identification+of+sites+in+adenovirus+hexon+for+foreign+peptide+incorporation.">Identification of sites in adenovirus hexon for foreign peptide incorporation.</a> Journal of virology. 79, 3382-3390 (2005).</li><li>Qiu, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Serotype-specific+neutralizing+antibody+epitopes+of+human+adenovirus+type+3+(HAdV-3)+and+HAdV-7+reside+in+multiple+hexon+hypervariable+regions.">Serotype-specific neutralizing antibody epitopes of human adenovirus type 3 (HAdV-3) and HAdV-7 reside in multiple hexon hypervariable regions.</a> Journal of. 86, 7964-7975 (2012).</li><li>Parker, C. E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Fine+definition+of+the+epitope+on+the+gp41+glycoprotein+of+human+immunodeficiency+virus+type+1+for+the+neutralizing+monoclonal+antibody+2F5.">Fine definition of the epitope on the gp41 glycoprotein of human immunodeficiency virus type 1 for the neutralizing monoclonal antibody 2F5.</a> Journal of virology. 75, 10906-10911 (2001).</li><li>Farrow, A. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Immunization+with+Hexon+Modified+Adenoviral+Vectors+Integrated+with+gp83+Epitope+Provides+Protection+against+Trypanosoma+cruzi+Infection.">Immunization with Hexon Modified Adenoviral Vectors Integrated with gp83 Epitope Provides Protection against Trypanosoma cruzi Infection.</a> PLoS neglected tropical diseases. 8, e3089 (2014).</li><li>Krause, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Epitopes+expressed+in+different+adenovirus+capsid+proteins+induce+different+levels+of+epitope-specific+immunity.">Epitopes expressed in different adenovirus capsid proteins induce different levels of epitope-specific immunity.</a> Journal of virology. 80, 5523-5530 (2006).</li><li>Omori, N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Modification+of+a+fiber+protein+in+an+adenovirus+vector+improves+in+vitro+gene+transfer+efficiency+to+the+mouse+microglial+cell+line.">Modification of a fiber protein in an adenovirus vector improves in vitro gene transfer efficiency to the mouse microglial cell line.</a> Neuroscience letters. 324, 145-148 (2002).</li><li>Dmitriev, I. P., Kashentseva, E. A., Curiel, D. T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Engineering+of+adenovirus+vectors+containing+heterologous+peptide+sequences+in+the+C+terminus+of+capsid+protein+IX.">Engineering of adenovirus vectors containing heterologous peptide sequences in the C terminus of capsid protein IX.</a> Journal of virology. 76, 6893-6899 (2002).</li><li>Xue, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Construction+and+characterization+of+a+recombinant+human+adenovirus+type+3+vector+containing+two+foreign+neutralizing+epitopes+in+hexon.">Construction and characterization of a recombinant human adenovirus type 3 vector containing two foreign neutralizing epitopes in hexon.</a> Virus research. 183, 67-74 (2014).</li><li>Tian, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Construction+and+characterization+of+human+adenovirus+serotype+3+packaged+by+serotype+7+hexon.">Construction and characterization of human adenovirus serotype 3 packaged by serotype 7 hexon.</a> Virus research. 160, 214-220 (2011).</li><li>Kim, J. W., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+adenovirus+vector+incorporating+carbohydrate+binding+domains+utilizes+glycans+for+gene+transfer.">An adenovirus vector incorporating carbohydrate binding domains utilizes glycans for gene transfer.</a> PloS one. 8, e55533 (2013).</li><li>Vasconcelos, J. R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Pathogen-induced+proapoptotic+phenotype+and+high+CD95+(Fas)+expression+accompany+a+suboptimal+CD8++T-cell+response:+reversal+by+adenoviral+vaccine.">Pathogen-induced proapoptotic phenotype and high CD95 (Fas) expression accompany a suboptimal CD8+ T-cell response: reversal by adenoviral vaccine.</a> PLoS pathogens. 8, e1002699 (2012).</li><li>Matthews, Q. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genetic+incorporation+of+a+herpes+simplex+virus+type+1+thymidine+kinase+and+firefly+luciferase+fusion+into+the+adenovirus+protein+IX+for+functional+display+on+the+virion.">Genetic incorporation of a herpes simplex virus type 1 thymidine kinase and firefly luciferase fusion into the adenovirus protein IX for functional display on the virion.</a> Molecular imaging. 5, 510-519 (2006).</li></ol>

Yazarlar ifşa hiçbir şey yok.

aşıların geliştirilmesi için Ad5 değişiklik geleneksel transgen stratejisinin uygulama öncelikle Ad5 PEI 4,6 ile bağlantılı darboğaz için azalmıştır. Bu darboğaz kısmen bu strateji Ad5 nötralizan antikorların tarafından nötralize kaçmasına beri antijenlerin-faiz ile Ad5 ve nötralize epitoplarını değiştirerek, alternatif Antijen Kapsid-Ortaklık stratejisi (Şekil 1A) uygulamasıyla azaldı ve sağlam dokunulmazlık nesil kolaylaştırmak olabilir dahil antijenleri...

İnsan adenovirüs (Ad), bir çift sarmallı DNA genomunu ihtiva eden bir ikosahedral nükleokapsid sahip bir orta büyüklükte olmayan zarflı bir virüstür. Reklam Yedi gruba bir sınıflandırmaya (G ile A), Adenoviridae familyasına aittir. Her grup farklı serotiplerin virüs içeriyor. Grup C adenovirüs, hangi serotip 5 (Ad5) en yoğun çalışmalar yapılmış ve en yaygın gen tedavisi ve aşı gibi vectored yaklaşımlar uygulanmaktadır. Geleneksel transgen stratejisi geliştirildi ve gen-faiz ile virüs erken genlerin değiştirmesi ile karakterize Ad5 değişiklikler, uygulanan ve gen-faiz bir ev sahibi odaklı ifadesi olmuştur. Örnekler Simian İmmün Yetmezlik Virüsü 1 rev geni ile erken gen 3 (E3) değiştirerek pENV9 / Ad5hrΔE3 inşaat olan İnsan Bağışıklık Yetmezliği ve gag geni ile erken gen 1 (E1) değiştirerek AdCMVGag inşaatıVirüs (HIV) 2 ve lac Z geni 3 E1 değiştirerek Reklam lac Z yapımı. Ad5 geleneksel transgen stratejisinin geniş uygulama şu esasa bağlıdır: Ad5, virüs ve virüs yayılması üzerine uygulanabilir gen mühendisliği, yabancı gen ucun geniş konaklama ve Ad5 4,5 güvenliği için barındıran geniş. Ancak, bu stratejinin kullanımı ile Ad5-vektörlü klinik tedavilerin azalmış etkililiğin Ad5 çocuklar ve yetişkinler 4,6 çoğunluğu arasında çok yaygın olduğundan, öncelikle Ad5 PEI ile ilişkili olduğu eşlenmiş olan büyük bir darboğaz olmuştur. Ad5 önemli darboğazı aşmak için, temel amacı Ad5 PEI engellemeyi alternatif bir strateji geliştirmektir. Bu tür nötralize edici antikorlar (yakalar) 8-10 ve CD8 + T hücresi tepkilerinin olarak doğuştan gelen bağışıklık 7, adaptif bağışıklık Ad5 karşı 10 birlikte gösterilmiştirAd5 yakalar Ad5 PEI 10,11 katkıları baskın rol oynamaya görünen ile Ad5 PEI ntribute. Dahası, Ad5 ana protein Hexon, lif ve penton tabanı dahil kapsid proteinleri bulunan hedef epitopları, yakalar. Hangi Of, hekson Ad5 yakalar 8,11-13 önemli hedefidir. Bu bulgulara dayanarak, yenilikçi Antijen Kapsid-Kuruluş strateji girmiştir. Bu yeni strateji, nötralizan antikorların ve verimli Ad5 vektör idareleri azalarak tanınması lider, proteinlerin-faiz Ad5 nötralize epitoplarını vardiya veya maskeleri Ad5 kapsid proteinleri üzerinde değiştirilmesini ya da birleştirilmesini vurgulamaktadır. Aynı zamanda ana doğrudan bağışıklık sistemine 4,14,15 kadar antijenler-faiz sunarak sağlam humoral bağışıklığı ve güçlü hücresel bağışıklığı ortaya çıkarmak yardımcı olabilir, çünkü bu strateji rekabetçi olması dikkat çekicidir. Bu strateji dayanarak, moleküler klonlama ve yeniden birleştirici Reklam viral vektör, bir kurtarma yapısal ayrılabilirdört ana adımlar (a) ya da polimeraz zincir reaksiyonu (PCR) ya da sentez ile gen-faiz fragmanının hazırlanması; (B) bir adenovirüs omurgasına gen bölgesinin çıkar fragmanını ve homolog kollar ihtiva eden bir mekik plazmidinin gen fragmanının ligasyonu; (C) homolog rekombinasyon ko-transforme doğrusallaştırılmış plasmid omurgası pAd5 / ΔH5 (GL) 16 gen-faiz fragmanını ihtiva eden plasmid Servisi; (D) doğrusallaştırılmıştır rekombinant adenoviral plazmid transfeksiyon antijenleri-faiz ile birleşmiş rekombinant Reklam vektör kurtarmak için. Grubumuzun ve bazıları farklı bulaşıcı patojenlere karşı İlan vectored aşı geliştirilmesi için bu alternatif reklam birleşme stratejisi artırdık. Bir rekombinant Ad vektör üretilmesini bildirdi Ad-HVR1-LGS-His Ad5 hekson (hexon5) arasında HVR1 yereli bir His-etiketli, HIV-1 antijeni V3 içeren 6 -V3. Bu oluşturulan vektör str tetiklediV3 epitopa 4 özgü Ong humoral immün tepkisi. Ayrıca hexon5 2 HVR2 yereli olarak HIV-1 zara yakın ekto bölge (MPER) eklenerek Ad5 / HVR2-MPER-L15ΔE1 gelişimini bildirilmiştir. Buna ek olarak, Dr. Zhou&#39;nun grup Reklam serotip 3 (Ad3) vectored aşılar, yani. Geliştirmek için bu Reklam kuruluş stratejisinin yararları kullandı, Reklam-3&#39;te of HVR1 içine enterovirus 71 nötralize edici epitopu SP70 dahil ederek viral vektör R1SP70A3 nesil hekson (hexon3). R1SP70A3 Enterovirüs 71 meydan 15 karşı koruma yüksek oranda kurşun epitop SP70 özgü güçlü yakalar ve IFN-γ üretimini, üretilen. Teknik başvuru amacıyla, bizim çalışmamız HVR1 içine HIV-1 antijeni içeren bir iki değerli Ad5 vektörü Ad5 / H5-HVR1-Kwas-HVR5-His 6 nesil odaklanmak niteliksel Antijen Kapsid-Kuruluş stratejisi yararlandı birda hexon5 ve HVR5 içine His etiketi. oluşturulan viral vektör, ayrıca immünolojik değerlendirilmiştir. Antijen Kapsid-Ortaklık stratejisi farklı bulaşıcı hastalıklara karşı Ad5-vektörlü aşılama yaklaşımlarının geliştirilmesi yönünde yararlanılabilir.

<table border="0" cellpadding="0" cellspacing="0">
	<tbody>
		<tr>
			<td>1x DPBS</td>
			<td>Thermo Scientific</td>
			<td>SH30256.01</td>
			<td>for cell spliting&#160;</td>
		</tr>
		<tr>
			<td>10x DPBS</td>
			<td>Thermo Scientific</td>
			<td>SH30378.02</td>
			<td>for dialysis buffer preparation</td>
		</tr>
		<tr>
			<td>glycerol</td>
			<td>SIGMA</td>
			<td>G5516-1L</td>
			<td>for dialysis buffer preparation</td>
		</tr>
		<tr>
			<td>SDS</td>
			<td>BIO-RAD</td>
			<td>161-0301</td>
			<td>for virus lysis buffer preparation</td>
		</tr>
		<tr>
			<td>Fetal Bovine Serum (FBS)</td>
			<td>Thermo Scientific</td>
			<td>SH30910.03</td>
			<td>component of culture medium</td>
		</tr>
		<tr>
			<td>100X Non-Essential Amino Acids&#160;</td>
			<td>Thermo Scientific</td>
			<td>SH30238.01</td>
			<td>component of culture medium</td>
		</tr>
		<tr>
			<td>200mM/L L-glutamine</td>
			<td>Cellgro</td>
			<td>25-005-CI</td>
			<td>component of culture medium</td>
		</tr>
		<tr>
			<td>penicillin/streptomycin solution&#160;</td>
			<td>Cellgro</td>
			<td>30-002-CI</td>
			<td>component of culture medium</td>
		</tr>
		<tr>
			<td>DMEM with high glucose</td>
			<td>Thermo Scientific</td>
			<td>SH30081.01</td>
			<td>for HEK293 cell culture</td>
		</tr>
		<tr>
			<td>Minimum Essential Medium Eagle</td>
			<td>SIGMA</td>
			<td>M5650</td>
			<td>for HeLa cell culture</td>
		</tr>
		<tr>
			<td>phenol:chloroform:isoamyl alcohol&#160;</td>
			<td>SIGMA</td>
			<td>P3803-100ML</td>
			<td>for large size of DNA purification</td>
		</tr>
		<tr>
			<td>cesium chloride&#160;</td>
			<td>Research Products International Corp.</td>
			<td>C68050</td>
			<td>for virus purificiation</td>
		</tr>
		<tr>
			<td>HEPES</td>
			<td>Cellgro</td>
			<td>25-060-CI</td>
			<td>for CsCl solution preparation</td>
		</tr>
		<tr>
			<td>HEK293</td>
			<td>ATCC</td>
			<td>51-0036</td>
			<td>for virus rescue and upscale</td>
		</tr>
		<tr>
			<td>HeLa</td>
			<td>ATCC</td>
			<td>CCL-2</td>
			<td>for neutralization assay</td>
		</tr>
		<tr>
			<td>T-25 flask</td>
			<td>Thermo Scientific</td>
			<td>156367</td>
			<td>for cell culture&#160;</td>
		</tr>
		<tr>
			<td>T-75 flask</td>
			<td>CORNING</td>
			<td>430641</td>
			<td>for cell culture&#160;</td>
		</tr>
		<tr>
			<td>T-175 flask</td>
			<td>Thermo Scientific</td>
			<td>159910</td>
			<td>for cell culture&#160;</td>
		</tr>
		<tr>
			<td>Ultracentrifuge</td>
			<td>BECKMAN</td>
			<td>NA</td>
			<td>for virus purification</td>
		</tr>
		<tr>
			<td>Ultracentrifuge tube</td>
			<td>BECKMAN</td>
			<td>344059</td>
			<td>for virus purification</td>
		</tr>
		<tr>
			<td>dialysis cassette&#160;</td>
			<td>Thermo Scientific</td>
			<td>66380</td>
			<td>for virus dialysis</td>
		</tr>
		<tr>
			<td>ELISA plate</td>
			<td>Thermo Scientific</td>
			<td>442404</td>
			<td>for ELISA</td>
		</tr>
		<tr>
			<td>human anti-gp41 (2F5) mAb</td>
			<td>NIH AIDS Reagent Program</td>
			<td>1475</td>
			<td>for immunological assays</td>
		</tr>
		<tr>
			<td>mouse anti-His tag mAb</td>
			<td>GenScript</td>
			<td>A00186</td>
			<td>for immunological assays</td>
		</tr>
		<tr>
			<td>SOC medium</td>
			<td>CORNING</td>
			<td>46-003-CR</td>
			<td>for transformation</td>
		</tr>
		<tr>
			<td>PCR master mix solution</td>
			<td>QIAGEN</td>
			<td>201445</td>
			<td>for PCR</td>
		</tr>
		<tr>
			<td>Animal lancet (point length at 5mm)</td>
			<td>MEDIpoint</td>
			<td></td>
			<td>for mice bleeding&#160;</td>
		</tr>
		<tr>
			<td>Biophotometer</td>
			<td>Eppendorf</td>
			<td></td>
			<td>for virus physical titer titration</td>
		</tr>
	</tbody>
</table>

utilizing the antigen capsid-incorporation strategy for the development of adenovirus serotype 5-vectored vaccine approaches

Adenovirüs serotip 5 (Ad5) yoğun aşı gelişimi için geleneksel bir transgen yöntemleri ile modifiye edilmiştir. Klinik çalışmalarda bu geleneksel modifiye Ad5 vektörlerin azaltılmış etkililiğin öncelikle nüfusun çoğunluğu arasında Ad5 önceden varolan bağışıklık (PEI) ile ilişkili olabilir. Ad5 PEI endişe çözerek Ad5-vektörlü aşı gelişmesini teşvik etmek, yenilikçi Antijen Kapsid-Kuruluş strateji istihdam edilmiştir. Bu stratejinin liyakat, biz ilk hekson mekik inşa Ad5-vektörlü plazmid HVR1-Kwas-HVR5-His önceden yapılmış mekik plazmid HVR5-His 6 / pH5S içine aşırı değişken bölgesi (HVR) Hexon 1. altklonlanmasıyla 6 / pH5S, His 6 etiketi HVR5 dahil vardı. HIV epitopu ELDKWAS ihtiva eden bu HVR1 DNA fragmanı elde edilmiştir. HVR1-Kwas-HVR5-His 6 / pH5S sonra doğrusallaştırılmış ve doğrusallaştırılmış omurga plasmid pAd5 / ΔH5 (GL) ile birlikte transforme edilmiş olanHomolog rekombinasyon için. PAd5 / H5-HVR1-Kwas-HVR5-His 6 hücrelerine transfekte edilmiştir Bu rekombine plazmid, viral vektör Ad5 / H5-HVR1-Kwas-HVR5-His 6 oluşturmak için. Bu vektör, viral bir fiziksel titre (VP / ml) ile belirtilen niteliksel uygunluğu, enfeksiyonlu titre (IP / ml) ve karşılık gelen VP / IP oranına sahip doğrulandı. Hem HIV epitopu ve O&#39;nun 6 etiket yüzey maruz Ad5 kapsitinde vardı ve kendi epitop özel antijenisiteyi korudu. Bir nötralizasyon deneyi in vitro Ad5-pozitif serumlar ile nötralize aşmak için bu iki değerli vektörü yeteneğini gösterdi. Fare aşılama HIV epitopu ve 6 His için güçlü bir humoral bağışıklık spesifik oluştuğunu gösterdi. Bu proof-of-prensibi çalışma Antijen Kapsid-Ortaklık stratejisi ile ilişkili protokol fizibil farklı kapsid proteinleri değiştirerek Ad5-vektörlü aşıların üretimi için kullanılabilir öne sürdü. Bu protokol, hatta f olabilirurther nadir serotip adenovirüs vektörlü aşıların üretimi için de uyarlanabilir.

Antijen kapsid-ekleme stratejisinde (Şekil 1A) iki değerlikli Ad5 viral vektörü Ad5 / H5-HVR1-Kwas-HVR5-His 6 oluşturmak için kullanılmıştır. Öncelikle, mekik plazmid HVR1-Kwas-HVR5-His 6 / pH5S önceki inşa mekik plazmid HVR5-His 6 / pH5S 17 içine HVR1-Kwas fragmanı altklonlanmasıyla inşa edilmiştir. İkinci olarak, plazmid pAd5 / H5-HVR1-Kwas-HVR5-His 6 14 &quot;EcoRI-HVR1-Kwas-HVR5-His6-Pmel&quot; bir kısmı ve SwaI-d...

Watch this Scientific Journal Video about Utilizing the Antigen Capsid-Incorporation Strategy for the Development of Adenovirus Serotype 5-Vectored Vaccine Approaches at JoVE.com

Utilizing the Antigen Capsid-Incorporation Strategy for the Development of Adenovirus Serotype 5-Vectored Vaccine Approaches

Burada, bir proof-of-prensibi iki değerlikli adenovirüs tip 5 (Ad5) vektörü oluşturmak için bir protokol mevcut Ad5 / H5-HVR1-Kwas-HVR5-His 6 Antijen Kapsid-Ortaklık stratejisi kullanılarak. Bu vektör nitel uygunluk arzettiği gösterilmiştir, yetenek dahil antijenlere Ad5-pozitif in vitro sera&#39;yı ve antijenikliği yanı sıra immünojenitesini kaçmak için.

Adenovirüs Serotipinin 5-vektörlü Aşı Yaklaşımlar Geliştirme Antijen Kapsid-Ortaklık Stratejisi kullanmak

Adenovirus serotype 5 (Ad5) has been extensively modified with traditional transgene methods for the vaccine development. The reduced efficacies of these ...

utilizing-antigen-capsid-incorporation-strategy-for-development

Research

JoVE Journal

Immunology and Infection

10.3K Görüntüleme.  University of Alabama at Birmingham.  Burada, bir proof-of-prensibi iki değerlikli adenovirüs tip 5 (Ad5) vektörü oluşturmak için bir protokol mevcut Ad5 / H5-HVR1-Kwas-HVR5-His 6 Antijen Kapsid-Ortaklık stratejisi kullanılarak. Bu vektör nitel uygunluk arzettiği gösterilmiştir, yetenek dahil antijenlere Ad5-pozitif in vitro sera'yı ve antijenikliği yanı sıra immünojenitesini kaçmak için. 

Video: Utilizing the Antigen Capsid-Incorporation Strategy for the Development of Adenovirus Serotype 5-Vectored Vaccine Approaches

Quantitative Analyses of all Influenza Type A Viral Hemagglutinins and Neuraminidases using Universal Antibodies in Simple Slot Blot Assays

Hemagglutinin (HA) and neuraminidase (NA) are two surface proteins of influenza viruses which are known to play important roles in the viral life cycle and the induction of protective immune responses1,2. As the main target for neutralizing antibodies, HA is currently used as the influenza vaccine potency marker and is measured by single radial immunodiffusion (SRID)3. However, the dependence of SRID on the availability of the corresponding subtype-specific antisera causes a minimum of 2-3 months delay for the release of every new vaccine. Moreover, despite evidence that NA also induces protective immunity4, the amount of NA in influenza vaccines is not yet standardized due to a lack of appropriate reagents or analytical method5. Thus, simple alternative methods capable of quantifying HA and NA antigens are desirable for rapid release and better quality control of influenza vaccines.
Universally conserved regions in all available influenza A HA and NA sequences were identified by bioinformatics analyses6-7. One sequence (designated as Uni-1) was identified in the only universally conserved epitope of HA, the fusion peptide6, while two conserved sequences were identified in neuraminidases, one close to the enzymatic active site (designated as HCA-2) and the other close to the N-terminus (designated as HCA-3)7. Peptides with these amino acid sequences were synthesized and used to immunize rabbits for the production of antibodies. The antibody against the Uni-1 epitope of HA was able to bind to 13 subtypes of influenza A HA (H1-H13) while the antibodies against the HCA-2 and HCA-3 regions of NA were capable of binding all 9 NA subtypes. All antibodies showed remarkable specificity against the viral sequences as evidenced by the observation that no cross-reactivity to allantoic proteins was detected. These universal antibodies were then used to develop slot blot assays to quantify HA and NA in influenza A vaccines without the need for specific antisera7,8. Vaccine samples were applied onto a PVDF membrane using a slot blot apparatus along with reference standards diluted to various concentrations. For the detection of HA, samples and standard were first diluted in Tris-buffered saline (TBS) containing 4M urea while for the measurement of NA they were diluted in TBS containing 0.01% Zwittergent as these conditions significantly improved the detection sensitivity. Following the detection of the HA and NA antigens by immunoblotting with their respective universal antibodies, signal intensities were quantified by densitometry. Amounts of HA and NA in the vaccines were then calculated using a standard curve established with the signal intensities of the various concentrations of the references used. 
Given that these antibodies bind to universal epitopes in HA or NA, interested investigators could use them as research tools in immunoassays other than the slot blot only.

A simple slot blot method was developed for the quantification of influenza viral hemagglutinin and neuraminidase using universal antibodies targeting their most conserved sequences identified through bioinformatics analyses. This innovative approach may provide a useful alternative to quantitative determination of all viral hemagglutinin and neuraminidase.

Tüm Influenza Kantitatif Analiz Basit Slot Blot Tahliller Evrensel Antikorlar kullanarak Viral Hemagglutinins ve nöraminidaz yazın

Hemagglutinin (HA) and neuraminidase (NA) are two surface proteins of influenza viruses which are known to play important roles in the viral life cycle ...

İmmünoloji ve Enfeksiyon

Efficient Recombinant Parvovirus Production with the Help of Adenovirus-derived Systems

Rodent parvoviruses (PV) such as rat H-1PV and MVM, are small icosahedral, single stranded, DNA viruses. Their genome includes two promoters P4 and P38 which regulate the expression of non-structural (NS1 and NS2) and capsid proteins (VP1 and VP2) respectively1. They attract high interest as anticancer agents for their oncolytic and oncosuppressive abilities while being non-pathogenic for humans2. NS1 is the major effector of viral cytotoxicity3. In order to further enhance their natural antineoplastic activities, derivatives from these vectors have been generated by replacing the gene encoding for the capsid proteins with a therapeutic transgene (e.g. a cytotoxic polypeptide, cytokine, chemokine, tumour suppressor gene etc.)4. The recombinant parvoviruses (recPVs) vector retains the NS1/2 coding sequences and the PV genome telomeres which are necessary for viral DNA amplification and packaging. Production of recPVs occurs only in the producer cells (generally HEK293T), by co-transfecting the cells with a second vector (pCMV-VP) expressing the gene encoding for the VP proteins (Fig. 1)4. The recPV vectors generated in this way are replication defective. Although recPVs proved to possess enhanced oncotoxic activities with respect to the parental viruses from which they have been generated, their production remains a major challenge and strongly hampers the use of these agents in anti-cancer clinical applications.
We found that introduction of an Ad-5 derived vector containing the E2a, E4(orf6) and the VA RNA genes (e.g. pXX6 plasmid) into HEK293T improved the production of recPVs by more than 10 fold in comparison to other protocols in use. Based on this finding, we have constructed a novel Ad-VP-helper that contains the genomic adenoviral elements necessary to enhance recPVs production as well as the parvovirus VP gene unit5. The use of Ad-VP-helper, allows production of rec-PVs using a protocol that relies entirely on viral infection steps (as opposed to plasmid transfection), making possible the use of cell lines that are difficult to transfect (e.g. NB324K) (Fig. 2). We present a method that greatly improves the amount of recombinant virus produced, reducing both the production time and costs, without affecting the quality of the final product5. In addition, large scale production of recPV (in suspension cells and bioreactors) is now conceivable.

Here we describe a protocol based only on cell infection, which improves the efficiency of recombinant parvovirus production by more than 100 fold in comparison to other protocols in use. This protocol relies on the use of a novel adenovirus 5-based helper containing the parvovirus VP transcription unit (Ad-VP).

Adenovirüs kaynaklı Sistemleri Yardımı ile verimli Rekombinant Parvovirus Üretim

Rodent parvoviruses (PV) such as rat H-1PV and MVM, are small icosahedral, single stranded, DNA viruses. Their genome includes two promoters P4 and P38 ...

Generation of Recombinant Arenavirus for Vaccine Development in FDA-Approved Vero Cells

The development and implementation of arenavirus reverse genetics represents a significant breakthrough in the arenavirus field 4. The use of cell-based arenavirus minigenome systems together with the ability to generate recombinant infectious arenaviruses with predetermined mutations in their genomes has facilitated the investigation of the contribution of viral determinants to the different steps of the arenavirus life cycle, as well as virus-host interactions and mechanisms of arenavirus pathogenesis 1, 3, 11 . In addition, the development of trisegmented arenaviruses has permitted the use of the arenavirus genome to express additional foreign genes of interest, thus opening the possibility of arenavirus-based vaccine vector applications 5 . Likewise, the development of single-cycle infectious arenaviruses capable of expressing reporter genes provides a new experimental tool to improve the safety of research involving highly pathogenic human arenaviruses 16 . The generation of recombinant arenaviruses using plasmid-based reverse genetics techniques has so far relied on the use of rodent cell lines 7,19 , which poses some barriers for the development of Food and Drug Administration (FDA)-licensed vaccine or vaccine vectors. To overcome this obstacle, we describe here the efficient generation of recombinant arenaviruses in FDA-approved Vero cells.

Rescue of recombinant arenaviruses from cloned cDNAs, an approach referred to as reverse genetics, allows researchers to investigate the role of specific viral gene products, as well as the contribution of their different specific domains and residues, to many different aspects of the biology of arenavirus. Likewise, reverse genetics techniques in FDA-approved cell lines (Vero) for vaccine development provides novel possibilities for the generation of effective and safe vaccines to combat human pathogenic arenaviruses.

FDA onaylı Vero hücrelerinde Aşı Geliştirme için bir araya getiren Arenavirus üretimi

The development and implementation of arenavirus reverse genetics represents a significant breakthrough in the arenavirus field  4. The use of cell-based ...

Using Click Chemistry to Measure the Effect of Viral Infection on Host-Cell RNA Synthesis

Many RNA viruses have evolved the ability to inhibit host cell transcription as a means to circumvent cellular defenses. For the study of these viruses, it is therefore important to have a quick and reliable way of measuring transcriptional activity in infected cells. Traditionally, transcription has been measured either by incorporation of radioactive nucleosides such as 3H-uridine followed by detection via autoradiography or scintillation counting, or incorporation of halogenated uridine analogs such as 5-bromouridine (BrU) followed by detection via immunostaining. The use of radioactive isotopes, however, requires specialized equipment and is not feasible in a number of laboratory settings, while the detection of BrU can be cumbersome and may suffer from low sensitivity.
The recently developed click chemistry, which involves a copper-catalyzed triazole formation from an azide and an alkyne, now provides a rapid and highly sensitive alternative to these two methods. Click chemistry is a two step process in which nascent RNA is first labeled by incorporation of the uridine analog 5-ethynyluridine (EU), followed by detection of the label with a fluorescent azide. These azides are available as several different fluorophores, allowing for a wide range of options for visualization.
This protocol describes a method to measure transcriptional suppression in cells infected with the Rift Valley fever virus (RVFV) strain MP-12 using click chemistry. Concurrently, expression of viral proteins in these cells is determined by classical intracellular immunostaining. Steps 1 through 4 detail a method to visualize transcriptional suppression via fluorescence microscopy, while steps 5 through 8 detail a method to quantify transcriptional suppression via flow cytometry. This protocol is easily adaptable for use with other viruses.

This method describes the use of click chemistry to measure changes in host cell transcription after infection with the Rift Valley fever virus (RVFV) strain MP-12. Results can be visualized qualitatively via fluorescence microscopy or obtained quantitatively through flow cytometry. This method is adaptable for use with other viruses.

Ana-Hücre RNA sentezi üzerinde Viral Enfeksiyon Etkisi Tedbir tıklayın Kimya Kullanımı

Many RNA viruses have evolved the ability to inhibit host cell transcription as a means to circumvent cellular defenses. For the study of these viruses, ...

Assessing the Development of Murine Plasmacytoid Dendritic Cells in Peyer's Patches Using Adoptive Transfer of Hematopoietic Progenitors

This protocol details a method to analyze the ability of purified hematopoietic progenitors to generate plasmacytoid dendritic cells (pDC) in intestinal Peyer&#39;s patch (PP). Common dendritic cell progenitors (CDPs, lin- c-kitlo CD115+ Flt3+) were purified from the bone marrow of C57BL6 mice by FACS and transferred to recipient mice that lack a significant pDC population in PP; in this case, Ifnar-/- mice were used as the transfer recipients. In some mice, overexpression of the dendritic cell growth factor Flt3 ligand (Flt3L) was enforced prior to adoptive transfer of CDPs, using hydrodynamic gene transfer (HGT) of Flt3L-encoding plasmid. Flt3L overexpression expands DC populations originating from transferred (or endogenous) hematopoietic progenitors. At 7-10 days after progenitor transfer, pDCs that arise from the adoptively transferred progenitors were distinguished from recipient cells on the basis of CD45 marker expression, with pDCs from transferred CDPs being CD45.1+ and recipients being CD45.2+. The ability of transferred CDPs to contribute to the pDC population in PP and to respond to Flt3L was evaluated by flow cytometry of PP single cell suspensions from recipient mice. This method may be used to test whether other progenitor populations are capable of generating PP pDCs. In addition, this approach could be used to examine the role of factors that are predicted to affect pDC development in PP, by transferring progenitor subsets with an appropriate knockdown, knockout or overexpression of the putative developmental factor and/or by manipulating circulating cytokines via HGT. This method may also allow analysis of how PP pDCs affect the frequency or function of other immune subsets in PPs. A unique feature of this method is the use of Ifnar-/- mice, which show severely depleted PP pDCs relative to wild type animals, thus allowing reconstitution of PP pDCs in the absence of confounding effects from lethal irradiation.

This protocol describes experimental procedures to assess the differentiation of plasmacytoid dendritic cells in Peyer&#8217;s patch from common dendritic cell progenitors, using techniques involving FACS-mediated cell isolation, hydrodynamic gene transfer, and flow analysis of immune subsets in Peyer&#8217;s patch.

Hematopoetik progenitörlerin Evlatlık Transferi kullanarak Peter Parçacıklannda Murin plazmasitoid dendritik hücreleri Gelişimini değerlendirilmesi

This protocol details a method to analyze the ability of purified hematopoietic progenitors to generate plasmacytoid dendritic cells (pDC) in intestinal ...

In Vitro Analysis of Myd88-mediated Cellular Immune Response to West Nile Virus Mutant Strain Infection

An attenuated West Nile virus (WNV), a nonstructural (NS) 4B-P38G mutant, induced higher innate cytokine and T cell responses than the wild-type WNV in mice. Recently, myeloid differentiation factor 88 (MyD88) signaling was shown to be important for initial T cell priming and memory T cell development during WNV NS4B-P38G mutant infection. In this study, two flow cytometry-based methods &#8211; an in vitro T cell priming assay and an intracellular cytokine staining (ICS) &#8211; were utilized to assess dendritic cells (DCs) and T cell functions. In the T cell priming assay, cell proliferation was analyzed by flow cytometry following co-culture of DCs from both groups of mice with carboxyfluorescein succinimidyl ester (CFSE) - labeled CD4+ T cells of OTII transgenic mice. This approach provided an accurate determination of the percentage of proliferating CD4+ T cells with significantly improved overall sensitivity than the traditional assays with radioactive reagents. A microcentrifuge tube system was used in both cell culture and cytokine staining procedures of the ICS protocol. Compared to the traditional tissue culture plate-based system, this modified procedure was easier to perform at biosafety level (BL) 3 facilities. Moreover, WNV- infected cells were treated with paraformaldehyde in both assays, which enabled further analysis outside BL3 facilities. Overall, these in vitro immunological assays can be used to efficiently assess cell-mediated immune responses during WNV infection.

In Vitro Analysis of Myd88-mediated Cellular Immune Response to West Nile Virus Mutant Strain Infection

Two flow cytometry-based methods &#8211; an in vitro T cell priming assay and intracellular cytokine staining were utilized to measure antigen presenting capacity of dendritic cells and antigen-specific T cell responses to a West Nile virus mutant infection in mice.

Batı Nil Virüsü Mutant Soy Enfeksiyon MyD88-aracılı Hücresel Bağışıklık Tepki Vitro Analizi

An attenuated West Nile virus (WNV), a nonstructural (NS) 4B-P38G mutant, induced higher innate cytokine and T cell responses than the wild-type WNV in ...

Detection of Human Leukocyte Antigen Biomarkers in Breast Cancer Utilizing Label-free Biosensor Technology

According to the American Cancer Society, more than 200,000 women will be diagnosed with invasive breast cancer each year and approximately 40,000 will die from the disease. The human leukocyte antigen (HLA) class I samples peptides derived from proteasomal degradation of cellular proteins and presents these fragments on the cell surface for interrogation by circulating cytotoxic T lymphocytes (CTL). Generation of T-cell receptor mimic (TCRm) monoclonal antibodies (mAbs) which recognize breast cancer specific peptide/HLA-A*02:01 complexes such as those derived from macrophage migration inhibitory factor (MIF19-27) and NY-ESO-1157-165 enable detection and destruction of breast cancer cells in the absence of an effective anti-tumor CTL response. Intact class I HLA/peptide complexes are shed by breast cancer cells and represent potentially relevant cancer biomarkers. In this work, a breakthrough biomarker screening system for cancer diagnostics incorporating T-cell receptor mimic monoclonal antibodies combined with a novel, label-free biosensor utilizing guided-mode resonance (GMR) sensor technology is presented. Detection of shed MIF/HLA-A*02:01 complexes in MDA-MB-231 cell supernatants, spiked human serum, and patient plasma is demonstrated. The impact of this work could revolutionize personalized medicine through development of companion disease diagnostics for targeted immunotherapies.

Intact class I HLA/peptide complexes are shed by cancer cells, representing a potential relevant cancer biomarker. Utilizing label-free sensor technology and T-cell receptor mimicking monoclonal antibodies, detection of shed MIF/HLA-A*02:01 complexes in MDA-MB-231 cell supernatants, spiked human serum, and patient plasma is demonstrated, enabling development of a novel cancer diagnostic platform.

Etiket-ücretsiz Biyosensör Teknolojisi kullanılması Meme Kanserinde İnsan Lökosit Antijen BİYOMARKÖRLERİN Algılama

According to the American Cancer Society, more than 200,000 women will be diagnosed with invasive breast cancer each year and approximately 40,000 will ...

Development of an in vitro model system for studying the interaction of Equus caballus IgE with its high-affinity receptor Fc&#949;RI

The interaction of IgE with its high-affinity Fc receptor (Fc&#949;RI) followed by an antigenic challenge is the principal pathway in IgE mediated allergic reactions. As a consequence of the high affinity binding between IgE and Fc&#949;RI, along with the continuous production of IgE by B cells, allergies usually persist throughout life, with currently no permanent cure available. Horses, especially race horses, which are commonly inbred, are a species of mammals that are very prone to the development of hypersensitivity responses, which can seriously affect their performance. Physiological responses to allergic sensitization in horses mirror that observed in humans and dogs. In this paper we describe the development of an in situ assay system for the quantitative assessment of the release of mediators of the allergic response pertaining to the equine system. To this end, the gene encoding equine Fc&#949;RI&#945; was transfected into and expressed onto the surface of parental Rat Basophil Leukemia (RBL-2H3.1) cells. The gene product of the transfected equine &#945;-chain formed a functional receptor complex with the endogenous rat &#946;- and &#947;-chains 1. The resultant assay system facilitated an assessment of the quantity of mediator secreted from equine Fc&#949;RI&#945; transfected RBL-2H3.1 cells following sensitization with equine IgE and antigenic challenge using &#946;-hexosaminidase release as a readout 2, 3. Mediator release peaked at 36.68% &#177; 4.88% at 100 ng ml-1 of antigen. This assay was modified from previous assays used to study human and canine allergic responses 4, 5. We have also shown that this type of assay system has multiple applications for the development of diagnostic tools and the safety assessment of potential therapeutic intervention strategies in allergic disease 6, 2, 3.

The current study describes the development and applications of a genetically engineered assay system based on the transfection of rat basophilic leukemia cells with the equine Fc&#949;RI&#945; gene. Transfected cells express a functional receptor where the release of mediators of the allergic response can be activated by IgE and antigen.

Bir Geliştirilmesi<em&gt; In vitro</emEtkileşimini incelemek için&gt; bir model sistem<em&gt; Equus</em&gt;<em&gt; Caballus</emYüksek afiniteli reseptör FcεRI&gt; ile IgE

The interaction of IgE with its high-affinity Fc receptor (Fc&#949;RI) followed by an antigenic challenge is the principal pathway in IgE mediated ...

Imaging CD4 T Cell Interstitial Migration in the Inflamed Dermis

The ability of CD4 T cells to carry out effector functions is dependent upon the rapid and efficient migration of these cells in inflamed peripheral tissues through an as-yet undefined mechanism. The application of multiphoton microscopy to the study of the immune system provides a tool to measure the dynamics of immune responses within intact tissues. Here we present a protocol for non-invasive intravital multiphoton imaging of CD4 T cells in the inflamed mouse ear dermis. Use of a custom imaging platform and a venous catheter allows for the visualization of CD4 T cell dynamics in the dermal interstitium, with the ability to interrogate these cells in real-time via the addition of blocking antibodies to key molecular components involved in motility. This system provides advantages over both in vitro models and surgically invasive imaging procedures. Understanding the pathways used by CD4 T cells for motility may ultimately provide insight into the basic function of CD4 T cells as well as the pathogenesis of both autoimmune diseases and pathology from chronic infections.

The mechanisms that govern the interstitial motility of CD4 effector T cells at sites of inflammation are relatively unknown. We present a non-invasive approach to visualize and manipulate in vitro-primed CD4 T cells in the inflamed ear dermis, allowing for study of the dynamic behavior of these cells in situ.

Iltihaplı Dermisinde içinde görüntüleme CD4 + T hücre Geçiş Göç

The ability of CD4 T cells to carry out effector functions is dependent upon the rapid and efficient migration of these cells in inflamed peripheral ...

Development of Stem Cell-derived Antigen-specific Regulatory T Cells Against Autoimmunity

Autoimmune diseases arise due to the loss of immunological self-tolerance. Regulatory T cells (Tregs) are important mediators of immunologic self-tolerance. Tregs represent about 5 - 10% of the mature CD4+ T cell subpopulation in mice and humans, with about 1 - 2% of those Tregs circulating in the peripheral blood. Induced pluripotent stem cells (iPSCs) can be differentiated into functional Tregs, which have a potential to be used for cell-based therapies of autoimmune diseases. Here, we present a method to develop antigen (Ag)-specific Tregs from iPSCs (i.e., iPSC-Tregs). The method is based on incorporating the transcription factor FoxP3 and an Ag-specific T cell receptor (TCR) into iPSCs and then differentiating on OP9 stromal cells expressing Notch ligands delta-like (DL) 1 and DL4. Following in vitro differentiation, the iPSC-Tregs express CD4, CD8, CD3, CD25, FoxP3, and Ag-specific TCR and are able to respond to Ag stimulation. This method has been successfully applied to cell-based therapy of autoimmune arthritis in a murine model. Adoptive transfer of these Ag-specific iPSC-Tregs into Ag-induced arthritis (AIA)-bearing mice has the ability to reduce joint inflammation and swelling and to prevent bone loss.

We present here a method to develop functional antigen (Ag)-specific regulatory T cells (Tregs) from induced pluripotent stem cells (iPSCs) for immunotherapy of autoimmune arthritis in a murine model.