Esta obra fue financiada en parte por los Institutos Nacionales de Salud otorga 5T32AI7493-20 y 5R01AI089337-03. Los financiadores no tenía papel en el diseño del estudio, la recogida y análisis de datos, decisión de publicar, o la preparación del manuscrito.

La Universidad de Alabama en Birmingham Institucional Animal Uso y Cuidado Comité aprobó el uso de ratones como se describe en el presente documento con el número de protocolo aprobado 101.109.272. 1. Genética Construcción de un plásmido modificado pAd5 / H5-HVR1-Kwas-HVR5-Su 6 con la Estrategia de la cápside-Incorporación Antígeno <ol><li> La construcción del plásmido lanzadera 6 / pH5S Sus HVR1-Kwas-HVR5- <ol><li> Pedido un plásmido que contiene la secuencia de ADN sintetizada HVR1-Kwas entre los sitios de enzimas de restricción AgeI a AccI del gen hexon5. </li><li> Digerir 6 mu g del fragmento sintetizado (HVR1-Kwas) con las enzimas de AgeI (6 unidades) y AccI (6 unidades) durante 3 horas a 37 ° C. Resolver el fragmento digerido en un gel de agarosa al 2% por electroforesis, y purificar el fragmento con un kit de extracción en gel de ADN de acuerdo con el protocolo del fabricante. </li><li> Basado en la relación molar de inserto al vector en 3: 1, usar el ADN ligasa de T4 ligasa y bUffer para ligar 12 ng del fragmento (HVR1-Kwas) en 100 ng de un plásmido lanzadera previamente construido HVR5-His 6 / pH5S 17 en un volumen de 10 l a TA durante 2 h, a través de los sitios de AgeI y AccI. </li><li> Transformar 1 l de cada 10 l de el producto de ligación en 50 l de células DH5 electrocompetentes en un electroporador (a 1.800 V). Añadir 950 l de medio SOC a las células DH5a transformado y se incuba la mezcla durante 1 hora a 37 ° C, con 300 rpm. Spread 100-200 l de la mezcla de 1 ml sobre el agar Luria-Bertani (LB) que contiene kanamicina y se incuba O / N a 37 ° C. <ol><li> A la pantalla ~ 10 colonias por PCR dirigidos al fragmento HVR1-Kwas, mezclar el cebador directo (TATGTGTGTCATGTATGCGT), cebador inverso (GGAGGCCCACTTGTCCAGCTC) y una sola colonia DH5a en una solución de mezcla maestra de PCR (de acuerdo con el protocolo del fabricante). Ejecutar las muestras en un termociclador refiriéndose al manual proporcionado con la solución mezcla maestra de PCR. </li><li> Utilice el cebador directo (TATGTGTGTCATGTATGCGT) para secuenciar el fragmento HVR1-Kwas en los clones seleccionados en la sección 1.1.4.1. </li></ol></li></ol></li><li> Construcción del plásmido pAd5 / H5-HVR1-Kwas-HVR5-Su 6 <ol><li> Recopilación de 6 g de HVR1-Kwas-HVR5-Su 6 / pH5S con las enzimas EcoRI (6 unidades) y PmeI (6 unidades) durante 3 horas a 37 ° C, y purificar el fragmento que contiene los brazos de recombinación homóloga y el gen modificado hexon5 dual, como se indica en el paso 1.1.2. Linealizar el plásmido columna vertebral pAd5 / ΔH5 (GL) 16 con SwaI. </li><li> Co-transformada de 100 ng del fragmento diana del plásmido lanzadera y 100 ng de la estructura linealizado pAd5 / ΔH5 (GL) en 50 l de células BJ5183 electrocompetentes para la recombinación homóloga en un electroporador (a 1.800 V). Añadir 950 l de medio SOC a las células transformadas y se incuba la mezcla durante 1 hora a 37 ° C, 300 rpm. Corre 100-200 l de la mezcla de 1 mlen el agar LB que contiene kanamicina (final de 50 mg / ml) para O / N de incubación a 37 ° C. <ol><li> Escoja ~ 10 pequeñas colonias en 3 ml de LB líquido que contiene kanamicina (final de 50 mg / ml) de O / N de incubación en un agitador (250 rpm, 37 ° C). Extracto de plásmidos de la cultura. Utilice el análisis de PCR para detectar las 10 colonias por la orientación del fragmento de HVR1-Kwas, como se ilustra en el paso 1.1.4.1. </li><li> A la pantalla los mismos colonias mediante análisis por PCR dirigida al fragmento pIX del genoma columna vertebral, mezclar el cebador directo (AGCTGTTGGATCTGCGCCAGCAGGTT), cebador inverso (CCAAACAGAGTCTGGTTTTTTATTTAT) y una sola colonia BJ5183 en una solución de mezcla maestra de PCR (de acuerdo con el protocolo del fabricante). Ejecutar las muestras en un termociclador refiriéndose al manual proporcionado con la solución de mezcla maestra de PCR. </li><li> Designar las colonias de doble positivos de PCR como pAd5 / H5-HVR1-Kwas-HVR5-Su 6. </li></ol></li><li> Transformar 100 ng del plásmido pAd5 / H5-HVR1-Kwas-HVR5-Su 6 ena células DH5a como se ilustra en el paso 1.1.4. <ol><li> Utilice el análisis de PCR para detectar ~ 10 colonias por la orientación del fragmento de HVR1-Kwas, como se ilustra en el paso 1.1.4.1. </li><li> Utilice el análisis de PCR para detectar las mismas colonias por la orientación del fragmento pIX del genoma columna vertebral, como se ilustra en el paso 1.2.2.2. </li><li> Utilice el cebador directo (TATGTGTGTCATGTATGCGT) para secuenciar el fragmento HVR1-Kwas en pAd5 / H5-HVR1-Kwas-HVR5-Su 6. </li></ol></li></ol></li></ol> 2. Preparación de Modificado Ad5 Viral vector Ad5 / H5-HVR1-Kwas-HVR5-Su 6 <ol><li> Constituyen el medio completo mediante la adición de FBS (10% final), ácidos no esenciales 100X Amino (final de 0,1 mM), 200 mM L-glutamina (final 2 mM) y penicilina / estreptomicina solución (final de 1%) en DMEM con alta glucosa . Mantener las células humanas de riñón embrionario (HEK293) en medio completo en una incubadora de cultivo (37 ° C y 5% de CO2 bajo condiciones de humedad del 85%). </li><li> Rescate de cinco viralctor Ad5 / H5-HVR1-Kwas-HVR5-Su 6 <ol><li> Seed 3,0 x 10 6 de las células HEK293 en una T-25 matraz que contenía 5 ml de medio completo y cultivo O / N para lograr una monocapa con 80% de confluencia. </li><li> Linealizar 15 g de pAd5 / H5-HVR1-Kwas-HVR5 6-His en un volumen de 100 l con enzima de restricción PacI (15 unidades) a 37 ° C durante 3 hrs. <ol><li> Extraer linealizado pAd5 / H5-HVR1-Kwas-HVR5-His 6 por centrifugación de la reacción dos veces (10.000 xg durante 1 min) con un volumen igual de fenol: cloroformo: alcohol isoamílico (relación en 25: 24: 1) en una campana de humos , y por centrifugación secuencial (10.000 xg durante 10 min) con una solución mixta (300 l de etanol 100% y 10 l de acetato de sodio) y 700 l de etanol al 70%. Desechar el sobrenadante en cada etapa de centrifugación. </li></ol></li><li> Resuspender el plásmido purificado en ~ 40 l de agua destilada o Tris-EDTA (TE) tampón. Cuantificar el ADN plásmido mediante la medición de la óptica density (DO) a 260 nm. </li><li> Transfectar 3 g del plásmido linealizado con reactivo comercial transfección liposomal en el matraz T-25, de acuerdo con el manual del fabricante. Cambie el medio de transfección con medio completo a 6 horas después de la transfección y la posterior incubación en la incubadora de cultivo. Mantener las células transfectadas mediante la sustitución de medio completo cada dos o tres días, hasta formar placas virales individuales. </li><li> Cuando las placas se desarrollan a efecto citopático completo (CPE), raspar las células restantes fuera el matraz en una campana estéril, y lisado celular cosecha por centrifugación medio a 300 xg durante 10 min a 4 ° C. Suspender el sedimento de células en ~ 1 ml de medio que contiene 2% de FBS, y romper las células por congelación-descongelación cuatro veces. Recoger el sobrenadante que contiene virus rescatado después de la centrifugación del lisado a 10.000 xg durante 10 min a 4 ° C. </li></ol></li><li> Propagación a gran escala del vector viral de Ad5 / H5-HVR1-Kwas-HVR5-Su 6 <ol><li> Propagar ªe virus en un matraz T-75 que contiene células HEK293 en la campana estéril mediante la infección con un tercio a la plena lisado del matraz T-25. Permita CPE completo para desarrollar dentro de dos o tres días en la incubadora de cultivo. Recoger el sobrenadante lisado como se indica en el paso 2.2.5. </li><li> Propagar el virus en una a tres matraces T-175 en la campana estéril mediante la infección con medio completo a lisado del matraz T-75, dependiendo de las condiciones de propagación de virus. Permita CPE completo para desarrollar dentro de dos o tres días en la incubadora de cultivo. Recoger el sobrenadante lisado como se indica en el paso 2.2.5. </li><li> Propagar el virus en una docena o más de matraces T-175 en la campana estéril mediante la infección con medio completo a lisado de la anterior matraz T-175 (s). Determinar la cantidad de uso matraz basado en las condiciones de propagación de virus y la cantidad de virus en necesidad. Recoger el sobrenadante lisado como se indica en el paso 2.2.5 cuando CPE completo se produce en dos o tres días en la incubadora de cultivo. </li></ol></li><li> Purificación de Ad5 / H5-HVR1-Kwas-HVR5-Su 6 de cloruro de cesio <ol><li> Preparar dos densidades de soluciones de CsCl en 5 mM HEPES: 1,33 g / ml y 1,45 g / ml, mientras que evitando el contacto con CsCl. </li><li> Cargar 4 ml de CsCl (1,33 g / ml) en un tubo de ultracentrífuga estéril, y la carga suavemente 4 ml de CsCl (1,45 g / ml) contra la parte inferior del tubo. Cargar 4 ml de sobrenadante de lisado lentamente en la parte superior de los gradientes en la campana estéril. </li><li> Centrifugar el tubo a 110.000 xg durante 3 horas a 4 ° C para separar la banda de virus maduro / inferior de la banda de virus defectuoso / superior. Recoger la banda inferior usando una jeringa de 3 ml armado con una aguja de 33 G y diluir la banda con 5 mM HEPES a un volumen de 4 ml en la campana estéril. </li><li> Cargar otro tubo con dos densidades de soluciones de CsCl y la banda diluida de virus como se describe en el paso 2.4.2. Centrifugar el tubo a 110.000 xg O / N a 4 ° C. Recoger la banda viral como se describe en el paso 2.4.3. </li><li> Inyectar la solución de virus recogido en un dialyses casete por una jeringa de 3 ml armado con una aguja de 33 G en la campana estéril. </li><li> Coloque el casete en 700 ml de tampón de diálisis 1x (1 L receta: 100 ml de PBS 10x, 100 ml de 100% de glicerol y 800 ml de agua destilada; filtrar el tampón a través de un filtro de 0,22 micras) y reemplazar el tampón de diálisis cada 3 hrs para 4 veces. Aspirar a cabo solución de virus dializado utilizando una jeringa con aguja. </li></ol></li></ol> 3. Validación del vector viral rescatado <ol><li> Las titulaciones virales del vector <ol><li> Para el título físico virus, diluir tanto virus y tampón de diálisis (control de fondo) a 1: 10 y 1: 20 en tampón de lisis virus (10% de SDS en Tris-EDTA) en pequeños tubos, e incubar todos los tubos a 56 ° C durante 10 minutos. </li><li> Encienda una BioPhotometer y establecer el modo de absorbancia a OD 260 nm. Utilice el tampón de diálisis diluido (1: 10) para equilibrar la señal de fondo haciendo clic en la parte inferior &quot;en blanco&quot;. Tipo &quot;10 + 90&quot; en el scr BioPhotometereen, y leer la señal del virus diluido (1: 10). </li><li> Leer la señal del virus diluido (1: 20), siguiendo el método en el paso 3.1.2, pero en su lugar, escriba &quot;5 + 95&quot; en la pantalla BioPhotometer. Multiplicar los dos números de lectura virus por 1.1x10 12 y calcular el título medio con una unidad como VP / ml, basado en los dos títulos individuales de las dos diluciones. </li><li> Para el título infeccioso del virus (IP / ml), utilizar el método de Karber 50 TCID estadística 14 para determinar la profundidad de la infección en células HEK293 después de la infección 10 días (dpi) </li></ol></li><li> Evaluación de la pantalla de exposición antigénica en el vector viral <ol><li> Escudo del vector viral en una placa de ELISA y continúe con el resto de pasos en un método ELISA estándar 14. Use anticuerpo humano anti-gp41 (2F5) monoclonal (mAb) y el ratón anti-His tag mAb para la detección de antígenos incorporados correspondiente 14. </li><li> Resolver el vector viral en un denatuelectroforesis en gel de proteína roja (SDS-PAGE) y continúe con el resto de pasos en un método Western-blot estándar 14. Use anticuerpo humano anti-gp41 (2F5) monoclonal (mAb) y el ratón anti-His tag mAb para la detección de antígenos incorporados correspondiente 14. </li></ol></li><li> Evaluación in vitro del vector en la capacidad de eludir sueros Ad5-positve <ol><li> Mantener las células HeLa en medio completo en la incubadora de cultivo (37 ° C y 5% de CO 2 bajo condiciones de humedad del 85%). Constituyen el medio completo mediante la adición de FBS (10% final), 200 mM L-glutamina (final de 2 mM) y solución de penicilina / estreptomicina (final de 1%) en medio esencial mínimo de Eagle (MEME). </li><li> Semilla células HeLa en placas de 6 pocillos a 1x10 6 células / pocillo, y se incuban las placas en la incubadora de cultivo (37 ° C y 5% de CO 2 bajo condiciones de humedad del 85%) durante 2 horas. Incubar los sueros Ad5-positivo (0,1 l 0 o l) con 5 IP / célula de vector viral (Ad5 o Ad5 / H5-HVR1-Kwas-HVR5-Su 6) en la incubadora de cultivo durante 1 hora antes de añadir las mezclas sobre las placas de 6 pocillos que contienen células. </li><li> A las 24 horas después de la infección (hpi), enjuagar las células una vez con PBS y se lisan las células en 0,5 ml de tampón de lisis. Centrifugar a 15.000 xg durante 5 min y se recoge el sobrenadante. Mezclar 20 l del sobrenadante con 100 l de sustrato de luciferasa para la lectura de la señal de la luciferasa, ya que los virus contienen el gen de la luciferasa. </li></ol></li></ol> 4. Evaluación inmunológica del vector viral rescatado <ol><li> Prepare dos grupos de inmunización: Ad5 y Ad5 / H5-HVR1-Kwas-HVR5-Su 6. <ol><li> Inyectar ratones (n = 8 / grupo) por vía intramuscular con virus en 1x10 10 VP / ratón, en un &quot;primer impulso&quot; régimen de inmunización homóloga, con un intervalo de 2 semanas. </li><li> A las 2 semanas después de cada inyección, sangrar ratones sin anestesia por la mejilla sangrado con lancetas animales (5 mm de longitud de punta) arecoger la sangre en tubos de 1,5 ml. </li></ol></li><li> Mezclar la sangre en los tubos por inversión arriba y abajo, y se incuba la sangre a temperatura ambiente durante 30 min. Haga girar los tubos a 10.000 xg durante 5 min a 4 ° C y los sueros de transferencia (capa superior) para nuevos tubos de 1,5 ml. <ol><li> Haga girar los nuevos tubos a 10.000 xg durante 5 min a 4 ° C y la transferencia de los sueros de recién marcados tubos de 1,5 ml para el almacenamiento a -80 ° C. </li></ol></li><li> Evaluación de la inmunidad humoral específica de antígeno por ELISA basado sueros- <ol><li> Diluir Su péptido (acciones a 1 mM) y el VIH-1 péptido (acciones a 1 mM) por separado en 100. </li><li> tampón de carbonato mM (pH 9,5) para lograr la concentración de recubrimiento péptido a 10 mM. Recubrir las placas de ELISA con los péptidos diluidos por separado mediante la adición de 100 l por pocillo e incubando las placas de O / N a 4 ° C. </li><li> Lavar las placas con PBST durante cuatro veces a 200 l / pocillo y el bloque durante 1 h en 5% de BSA en PBST. Aplicar sueros de ratones a las placas a 1: 100 dilución en el buf bloqueafer, 100 l / pocillo. Incubar durante 2 horas de incubación a temperatura ambiente. </li><li> Lavar las placas con PBST durante cuatro veces. Bloquear las placas por incubación a TA durante 30 min en el tampón de bloqueo a 100 l / pocillo. </li><li> Aplicar de cabra anti-IgG de ratón-HRP (1: 5.000 en el tampón de bloqueo) a 100 l / pocillo tanto a las placas recubiertas con Su péptido y el VIH-1 péptido individualmente. Incubar durante 2 horas a RT. Lavar las placas con PBST. </li><li> Leer las placas a OD450 nm después de la incubación con sustrato de HRP durante 30 min. </li></ol></li></ol>

<ol>
	<li>Cheng, S. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Coexpression+of+the+simian+immunodeficiency+virus+Env+and+Rev+proteins+by+a+recombinant+human+adenovirus+host+range+mutant.">Coexpression of the simian immunodeficiency virus Env and Rev proteins by a recombinant human adenovirus host range mutant.</a> Journal of virology. 66, 6721-6727 (1992).</li><li>Matthews, Q. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=HIV+antigen+incorporation+within+adenovirus+hexon+hypervariable+2+for+a+novel+HIV+vaccine+approach.">HIV antigen incorporation within adenovirus hexon hypervariable 2 for a novel HIV vaccine approach.</a> PloS one. 5, e11815 (2010).</li><li>DeMatteo, R. P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Long-lasting+adenovirus+transgene+expression+in+mice+through+neonatal+intrathymic+tolerance+induction+without+the+use+of+immunosuppression.">Long-lasting adenovirus transgene expression in mice through neonatal intrathymic tolerance induction without the use of immunosuppression.</a> Journal of virology. 71, 5330-5335 (1997).</li><li>Gu, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+recombinant+adenovirus-based+vector+elicits+a+specific+humoral+immune+response+against+the+V3+loop+of+HIV-1+gp120+in+mice+through+the+'Antigen+Capsid-Incorporation'+strategy.">A recombinant adenovirus-based vector elicits a specific humoral immune response against the V3 loop of HIV-1 gp120 in mice through the 'Antigen Capsid-Incorporation' strategy.</a> Virology journal. 11, 112 (2014).</li><li>Matthews, Q. L., Krendelchtchikov, A. L. G., Li, Z. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Viral+Vectors+for+Vaccine+Development.">Viral Vectors for Vaccine Development.</a> INTECH. , (2013).</li><li>Tang, D. C., Zhang, J., Toro, H., Shi, Z., Van Kampen, K. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Adenovirus+as+a+carrier+for+the+development+of+influenza+virus-free+avian+influenza+vaccines.">Adenovirus as a carrier for the development of influenza virus-free avian influenza vaccines.</a> Expert review of vaccines. 8, 469-481 (2009).</li><li>Flatt, J. W., Kim, R., Smith, J. G., Nemerow, G. R., Stewart, P. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+intrinsically+disordered+region+of+the+adenovirus+capsid+is+implicated+in+neutralization+by+human+alpha+defensin+5.">An intrinsically disordered region of the adenovirus capsid is implicated in neutralization by human alpha defensin 5.</a> PloS one. 8, e61571 (2013).</li><li>Bradley, R. R., Lynch, D. M., Iampietro, M. J., Borducchi, E. N., Barouch, D. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Adenovirus+serotype+5+neutralizing+antibodies+target+both+hexon+and+fiber+following+vaccination+and+natural+infection.">Adenovirus serotype 5 neutralizing antibodies target both hexon and fiber following vaccination and natural infection.</a> Journal of virology. 86, 625-629 (2012).</li><li>Zaiss, A. K., Machado, H. B., Herschman, H. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+influence+of+innate+and+pre-existing+immunity+on+adenovirus+therapy.">The influence of innate and pre-existing immunity on adenovirus therapy.</a> Journal of cellular biochemistry. 108, 778-790 (2009).</li><li>Sumida, S. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Neutralizing+antibodies+and+CD8++T+lymphocytes+both+contribute+to+immunity+to+adenovirus+serotype+5+vaccine+vectors.">Neutralizing antibodies and CD8+ T lymphocytes both contribute to immunity to adenovirus serotype 5 vaccine vectors.</a> Journal of virology. 78, 2666-2673 (2004).</li><li>Sumida, S. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Neutralizing+antibodies+to+adenovirus+serotype+5+vaccine+vectors+are+directed+primarily+against+the+adenovirus+hexon+protein.">Neutralizing antibodies to adenovirus serotype 5 vaccine vectors are directed primarily against the adenovirus hexon protein.</a> Journal of immunology. 174, 7179-7185 (2005).</li><li>Bradley, R. R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Adenovirus+serotype+5-specific+neutralizing+antibodies+target+multiple+hexon+hypervariable+regions.">Adenovirus serotype 5-specific neutralizing antibodies target multiple hexon hypervariable regions.</a> Journal of virology. 86, 1267-1272 (2012).</li><li>Gahery-Segard, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Immune+response+to+recombinant+capsid+proteins+of+adenovirus+in+humans:+antifiber+and+anti-penton+base+antibodies+have+a+synergistic+effect+on+neutralizing+activity.">Immune response to recombinant capsid proteins of adenovirus in humans: antifiber and anti-penton base antibodies have a synergistic effect on neutralizing activity.</a> Journal of virology. 72, 2388-2397 (1998).</li><li>Gu, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Using+multivalent+adenoviral+vectors+for+HIV+vaccination.">Using multivalent adenoviral vectors for HIV vaccination.</a> PloS one. 8, e60347 (2013).</li><li>Tian, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Protection+against+enterovirus+71+with+neutralizing+epitope+incorporation+within+adenovirus+type+3+hexon.">Protection against enterovirus 71 with neutralizing epitope incorporation within adenovirus type 3 hexon.</a> PloS one. 7, e41381 (2012).</li><li>Wu, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Construction+and+characterization+of+adenovirus+serotype+5+packaged+by+serotype+3+hexon.">Construction and characterization of adenovirus serotype 5 packaged by serotype 3 hexon.</a> Journal of virology. 76, 12775-12782 (2002).</li><li>Wu, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Identification+of+sites+in+adenovirus+hexon+for+foreign+peptide+incorporation.">Identification of sites in adenovirus hexon for foreign peptide incorporation.</a> Journal of virology. 79, 3382-3390 (2005).</li><li>Qiu, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Serotype-specific+neutralizing+antibody+epitopes+of+human+adenovirus+type+3+(HAdV-3)+and+HAdV-7+reside+in+multiple+hexon+hypervariable+regions.">Serotype-specific neutralizing antibody epitopes of human adenovirus type 3 (HAdV-3) and HAdV-7 reside in multiple hexon hypervariable regions.</a> Journal of. 86, 7964-7975 (2012).</li><li>Parker, C. E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Fine+definition+of+the+epitope+on+the+gp41+glycoprotein+of+human+immunodeficiency+virus+type+1+for+the+neutralizing+monoclonal+antibody+2F5.">Fine definition of the epitope on the gp41 glycoprotein of human immunodeficiency virus type 1 for the neutralizing monoclonal antibody 2F5.</a> Journal of virology. 75, 10906-10911 (2001).</li><li>Farrow, A. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Immunization+with+Hexon+Modified+Adenoviral+Vectors+Integrated+with+gp83+Epitope+Provides+Protection+against+Trypanosoma+cruzi+Infection.">Immunization with Hexon Modified Adenoviral Vectors Integrated with gp83 Epitope Provides Protection against Trypanosoma cruzi Infection.</a> PLoS neglected tropical diseases. 8, e3089 (2014).</li><li>Krause, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Epitopes+expressed+in+different+adenovirus+capsid+proteins+induce+different+levels+of+epitope-specific+immunity.">Epitopes expressed in different adenovirus capsid proteins induce different levels of epitope-specific immunity.</a> Journal of virology. 80, 5523-5530 (2006).</li><li>Omori, N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Modification+of+a+fiber+protein+in+an+adenovirus+vector+improves+in+vitro+gene+transfer+efficiency+to+the+mouse+microglial+cell+line.">Modification of a fiber protein in an adenovirus vector improves in vitro gene transfer efficiency to the mouse microglial cell line.</a> Neuroscience letters. 324, 145-148 (2002).</li><li>Dmitriev, I. P., Kashentseva, E. A., Curiel, D. T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Engineering+of+adenovirus+vectors+containing+heterologous+peptide+sequences+in+the+C+terminus+of+capsid+protein+IX.">Engineering of adenovirus vectors containing heterologous peptide sequences in the C terminus of capsid protein IX.</a> Journal of virology. 76, 6893-6899 (2002).</li><li>Xue, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Construction+and+characterization+of+a+recombinant+human+adenovirus+type+3+vector+containing+two+foreign+neutralizing+epitopes+in+hexon.">Construction and characterization of a recombinant human adenovirus type 3 vector containing two foreign neutralizing epitopes in hexon.</a> Virus research. 183, 67-74 (2014).</li><li>Tian, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Construction+and+characterization+of+human+adenovirus+serotype+3+packaged+by+serotype+7+hexon.">Construction and characterization of human adenovirus serotype 3 packaged by serotype 7 hexon.</a> Virus research. 160, 214-220 (2011).</li><li>Kim, J. W., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+adenovirus+vector+incorporating+carbohydrate+binding+domains+utilizes+glycans+for+gene+transfer.">An adenovirus vector incorporating carbohydrate binding domains utilizes glycans for gene transfer.</a> PloS one. 8, e55533 (2013).</li><li>Vasconcelos, J. R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Pathogen-induced+proapoptotic+phenotype+and+high+CD95+(Fas)+expression+accompany+a+suboptimal+CD8++T-cell+response:+reversal+by+adenoviral+vaccine.">Pathogen-induced proapoptotic phenotype and high CD95 (Fas) expression accompany a suboptimal CD8+ T-cell response: reversal by adenoviral vaccine.</a> PLoS pathogens. 8, e1002699 (2012).</li><li>Matthews, Q. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genetic+incorporation+of+a+herpes+simplex+virus+type+1+thymidine+kinase+and+firefly+luciferase+fusion+into+the+adenovirus+protein+IX+for+functional+display+on+the+virion.">Genetic incorporation of a herpes simplex virus type 1 thymidine kinase and firefly luciferase fusion into the adenovirus protein IX for functional display on the virion.</a> Molecular imaging. 5, 510-519 (2006).</li></ol>

Los autores no tienen nada que revelar.

La aplicación de la estrategia tradicional transgén en la modificación de Ad5 para el desarrollo de vacunas se ha disminuido debido principalmente al cuello de botella asociado con el Ad5 PEI 4,6. Este cuello de botella puede ser parcialmente disminuido por la aplicación de la estrategia de antígeno de la cápside-Incorporación (Figura 1A) alternativo, ya que esta estrategia puede evadir la neutralización por Ad5 NAbs reemplazando neutralizantes epítopos de Ad5 con antígenos de inter...

Adenovirus humano (Ad) es un virus de tamaño medio sin envoltura con una nucleocápside icosaédrica que contiene un genoma de ADN de cadena doble. Ad pertenece a la familia Adenoviridae, con una clasificación en siete grupos (A a G). Cada grupo contiene virus de diferentes serotipos. De los cuales, adenovirus serotipo 5 (Ad5) del grupo C ha sido el más estudiado y el que más se aplica para los enfoques vectored como la terapia génica y vacunas. La estrategia transgén tradicional ha sido desarrollado y aplicado para las modificaciones de Ad5, que se caracteriza por el desplazamiento de los genes tempranos de virus con un gen de interés, y la expresión del gen de centrado de intereses en un huésped. Ejemplos de ello son la construcción de pENV9 / Ad5hrΔE3 mediante la sustitución de gen temprano 3 (E3) con el gen rev de Simian Virus de Inmunodeficiencia 1, la construcción de AdCMVGag mediante la sustitución de gen temprano 1 (E1) con el gen gag de la Inmunodeficiencia HumanaVirus (HIV) 2, y la construcción de Ad lac Z mediante la sustitución de E1 con lac Z gen 3. La amplia aplicación de la estrategia tradicional transgén en Ad5 depende de los siguientes méritos: la amplia gama de anfitriones para Ad5, la factible ingeniería gen en el virus y la propagación de virus, la gran alojamiento de inserto de gen extraño y la seguridad de Ad5 4,5. Sin embargo, los reducidos eficacias de terapias clínicas vectored-Ad5 por el uso de esta estrategia ha sido un importante cuello de botella, que ha sido asignada para ser asociado principalmente con Ad5 PEI, ya Ad5 es tan frecuente entre la mayoría de los niños y los adultos 4,6. Para superar el principal cuello de botella de Ad5, el objetivo principal es el desarrollo de una estrategia alternativa eludir Ad5 PEI. La inmunidad innata 7, la inmunidad adaptativa, tales como anticuerpos neutralizantes (NABS), 8-10 y T CD8 + respuestas de las células 10 contra Ad5 se ha demostrado que contribute al Ad5 PEI, con Ad5 NAbs apareciendo a desempeñar el papel dominante en las contribuciones al Ad5 PEI 10,11. Por otra parte, Ad5 Nabs epítopos objetivo situadas en proteínas de la cápside, incluidos el principal hexón proteínas, fibra y base de pentón. De los cuales, hexón es el objetivo principal de Ad5 NAbs 8,11-13. Basándose en estos hallazgos, una innovadora estrategia de antígeno de la cápside-Incorporación se ha introducido. Esta nueva estrategia destaca la sustitución o incorporación de proteínas de intereses en las proteínas de la cápside Ad5, que desplaza o máscaras de los epítopos neutralizantes Ad5, que conduce a la disminución de reconocimiento por parte de las administraciones y NAbs vector Ad5 eficientes. Es de destacar que esta estrategia es competitivo ya que también puede ayudar a hosts provocar inmunidad humoral y la inmunidad celular robusto potente mediante la presentación de antígenos directamente-de-interés para el sistema inmune 4,14,15. Basado en esta estrategia, la clonación molecular y rescate Ad vector viral recombinante se pueden dividir estructuralmenteen cuatro pasos principales: (a) la preparación de fragmento de gen de interés ya sea por reacción en cadena de la polimerasa (PCR) o síntesis; (B) la ligación de fragmento de gen en un plásmido lanzadera que contiene el fragmento del gen de interés y los brazos homólogas a una cadena principal de adenovirus; (C) la recombinación homóloga por la co-transformación del plásmido lanzadera que contiene el fragmento del gen de intereses con el plásmido linealizado backbone pAd5 / ΔH5 (GL) 16; (D) la transfección de plásmido linealizado adenoviral recombinante para rescatar el vector Ad recombinante constituida con antígenos de intereses. Nuestro grupo y algunos otros han extendido esta estrategia de incorporación de anuncio alternativo para Ad desarrollo de la vacuna vectorizada contra diferentes agentes patógenos infecciosos. Nos informó la generación de un vector recombinante Ad Ad-HVR1-LGS-Su 6 -V3 incorporando un Su-etiquetados VIH-1 antígeno V3 en la configuración regional HVR1 de Ad5 hexón (hexon5). Este vector generado desencadena strong respuesta inmune humoral específica para el epítopo V3 4. También informó el desarrollo de Ad5 / HVR2-MPER-L15ΔE1 incorporando el VIH-1 membrana región ectodominio proximal (MPER) en la configuración regional HVR2 de hexon5 2. Además, el grupo del Dr. Zhou ha utilizado los beneficios de esta estrategia de incorporación Ad desarrollar Ad serotipo 3 (Ad3) vacunas vectorizadas, es decir., La generación de vectores R1SP70A3 viral mediante la incorporación de un SP70 epítopo neutralizante de Enterovirus 71 en el HVR1 de Ad3 hexon (hexon3). R1SP70A3 generado NAbs fuertes y la producción de IFN-γ específicas para el epítopo SP70, que conducen a la alta tasa de protección contra Enterovirus 71 15 desafío. A los efectos de referencia técnica, nuestro estudio se aprovechó de la estrategia de antígeno de la cápside-Incorporación cualitativa para centrarse en la generación de un vector Ad5 divalente Ad5 / H5-HVR1-Kwas-HVR5-Su 6 mediante la incorporación de un antígeno del VIH-1 en HVR1 unda His en HVR5 de hexon5. El vector viral también fue generada inmunológicamente evaluado. La estrategia de antígeno de la cápside-Incorporación podría ser utilizado para el desarrollo de enfoques de vacunación vectored-Ad5 contra diferentes enfermedades infecciosas.

<table border="0" cellpadding="0" cellspacing="0">
	<tbody>
		<tr>
			<td>1x DPBS</td>
			<td>Thermo Scientific</td>
			<td>SH30256.01</td>
			<td>for cell spliting&#160;</td>
		</tr>
		<tr>
			<td>10x DPBS</td>
			<td>Thermo Scientific</td>
			<td>SH30378.02</td>
			<td>for dialysis buffer preparation</td>
		</tr>
		<tr>
			<td>glycerol</td>
			<td>SIGMA</td>
			<td>G5516-1L</td>
			<td>for dialysis buffer preparation</td>
		</tr>
		<tr>
			<td>SDS</td>
			<td>BIO-RAD</td>
			<td>161-0301</td>
			<td>for virus lysis buffer preparation</td>
		</tr>
		<tr>
			<td>Fetal Bovine Serum (FBS)</td>
			<td>Thermo Scientific</td>
			<td>SH30910.03</td>
			<td>component of culture medium</td>
		</tr>
		<tr>
			<td>100X Non-Essential Amino Acids&#160;</td>
			<td>Thermo Scientific</td>
			<td>SH30238.01</td>
			<td>component of culture medium</td>
		</tr>
		<tr>
			<td>200mM/L L-glutamine</td>
			<td>Cellgro</td>
			<td>25-005-CI</td>
			<td>component of culture medium</td>
		</tr>
		<tr>
			<td>penicillin/streptomycin solution&#160;</td>
			<td>Cellgro</td>
			<td>30-002-CI</td>
			<td>component of culture medium</td>
		</tr>
		<tr>
			<td>DMEM with high glucose</td>
			<td>Thermo Scientific</td>
			<td>SH30081.01</td>
			<td>for HEK293 cell culture</td>
		</tr>
		<tr>
			<td>Minimum Essential Medium Eagle</td>
			<td>SIGMA</td>
			<td>M5650</td>
			<td>for HeLa cell culture</td>
		</tr>
		<tr>
			<td>phenol:chloroform:isoamyl alcohol&#160;</td>
			<td>SIGMA</td>
			<td>P3803-100ML</td>
			<td>for large size of DNA purification</td>
		</tr>
		<tr>
			<td>cesium chloride&#160;</td>
			<td>Research Products International Corp.</td>
			<td>C68050</td>
			<td>for virus purificiation</td>
		</tr>
		<tr>
			<td>HEPES</td>
			<td>Cellgro</td>
			<td>25-060-CI</td>
			<td>for CsCl solution preparation</td>
		</tr>
		<tr>
			<td>HEK293</td>
			<td>ATCC</td>
			<td>51-0036</td>
			<td>for virus rescue and upscale</td>
		</tr>
		<tr>
			<td>HeLa</td>
			<td>ATCC</td>
			<td>CCL-2</td>
			<td>for neutralization assay</td>
		</tr>
		<tr>
			<td>T-25 flask</td>
			<td>Thermo Scientific</td>
			<td>156367</td>
			<td>for cell culture&#160;</td>
		</tr>
		<tr>
			<td>T-75 flask</td>
			<td>CORNING</td>
			<td>430641</td>
			<td>for cell culture&#160;</td>
		</tr>
		<tr>
			<td>T-175 flask</td>
			<td>Thermo Scientific</td>
			<td>159910</td>
			<td>for cell culture&#160;</td>
		</tr>
		<tr>
			<td>Ultracentrifuge</td>
			<td>BECKMAN</td>
			<td>NA</td>
			<td>for virus purification</td>
		</tr>
		<tr>
			<td>Ultracentrifuge tube</td>
			<td>BECKMAN</td>
			<td>344059</td>
			<td>for virus purification</td>
		</tr>
		<tr>
			<td>dialysis cassette&#160;</td>
			<td>Thermo Scientific</td>
			<td>66380</td>
			<td>for virus dialysis</td>
		</tr>
		<tr>
			<td>ELISA plate</td>
			<td>Thermo Scientific</td>
			<td>442404</td>
			<td>for ELISA</td>
		</tr>
		<tr>
			<td>human anti-gp41 (2F5) mAb</td>
			<td>NIH AIDS Reagent Program</td>
			<td>1475</td>
			<td>for immunological assays</td>
		</tr>
		<tr>
			<td>mouse anti-His tag mAb</td>
			<td>GenScript</td>
			<td>A00186</td>
			<td>for immunological assays</td>
		</tr>
		<tr>
			<td>SOC medium</td>
			<td>CORNING</td>
			<td>46-003-CR</td>
			<td>for transformation</td>
		</tr>
		<tr>
			<td>PCR master mix solution</td>
			<td>QIAGEN</td>
			<td>201445</td>
			<td>for PCR</td>
		</tr>
		<tr>
			<td>Animal lancet (point length at 5mm)</td>
			<td>MEDIpoint</td>
			<td></td>
			<td>for mice bleeding&#160;</td>
		</tr>
		<tr>
			<td>Biophotometer</td>
			<td>Eppendorf</td>
			<td></td>
			<td>for virus physical titer titration</td>
		</tr>
	</tbody>
</table>

utilizing the antigen capsid-incorporation strategy for the development of adenovirus serotype 5-vectored vaccine approaches

Adenovirus de serotipo 5 (Ad5) ha sido ampliamente modificado con métodos tradicionales de transgén para el desarrollo de vacunas. Las eficacias reducidas de estos vectores Ad5 tradicionalmente modificados en los ensayos clínicos podrían ser correlacionados principalmente con Ad5 inmunidad pre-existente (PEI) entre la mayoría de la población. Promover el desarrollo de vacunas Ad5-vectored resolviendo la preocupación de Ad5 PEI, la innovadora estrategia de antígeno de la cápside-Incorporación se ha empleado. Por mérito de esta estrategia, Ad5 vectored-que primero construyó el transbordador hexón plásmido HVR1-Sus Kwas-HVR5-6 / pH5S subclonando la región hipervariable (HVR) 1 de hexón en un plásmido lanzadera previamente construido HVR5-His 6 / pH5S, que tenía Su etiqueta 6 incorporado en el HVR5. Se sintetizó Este fragmento de ADN que contiene un epítopo de HVR1 ELDKWAS VIH. 6 / pH5S Sus HVR1-Kwas-HVR5-Fue entonces linealizado y co-transformada con el plásmido linealizado backbone pAd5 / ΔH5 (GL),para la recombinación homóloga. Este plásmido recombinado pAd5 / H5-HVR1-Kwas-HVR5 6-His se transfectó en células para generar el vector viral Ad5 / H5-HVR1-Kwas-HVR5 6-His. Este vector fue validado para tener la aptitud cualitativa indica viral título física (VP / ml), título infeccioso (IP / ml) y la correspondiente relación / IP VP. Tanto el epítopo VIH y His 6 estaban en la cápside Ad5 expuesto en la superficie, y retenidos antigenicidad epítopo específico de los suyos. Un ensayo de neutralización indica la capacidad de este vector divalente para eludir la neutralización por sueros Ad5-positivo in vitro. Inmunización ratones demostró la generación de robusta inmunidad humoral específica al epítopo de VIH y su 6. Este estudio de prueba de principio sugirió que el protocolo asociado con la estrategia de antígeno de la cápside-Incorporación podría ser factible utilizar para la generación de vacunas vectorizadas-Ad5 mediante la modificación de diferentes proteínas de la cápside. Este protocolo podría incluso ser fás modificado para la generación de vacunas de adenovirus-vectorizada raras serotipo.

La estrategia de antígeno de la cápside-Incorporación (Figura 1A) se utilizó para generar el vector viral divalente Ad5 Ad5 / H5-HVR1-Kwas-HVR5 6-His. En primer lugar, el servicio de transporte plásmido HVR1-Kwas-HVR5-Su 6 / pH5S se construyó subclonando fragmento HVR1-Kwas en el anterior plásmido lanzadera construida HVR5-Su 6 / pH5S 17. En segundo lugar, el plásmido pAd5 / H5-HVR1-Kwas-HVR5-His 6 14 fue construido por una recomb...

Watch this Scientific Journal Video about Utilizing the Antigen Capsid-Incorporation Strategy for the Development of Adenovirus Serotype 5-Vectored Vaccine Approaches at JoVE.com

Utilizing the Antigen Capsid-Incorporation Strategy for the Development of Adenovirus Serotype 5-Vectored Vaccine Approaches

A continuación, presentamos un protocolo para generar un adenovirus divalente tipo 5 (Ad5) vectores de prueba de principio Ad5 / H5-HVR1-Kwas-HVR5-Su 6 mediante la utilización de la estrategia de antígeno de la cápside-Incorporación. Este vector se demostró la aptitud para exhibir cualitativa, la capacidad de escapar de sueros Ad5-positivo in vitro, y la antigenicidad, así como la inmunogenicidad de los antígenos incorporados.

La utilización de la Estrategia de la cápside-Incorporación Antigen para el desarrollo de enfoques adenovirus serotipo 5-Vectored de vacunas

Adenovirus serotype 5 (Ad5) has been extensively modified with traditional transgene methods for the vaccine development. The reduced efficacies of these ...

utilizing-antigen-capsid-incorporation-strategy-for-development

Research

JoVE Journal

Immunology and Infection

10.3K vistas.  University of Alabama at Birmingham.  A continuación, presentamos un protocolo para generar un adenovirus divalente tipo 5 (Ad5) vectores de prueba de principio Ad5 / H5-HVR1-Kwas-HVR5-Su 6 mediante la utilización de la estrategia de antígeno de la cápside-Incorporación. Este vector se demostró la aptitud para exhibir cualitativa, la capacidad de escapar de sueros Ad5-positivo in vitro, y la antigenicidad, así como la inmunogenicidad de los antígenos incorporados. 

Video: Utilizing the Antigen Capsid-Incorporation Strategy for the Development of Adenovirus Serotype 5-Vectored Vaccine Approaches

Efficient Recombinant Parvovirus Production with the Help of Adenovirus-derived Systems

Rodent parvoviruses (PV) such as rat H-1PV and MVM, are small icosahedral, single stranded, DNA viruses. Their genome includes two promoters P4 and P38 which regulate the expression of non-structural (NS1 and NS2) and capsid proteins (VP1 and VP2) respectively1. They attract high interest as anticancer agents for their oncolytic and oncosuppressive abilities while being non-pathogenic for humans2. NS1 is the major effector of viral cytotoxicity3. In order to further enhance their natural antineoplastic activities, derivatives from these vectors have been generated by replacing the gene encoding for the capsid proteins with a therapeutic transgene (e.g. a cytotoxic polypeptide, cytokine, chemokine, tumour suppressor gene etc.)4. The recombinant parvoviruses (recPVs) vector retains the NS1/2 coding sequences and the PV genome telomeres which are necessary for viral DNA amplification and packaging. Production of recPVs occurs only in the producer cells (generally HEK293T), by co-transfecting the cells with a second vector (pCMV-VP) expressing the gene encoding for the VP proteins (Fig. 1)4. The recPV vectors generated in this way are replication defective. Although recPVs proved to possess enhanced oncotoxic activities with respect to the parental viruses from which they have been generated, their production remains a major challenge and strongly hampers the use of these agents in anti-cancer clinical applications.
We found that introduction of an Ad-5 derived vector containing the E2a, E4(orf6) and the VA RNA genes (e.g. pXX6 plasmid) into HEK293T improved the production of recPVs by more than 10 fold in comparison to other protocols in use. Based on this finding, we have constructed a novel Ad-VP-helper that contains the genomic adenoviral elements necessary to enhance recPVs production as well as the parvovirus VP gene unit5. The use of Ad-VP-helper, allows production of rec-PVs using a protocol that relies entirely on viral infection steps (as opposed to plasmid transfection), making possible the use of cell lines that are difficult to transfect (e.g. NB324K) (Fig. 2). We present a method that greatly improves the amount of recombinant virus produced, reducing both the production time and costs, without affecting the quality of the final product5. In addition, large scale production of recPV (in suspension cells and bioreactors) is now conceivable.

Here we describe a protocol based only on cell infection, which improves the efficiency of recombinant parvovirus production by more than 100 fold in comparison to other protocols in use. This protocol relies on the use of a novel adenovirus 5-based helper containing the parvovirus VP transcription unit (Ad-VP).

Producción eficiente de parvovirus recombinante con la ayuda de derivados de adenovirus-Systems

Rodent parvoviruses (PV) such as rat H-1PV and MVM, are small icosahedral, single stranded, DNA viruses. Their genome includes two promoters P4 and P38 ...

Investigación

Inmunología e Infección

Generation of Recombinant Arenavirus for Vaccine Development in FDA-Approved Vero Cells

The development and implementation of arenavirus reverse genetics represents a significant breakthrough in the arenavirus field 4. The use of cell-based arenavirus minigenome systems together with the ability to generate recombinant infectious arenaviruses with predetermined mutations in their genomes has facilitated the investigation of the contribution of viral determinants to the different steps of the arenavirus life cycle, as well as virus-host interactions and mechanisms of arenavirus pathogenesis 1, 3, 11 . In addition, the development of trisegmented arenaviruses has permitted the use of the arenavirus genome to express additional foreign genes of interest, thus opening the possibility of arenavirus-based vaccine vector applications 5 . Likewise, the development of single-cycle infectious arenaviruses capable of expressing reporter genes provides a new experimental tool to improve the safety of research involving highly pathogenic human arenaviruses 16 . The generation of recombinant arenaviruses using plasmid-based reverse genetics techniques has so far relied on the use of rodent cell lines 7,19 , which poses some barriers for the development of Food and Drug Administration (FDA)-licensed vaccine or vaccine vectors. To overcome this obstacle, we describe here the efficient generation of recombinant arenaviruses in FDA-approved Vero cells.

Rescue of recombinant arenaviruses from cloned cDNAs, an approach referred to as reverse genetics, allows researchers to investigate the role of specific viral gene products, as well as the contribution of their different specific domains and residues, to many different aspects of the biology of arenavirus. Likewise, reverse genetics techniques in FDA-approved cell lines (Vero) for vaccine development provides novel possibilities for the generation of effective and safe vaccines to combat human pathogenic arenaviruses.

Generación de Arenavirus recombinante para el Desarrollo de Vacunas de la FDA aprobados células Vero

The development and implementation of arenavirus reverse genetics represents a significant breakthrough in the arenavirus field  4. The use of cell-based ...

Using Click Chemistry to Measure the Effect of Viral Infection on Host-Cell RNA Synthesis

Many RNA viruses have evolved the ability to inhibit host cell transcription as a means to circumvent cellular defenses. For the study of these viruses, it is therefore important to have a quick and reliable way of measuring transcriptional activity in infected cells. Traditionally, transcription has been measured either by incorporation of radioactive nucleosides such as 3H-uridine followed by detection via autoradiography or scintillation counting, or incorporation of halogenated uridine analogs such as 5-bromouridine (BrU) followed by detection via immunostaining. The use of radioactive isotopes, however, requires specialized equipment and is not feasible in a number of laboratory settings, while the detection of BrU can be cumbersome and may suffer from low sensitivity.
The recently developed click chemistry, which involves a copper-catalyzed triazole formation from an azide and an alkyne, now provides a rapid and highly sensitive alternative to these two methods. Click chemistry is a two step process in which nascent RNA is first labeled by incorporation of the uridine analog 5-ethynyluridine (EU), followed by detection of the label with a fluorescent azide. These azides are available as several different fluorophores, allowing for a wide range of options for visualization.
This protocol describes a method to measure transcriptional suppression in cells infected with the Rift Valley fever virus (RVFV) strain MP-12 using click chemistry. Concurrently, expression of viral proteins in these cells is determined by classical intracellular immunostaining. Steps 1 through 4 detail a method to visualize transcriptional suppression via fluorescence microscopy, while steps 5 through 8 detail a method to quantify transcriptional suppression via flow cytometry. This protocol is easily adaptable for use with other viruses.

This method describes the use of click chemistry to measure changes in host cell transcription after infection with the Rift Valley fever virus (RVFV) strain MP-12. Results can be visualized qualitatively via fluorescence microscopy or obtained quantitatively through flow cytometry. This method is adaptable for use with other viruses.

Usando Click Química para medir el efecto de la infección viral en el Host-Cell ARN Síntesis

Many RNA viruses have evolved the ability to inhibit host cell transcription as a means to circumvent cellular defenses. For the study of these viruses, ...

In Vitro Analysis of Myd88-mediated Cellular Immune Response to West Nile Virus Mutant Strain Infection

An attenuated West Nile virus (WNV), a nonstructural (NS) 4B-P38G mutant, induced higher innate cytokine and T cell responses than the wild-type WNV in mice. Recently, myeloid differentiation factor 88 (MyD88) signaling was shown to be important for initial T cell priming and memory T cell development during WNV NS4B-P38G mutant infection. In this study, two flow cytometry-based methods &#8211; an in vitro T cell priming assay and an intracellular cytokine staining (ICS) &#8211; were utilized to assess dendritic cells (DCs) and T cell functions. In the T cell priming assay, cell proliferation was analyzed by flow cytometry following co-culture of DCs from both groups of mice with carboxyfluorescein succinimidyl ester (CFSE) - labeled CD4+ T cells of OTII transgenic mice. This approach provided an accurate determination of the percentage of proliferating CD4+ T cells with significantly improved overall sensitivity than the traditional assays with radioactive reagents. A microcentrifuge tube system was used in both cell culture and cytokine staining procedures of the ICS protocol. Compared to the traditional tissue culture plate-based system, this modified procedure was easier to perform at biosafety level (BL) 3 facilities. Moreover, WNV- infected cells were treated with paraformaldehyde in both assays, which enabled further analysis outside BL3 facilities. Overall, these in vitro immunological assays can be used to efficiently assess cell-mediated immune responses during WNV infection.

In Vitro Analysis of Myd88-mediated Cellular Immune Response to West Nile Virus Mutant Strain Infection

Two flow cytometry-based methods &#8211; an in vitro T cell priming assay and intracellular cytokine staining were utilized to measure antigen presenting capacity of dendritic cells and antigen-specific T cell responses to a West Nile virus mutant infection in mice.

El análisis in vitro de la respuesta inmune celular Myd88 mediada por el Virus del Nilo Occidental cepa mutante Infección

An attenuated West Nile virus (WNV), a nonstructural (NS) 4B-P38G mutant, induced higher innate cytokine and T cell responses than the wild-type WNV in ...

Detection of Human Leukocyte Antigen Biomarkers in Breast Cancer Utilizing Label-free Biosensor Technology

According to the American Cancer Society, more than 200,000 women will be diagnosed with invasive breast cancer each year and approximately 40,000 will die from the disease. The human leukocyte antigen (HLA) class I samples peptides derived from proteasomal degradation of cellular proteins and presents these fragments on the cell surface for interrogation by circulating cytotoxic T lymphocytes (CTL). Generation of T-cell receptor mimic (TCRm) monoclonal antibodies (mAbs) which recognize breast cancer specific peptide/HLA-A*02:01 complexes such as those derived from macrophage migration inhibitory factor (MIF19-27) and NY-ESO-1157-165 enable detection and destruction of breast cancer cells in the absence of an effective anti-tumor CTL response. Intact class I HLA/peptide complexes are shed by breast cancer cells and represent potentially relevant cancer biomarkers. In this work, a breakthrough biomarker screening system for cancer diagnostics incorporating T-cell receptor mimic monoclonal antibodies combined with a novel, label-free biosensor utilizing guided-mode resonance (GMR) sensor technology is presented. Detection of shed MIF/HLA-A*02:01 complexes in MDA-MB-231 cell supernatants, spiked human serum, and patient plasma is demonstrated. The impact of this work could revolutionize personalized medicine through development of companion disease diagnostics for targeted immunotherapies.

Intact class I HLA/peptide complexes are shed by cancer cells, representing a potential relevant cancer biomarker. Utilizing label-free sensor technology and T-cell receptor mimicking monoclonal antibodies, detection of shed MIF/HLA-A*02:01 complexes in MDA-MB-231 cell supernatants, spiked human serum, and patient plasma is demonstrated, enabling development of a novel cancer diagnostic platform.

La detección del antígeno leucocitario humano biomarcadores en cáncer de mama Utilizando-Label gratuita tecnología de biosensores

According to the American Cancer Society, more than 200,000 women will be diagnosed with invasive breast cancer each year and approximately 40,000 will ...

Development of an in vitro model system for studying the interaction of Equus caballus IgE with its high-affinity receptor Fc&#949;RI

The interaction of IgE with its high-affinity Fc receptor (Fc&#949;RI) followed by an antigenic challenge is the principal pathway in IgE mediated allergic reactions. As a consequence of the high affinity binding between IgE and Fc&#949;RI, along with the continuous production of IgE by B cells, allergies usually persist throughout life, with currently no permanent cure available. Horses, especially race horses, which are commonly inbred, are a species of mammals that are very prone to the development of hypersensitivity responses, which can seriously affect their performance. Physiological responses to allergic sensitization in horses mirror that observed in humans and dogs. In this paper we describe the development of an in situ assay system for the quantitative assessment of the release of mediators of the allergic response pertaining to the equine system. To this end, the gene encoding equine Fc&#949;RI&#945; was transfected into and expressed onto the surface of parental Rat Basophil Leukemia (RBL-2H3.1) cells. The gene product of the transfected equine &#945;-chain formed a functional receptor complex with the endogenous rat &#946;- and &#947;-chains 1. The resultant assay system facilitated an assessment of the quantity of mediator secreted from equine Fc&#949;RI&#945; transfected RBL-2H3.1 cells following sensitization with equine IgE and antigenic challenge using &#946;-hexosaminidase release as a readout 2, 3. Mediator release peaked at 36.68% &#177; 4.88% at 100 ng ml-1 of antigen. This assay was modified from previous assays used to study human and canine allergic responses 4, 5. We have also shown that this type of assay system has multiple applications for the development of diagnostic tools and the safety assessment of potential therapeutic intervention strategies in allergic disease 6, 2, 3.

Development of an &lt;em&gt;in vitro&lt;/em&gt; model system for studying the interaction of &lt;em&gt;Equus&lt;/em&gt; &lt;em&gt;caballus&lt;/em&gt; IgE with its high-affinity receptor Fc&amp;#949;RI

The current study describes the development and applications of a genetically engineered assay system based on the transfection of rat basophilic leukemia cells with the equine Fc&#949;RI&#945; gene. Transfected cells express a functional receptor where the release of mediators of the allergic response can be activated by IgE and antigen.

Desarrollo de una<em&gt; In vitro</em&gt; Sistema modelo para estudiar la interacción de<em&gt; Equus</em&gt;<em&gt; Caballus</em&gt; IgE con su receptor de alta afinidad Fc RI

The interaction of IgE with its high-affinity Fc receptor (Fc&#949;RI) followed by an antigenic challenge is the principal pathway in IgE mediated ...

Imaging CD4 T Cell Interstitial Migration in the Inflamed Dermis

The ability of CD4 T cells to carry out effector functions is dependent upon the rapid and efficient migration of these cells in inflamed peripheral tissues through an as-yet undefined mechanism. The application of multiphoton microscopy to the study of the immune system provides a tool to measure the dynamics of immune responses within intact tissues. Here we present a protocol for non-invasive intravital multiphoton imaging of CD4 T cells in the inflamed mouse ear dermis. Use of a custom imaging platform and a venous catheter allows for the visualization of CD4 T cell dynamics in the dermal interstitium, with the ability to interrogate these cells in real-time via the addition of blocking antibodies to key molecular components involved in motility. This system provides advantages over both in vitro models and surgically invasive imaging procedures. Understanding the pathways used by CD4 T cells for motility may ultimately provide insight into the basic function of CD4 T cells as well as the pathogenesis of both autoimmune diseases and pathology from chronic infections.

The mechanisms that govern the interstitial motility of CD4 effector T cells at sites of inflammation are relatively unknown. We present a non-invasive approach to visualize and manipulate in vitro-primed CD4 T cells in the inflamed ear dermis, allowing for study of the dynamic behavior of these cells in situ.

La migración de células T CD4 obtener imágenes intersticial en la dermis inflamadas

The ability of CD4 T cells to carry out effector functions is dependent upon the rapid and efficient migration of these cells in inflamed peripheral ...

Development of Stem Cell-derived Antigen-specific Regulatory T Cells Against Autoimmunity

Autoimmune diseases arise due to the loss of immunological self-tolerance. Regulatory T cells (Tregs) are important mediators of immunologic self-tolerance. Tregs represent about 5 - 10% of the mature CD4+ T cell subpopulation in mice and humans, with about 1 - 2% of those Tregs circulating in the peripheral blood. Induced pluripotent stem cells (iPSCs) can be differentiated into functional Tregs, which have a potential to be used for cell-based therapies of autoimmune diseases. Here, we present a method to develop antigen (Ag)-specific Tregs from iPSCs (i.e., iPSC-Tregs). The method is based on incorporating the transcription factor FoxP3 and an Ag-specific T cell receptor (TCR) into iPSCs and then differentiating on OP9 stromal cells expressing Notch ligands delta-like (DL) 1 and DL4. Following in vitro differentiation, the iPSC-Tregs express CD4, CD8, CD3, CD25, FoxP3, and Ag-specific TCR and are able to respond to Ag stimulation. This method has been successfully applied to cell-based therapy of autoimmune arthritis in a murine model. Adoptive transfer of these Ag-specific iPSC-Tregs into Ag-induced arthritis (AIA)-bearing mice has the ability to reduce joint inflammation and swelling and to prevent bone loss.

We present here a method to develop functional antigen (Ag)-specific regulatory T cells (Tregs) from induced pluripotent stem cells (iPSCs) for immunotherapy of autoimmune arthritis in a murine model.

Desarrollo de derivados de células madre Las células T reguladoras específicas de antígeno contra la autoinmunidad

Autoimmune diseases arise due to the loss of immunological self-tolerance. Regulatory T cells (Tregs) are important mediators of immunologic ...

Evaluation of Host-Pathogen Responses and Vaccine Efficacy in Mice

Vaccines are a 20th century medical marvel. They have dramatically reduced the morbidity and mortality caused by infectious diseases and contributed to a striking increase in life expectancy around the globe. Nonetheless, determining vaccine efficacy remains a challenge. Emerging evidence suggests that the current acellular vaccine (aPV) for Bordetella pertussis (B. pertussis) induces suboptimal immunity. Therefore, a major challenge is designing a next-generation vaccine that induces protective immunity without the adverse side effects of a whole-cell vaccine (wPV). Here we describe a protocol that we used to test the efficacy of a promising, novel adjuvant that skews immune responses to a protective Th1/Th17 phenotype and promotes a better clearance of a B. pertussis challenge from the murine respiratory tract. This article describes the protocol for mouse immunization, bacterial inoculation, tissue harvesting, and analysis of immune responses. Using this method, within our model, we have successfully elucidated crucial mechanisms elicited by a promising, next-generation acellular pertussis vaccine. This method can be applied to any infectious disease model in order to determine vaccine efficacy.

Here we present an elegant protocol for in vivo evaluation of vaccine effectiveness and host immune responses. This protocol can be adapted for vaccine models that study viral, bacterial, or parasitic pathogens.

Evaluación de las respuestas del huésped-patógeno y eficacia de la vacuna en ratones

Vaccines are a 20th century medical marvel. They have dramatically reduced the morbidity and mortality caused by infectious diseases and contributed to a ...

Use of an Influenza Antigen Microarray to Measure the Breadth of Serum Antibodies Across Virus Subtypes

The influenza virus remains a significant cause of mortality worldwide due to the limited effectiveness of currently available vaccines. A key challenge to the development of universal influenza vaccines is high antigenic diversity resulting from antigenic drift. Overcoming this challenge requires novel research tools to measure the breadth of serum antibodies directed against many virus strains across different antigenic subtypes. Here, we present a protocol for analyzing the breadth of serum antibodies against diverse influenza virus strains using a protein microarray of influenza antigens.
This influenza antigen microarray is constructed by printing purified hemagglutinin and neuraminidase antigens onto a nitrocellulose-coated membrane using a microarray printer. Human sera are incubated on the microarray to bind antibodies against the influenza antigens. Quantum-dot-conjugated secondary antibodies are used to simultaneously detect IgG and IgA antibodies binding to each antigen on the microarray. Quantitative antibody binding is measured as fluorescence intensity using a portable imager. Representative results are shown to demonstrate assay reproducibility in measuring subtype-specific and cross-reactive influenza antibodies in human sera.
Compared to traditional methods such as ELISA, the influenza antigen microarray provides a high throughput multiplexed approach capable of testing hundreds of sera for multiple antibody isotypes against hundreds of antigens in a short time frame, and thus has applications in sero-surveillance and vaccine development. A limitation is the inability to distinguish binding antibodies from neutralizing antibodies.

We present a protocol for using a protein microarray constructed by printing influenza antigens onto nitrocellulose-coated slides to simultaneously probe serum for multiple antibody isotypes against over 250 antigens from different virus strains, thus allowing measurement of the breadth of serum antibodies across virus subtypes.

Uso de un microarreglo antigonagen antigripal para medir la amplitud de los anticuerpos séricos a través de los subtipos de virus

The influenza virus remains a significant cause of mortality worldwide due to the limited effectiveness of currently available vaccines. A key challenge ...