Ce travail a été financé en partie par les Instituts nationaux de la Santé accorde 5T32AI7493-20 et 5R01AI089337-03. Les bailleurs de fonds ne jouaient aucun rôle dans la conception de l&#39;étude, la collecte et l&#39;analyse des données, la décision de publier, ou de la préparation du manuscrit.

L&#39;Université de l&#39;Alabama à Birmingham Comité soins en établissement et l&#39;utilisation des animaux a approuvé l&#39;utilisation de souris comme décrit ici sous le numéro 101 109 272 protocole approuvé. 1. Construction d&#39;une modification génétique plasmide PAD5 / H5-HVR1-Kwas-HVR5-His 6 avec la stratégie capside-Incorporation Antigène <ol><li> Construction du plasmide navette HVR1-Kwas HVR5-6-His / pH5S <ol><li> Commander un plasmide contenant la séquence d&#39;ADN synthétisée HVR1-Kwas entre les sites d&#39;enzymes de restriction Agel à AccI de gène hexon5. </li><li> Digest 6 pg du fragment synthétisé (HVR1-Kwas) avec l&#39;enzymes Agel (6 unités) et AccI (6 unités) pendant 3 heures à 37 ° C. Résoudre le fragment digéré dans un gel d&#39;agarose à 2% par électrophorèse, et on purifie le fragment avec un kit d&#39;extraction de gel d&#39;ADN selon le protocole du fabricant. </li><li> Sur la base du rapport molaire de l&#39;insert au vecteur de 3: 1, en utilisant l&#39;ADN ligase T4 ligase et buffer à ligaturer 12 ng du fragment (HVR1-Kwas) dans 100 ng d&#39;un plasmide navette précédemment construit HVR5-His 6 / pH5S 17 dans un volume de 10 ul à la température ambiante pendant 2 h, via les sites AccI et de Agel. </li><li> Transformer une pi sur 10 pi du produit de ligature dans 50 pl de cellules DH5a électrocompétentes dans un électroporateur (à 1800 V). Ajouter 950 ul de milieu SOC à des cellules DH5a transformées et incuber le mélange pendant 1 heure à 37 ° C, avec 300 tours par minute. Étaler 100-200 ul du mélange 1 ml sur la gélose Luria-Bertani (LB) contenant de la kanamycine et incuber O / N à 37 ° C. <ol><li> À l&#39;écran ~ 10 colonies par PCR ciblant le fragment HVR1-Kwas, mélanger l&#39;amorce avant (TATGTGTGTCATGTATGCGT), amorce inverse (GGAGGCCCACTTGTCCAGCTC) et une seule colonie DH5a dans une solution de mélange maître PCR (selon le protocole du fabricant). Exécutez des échantillons sur un thermocycleur en se référant au manuel fourni avec la solution PCR mix master. </li><li> Utilisez l&#39;amorce avant (TATGTGTGTCATGTATGCGT) pour séquencer le fragment HVR1-Kwas dans les clones sélectionnés dans la section 1.1.4.1. </li></ol></li></ol></li><li> Construction du plasmide PAD5 / H5-HVR1-Kwas-6-His HVR5 <ol><li> Digest 6 ug de HVR1-Kwas-HVR5-His 6 / pH5S avec les enzymes EcoRI (6 unités) et Pmel (6 unités) pendant 3 heures à 37 ° C, et on purifie le fragment contenant les bras de recombinaison homologue et le gène hexon5 double modifié, comme indiqué dans l&#39;étape 1.1.2. Linéariser l&#39;épine dorsale plasmide PAD5 / ΔH5 (GL) 16 avec SwaI. </li><li> Co-transformation de 100 ng du fragment cible à partir du plasmide navette et 100 ng de l&#39;épine dorsale linéarisé PAD5 / ΔH5 (GL) dans 50 ul de cellules électrocompétentes BJ5183 pour la recombinaison homologue dans un électroporateur (à 1 800 V). Ajouter 950 ul de milieu SOC à des cellules transformées et incuber le mélange pendant 1 heure à 37 ° C, 300 tours par minute. Étaler 100 à 200 ul du mélange de 1 mlsur la gélose LB contenant de la kanamycine (finale 50 pg / ml) O / N incubation à 37 ° C. <ol><li> Choix ~ 10 petites colonies dans 3 ml de LB liquide contenant de la kanamycine (finale 50 pg / ml) O / N incubation à un agitateur (250 tours par minute, 37 ° C). Extraire les plasmides à partir de la culture. Utiliser l&#39;analyse par PCR pour cribler les 10 colonies par le fragment de ciblage HVR1-Kwas, comme illustré à l&#39;étape 1.1.4.1. </li><li> Pour dépister les mêmes colonies par analyse PCR ciblant le fragment pIX du génome de la colonne vertébrale, mélanger l&#39;amorce directe (AGCTGTTGGATCTGCGCCAGCAGGTT), amorce inverse (CCAAACAGAGTCTGGTTTTTTATTTAT) et un seul BJ5183 colonie dans une solution mix master PCR (selon le protocole du fabricant). Exécutez des échantillons sur un thermocycleur en se référant au manuel fourni avec la solution de mélange maître PCR. </li><li> Désigner les colonies double positifs PCR comme PAD5 / H5-HVR1-Kwas-HVR5-His 6. </li></ol></li><li> Transformer 100 ng du plasmide PAD5 / H5-HVR1-Kwas HVR5-6-His dansà DH5a cellules comme illustré à l&#39;étape 1.1.4. <ol><li> Utiliser l&#39;analyse par PCR pour cribler ~ 10 colonies par le fragment de ciblage HVR1-Kwas, comme illustré à l&#39;étape 1.1.4.1. </li><li> Utiliser l&#39;analyse par PCR pour cribler les mêmes colonies par le fragment de ciblage pIX du génome de la colonne vertébrale, comme illustré à l&#39;étape 1.2.2.2. </li><li> Utilisez l&#39;amorce avant (TATGTGTGTCATGTATGCGT) pour séquencer le fragment HVR1-Kwas dans PAD5 / H5-HVR1-Kwas-HVR5-His 6. </li></ol></li></ol></li></ol> 2. Préparation de modification Ad5 vecteur viral Ad5 / H5-HVR1-Kwas-HVR5-His 6 <ol><li> Constituer le milieu complet en ajoutant FBS (finale de 10%), les acides aminés 100X non essentiels (finale 0,1 mM), 200 mM de L-glutamine (finale 2 mM) et solution de pénicilline / streptomycine (finale 1%) dans DMEM avec haute teneur en glucose . Maintenir les cellules humaines embryonnaires de rein (HEK293) dans un milieu complet dans un incubateur de culture (37 ° C et 5% de CO2 dans 85% des conditions humidifié). </li><li> Sauvetage de cinq viralecteur Ad5 / H5-HVR1-Kwas-HVR5-His 6 <ol><li> Graine 3,0 x 10 6 de cellules HEK293 dans une fiole T-25 contenant 5 ml de milieu complet et la culture O / N pour obtenir une monocouche avec 80% de confluence. </li><li> 15 pg de linéariser PAD5 / H5-HVR1-Kwas-6-His HVR5 dans un volume de 100 ul avec l&#39;enzyme de restriction PacI (15 unités) à 37 ° C pendant 3 heures. <ol><li> Extrait linéarisé PAD5 / H5-HVR1-Kwas-HVR5-His 6 par centrifugation de la réaction de deux fois (10 000 g pendant 1 min) avec un volume égal de phénol: chloroforme: alcool isoamylique (rapport de 25: 24: 1) dans une hotte de laboratoire et séquentiel par centrifugation (10 000 xg pendant 10 min) avec une solution mixte (300 ul d&#39;éthanol à 100% et 10 ul d&#39;acétate de sodium) et 700 ul d&#39;éthanol à 70%. Rejeter le surnageant à chaque étape de centrifugation. </li></ol></li><li> Remettre en suspension dans le plasmide purifié ~ 40 pi d&#39;eau distillée ou du Tris-EDTA (TE) tampon. Quantifier l&#39;ADN plasmidique par la mesure de l&#39;optiquensity (DO) à 260 nm. </li><li> Transfecter 3 pg du plasmide linéarisé avec commerciale réactif de transfection liposomale dans le flacon T-25, selon le manuel du fabricant. Changer le milieu de transfection avec un milieu complet à 6 heures post-transfection et d&#39;incubation ultérieure dans l&#39;incubateur de culture. Maintenir les cellules transfectées par le remplacement du milieu complet tous les deux à trois jours, jusqu&#39;à ce que personne formulaire de plaques virales. </li><li> Lorsque les plaques se développent pour effet cytopathique complet (CPE), racler les cellules restantes au large de la fiole dans une hotte stérile, et la cellule de récolte lysat par centrifugation milieu à 300 g pendant 10 min à 4 ° C. Suspendre le culot cellulaire dans ~ 1 ml de milieu contenant 2% de FBS, et de briser les cellules par congélation-décongélation quatre fois. Recueillir le surnageant contenant le virus sauvé après centrifugation lysat à 10.000 xg pendant 10 min à 4 ° C. </li></ol></li><li> Propagation à grande échelle du vecteur viral Ad5 / H5-HVR1-Kwas-HVR5-His 6 <ol><li> Propager evirus de e dans un flacon T-75 contenant des cellules HEK293 dans la hotte stérile en infectant avec 1/3 à pleine lysat du flacon T-25. Laisser CPE complet pour développer dans les deux à trois jours dans l&#39;incubateur de culture. Récolter le surnageant de lysat comme indiqué dans l&#39;étape 2.2.5. </li><li> Propager le virus dans une à trois flacons T-175 dans la hotte stérile par infection avec 1/2 à plein lysat provenant de la fiole T-75, en fonction des conditions de propagation du virus. Laisser CPE complet pour développer dans les deux à trois jours dans l&#39;incubateur de culture. Récolter le surnageant de lysat comme indiqué dans l&#39;étape 2.2.5. </li><li> Propager le virus dans une douzaine ou plus de flacons T-175 dans la hotte stérile en infectant avec 1/2 à pleine lysat du flacon T-175 précédente (s). Calculer la somme de l&#39;utilisation de la fiole sur la base des conditions de propagation du virus et la quantité de virus dans le besoin. Récolter le surnageant de lysat comme indiqué dans l&#39;étape 2.2.5 lorsqu&#39;il est plein CPE se produit dans les deux à trois jours dans l&#39;incubateur de culture. </li></ol></li><li> Purification de Ad5 / H5-HVR1-Kwas-HVR5-His 6 par le chlorure de césium <ol><li> Préparer deux densités des solutions de CsCl à l&#39;HEPES 5 mM: 1,33 g / ml et 1,45 g / ml, tout en évitant le contact avec CsCl. </li><li> Charge 4 ml de CsCl (1,33 g / ml) dans un tube d&#39;ultracentrifugation stérile, et charger doucement 4 ml de CsCl (1,45 g / ml) contre fond du tube. Charge 4 ml de lysat surnageant lentement au-dessus des gradients dans la hotte stérile. </li><li> Centrifuger le tube à 110 000 g pendant 3 heures à 4 ° C pour séparer la bande inférieure d&#39;âge mûr / virus de la bande supérieure défectueux / virus. Recueillir la bande inférieure à l&#39;aide d&#39;une seringue de 3 ml avec une aiguille armée G 33 et la bande diluer avec 5 mM de HEPES à un volume de 4 ml dans la hotte stérile. </li><li> Charger un autre tube avec deux densités de solutions de CsCl et la bande diluée de virus comme décrit à l&#39;étape 2.4.2. Centrifuger le tube à 110 000 xg O / N à 4 ° C. Recueillir la bande virale comme décrit à l&#39;étape 2.4.3. </li><li> Injecter la solution de virus recueillis dans un Dialysest la cassette par une seringue de 3 ml armé avec une aiguille 33 G dans la hotte stérile. </li><li> Placer la cassette dans 700 ml de tampon de dialyse 1x (1 L recette: 100 ml de 10 x PBS, 100 ml de 100% de glycerol et 800 ml d&#39;eau distillée; filtrage du tampon à travers un filtre de 0,22 um) et remplacer le tampon de dialyse toutes les 3 h pour quatre fois. Aspirer la solution de virus dialysée en utilisant la seringue aiguilleté. </li></ol></li></ol> 3. Validation du vecteur viral Sauvé <ol><li> Vecteur viral titrages <ol><li> Pour le titrage physique de virus, on dilue à la fois le virus et le tampon de dialyse (contrôle d&#39;arrière-plan) à 1: 10 et 1: 20 dans du tampon de lyse par le virus (10% de SDS dans du Tris-EDTA) dans de petits tubes, et incuber les tubes à 56 ° C pendant 10 min. </li><li> Tourner sur un BioPhotometer et régler le mode de l&#39;absorbance à DO 260 nm. Utilisez le tampon de dialyse dilué (1: 10) pour équilibrer le signal de fond en cliquant sur le fond &quot;blanc&quot;. Tapez &quot;10 + 90&quot; dans le scr BioPhotometereen, et lire le signal du virus dilué (1: 10). </li><li> Lire le signal du virus dilué (1: 20) en suivant la méthode à l&#39;étape 3.1.2, mais au lieu de taper &quot;5 + 95&quot; dans l&#39;écran de BioPhotometer. Multiplier deux nombres de virus de lecture par 1.1x10 12 et calculer le titre moyen d&#39;une unité en tant que VP / ml, sur la base des deux titres individuels des deux dilutions. </li><li> Pour le titre de virus infectieux (IP / ml), utilisez le Karber DICT statistique 50 14 méthode pour déterminer la profondeur de l&#39;infection sur les cellules HEK293 après l&#39;infection de 10 jours (dpi) </li></ol></li><li> Évaluation de l&#39;affichage de l&#39;exposition antigénique sur le vecteur viral <ol><li> Enduire le vecteur viral dans une plaque ELISA et procéder avec le reste d&#39;étapes dans une méthode ELISA standard 14. Utilisation anti-gp41 (2F5) un anticorps humain monoclonal (mAb) anti-souris et marqueur His mAb pour la détection d&#39;antigènes constituées 14 correspondant. </li><li> Résoudre le vecteur viral dans un denaturouge électrophorèse sur gel de protéine (SDS-PAGE) et de procéder avec le reste d&#39;étapes dans une méthode western-blot la norme 14. Utilisation anti-gp41 (2F5) un anticorps humain monoclonal (mAb) anti-souris et marqueur His mAb pour la détection d&#39;antigènes constituées 14 correspondant. </li></ol></li><li> Dans l&#39;évaluation in vitro du vecteur sur l&#39;aptitude à contourner les sérums Ad5-positve <ol><li> Maintenir des cellules HeLa dans du milieu complet dans l&#39;incubateur de culture (37 ° C et 5% de CO 2 sous des conditions de 85% humidifié). Constituer le milieu complet en ajoutant FBS (finale de 10%), 200 mM de L-glutamine (finale 2 mM) et une solution de pénicilline / streptomycine (finale 1%) dans du milieu essentiel minimum d&#39;Eagle (MEME). </li><li> Seed cellules HeLa dans des plaques de 6 puits à 1x10 6 cellules / puits, et incuber les plaques dans l&#39;incubateur de culture (37 ° C et 5% de CO 2 moins de 85% des conditions humidifiés) pendant 2 heures. Incuber sérums Ad5-positive (0,1 pi ou 0 ul) avec 5 IP / cellule de vecteur viral (Ad5 ou Ad5 / H5-HVR1-Kwas HVR5-6-His) dans l&#39;incubateur de culture pendant 1 h avant d&#39;ajouter les mélanges sur des plaques à 6 puits contenant des cellules. </li><li> À 24 h après l&#39;infection (hpi), rinçage des cellules une fois avec du PBS et les cellules lysent dans 0,5 ml de tampon de lyse. Centrifuger à 15 000 g pendant 5 min et recueillir le surnageant. Mélanger 20 pi du surnageant avec 100 pi de substrat de la luciférase pour la lecture du signal de la luciférase, car les virus contiennent le gène de la luciférase. </li></ol></li></ol> 4. immunologique évaluation du vecteur viral Sauvé <ol><li> Préparer deux groupes de vaccination: Ad5 et Ad5 / H5-HVR1-Kwas-HVR5-His 6. <ol><li> Injecter souris (n = 8 / groupe) par voie intramusculaire avec des virus à 1x10 10 VP / souris, dans un homologue &quot;prime-boost&quot; schéma d&#39;immunisation, avec un intervalle de 2 semaines. </li><li> A 2 semaines après chaque injection, saigner souris sans anesthésie par des saignements joue avec lancettes animales (5 mm de longueur de pointe) àrecueillir le sang dans des tubes de 1,5 ml. </li></ol></li><li> Mélanger le sang dans les tubes par retournement vers le haut et vers le bas, et incuber le sang à la température ambiante pendant 30 min. Faites tourner les tubes à 10.000 g pendant 5 min à 4 ° C et les sérums de transfert (couche supérieure) à de nouveaux tubes de 1,5 ml. <ol><li> Faites tourner les nouveaux tubes à 10.000 g pendant 5 min à 4 ° C et les sérums de transfert nouvellement marqué tubes de 1,5 ml pour le stockage à -80 ° C. </li></ol></li><li> Evaluation de l&#39;immunité humorale spécifique de l&#39;antigène par ELISA basé sérums- <ol><li> Diluer Son peptide (stock à 1 mM) et le VIH-1 peptide (stock à 1 mM) séparément dans 100. </li><li> un tampon de carbonate mM (pH 9,5) pour atteindre la concentration de revêtement de peptide à 10 uM. Enrober les plaques ELISA avec les peptides dilué séparément en ajoutant 100 pi par puits et incuber les plaques O / N à 4 ° C. </li><li> Laver les plaques avec du PBST quatre fois à 200 pl / puits et le bloc pendant 1 h à 5% de BSA dans du PBST. Appliquer des sérums de souris pour les plaques à dilution 1: 100 dans le blocage buffer, 100 pl / puits. Incuber pendant 2 heures d&#39;incubation à la température ambiante. </li><li> Laver les plaques avec du PBST quatre fois. Bloquer les plaques par incubation à température ambiante pendant 30 min dans du tampon de blocage à 100 pl / puits. </li><li> Appliquer de chèvre anti-IgG de souris-HRP (1: 5000 dans le tampon de blocage) à 100 ul / puits à la fois aux plaques revêtues avec son peptide de HIV-1 et peptide individuellement. Incuber pendant 2 heures à température ambiante. Laver les plaques avec du PBST. </li><li> Lire les plaques à DO450 nm après incubation avec un substrat de HRP pendant 30 min. </li></ol></li></ol>

<ol>
	<li>Cheng, S. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Coexpression+of+the+simian+immunodeficiency+virus+Env+and+Rev+proteins+by+a+recombinant+human+adenovirus+host+range+mutant.">Coexpression of the simian immunodeficiency virus Env and Rev proteins by a recombinant human adenovirus host range mutant.</a> Journal of virology. 66, 6721-6727 (1992).</li><li>Matthews, Q. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=HIV+antigen+incorporation+within+adenovirus+hexon+hypervariable+2+for+a+novel+HIV+vaccine+approach.">HIV antigen incorporation within adenovirus hexon hypervariable 2 for a novel HIV vaccine approach.</a> PloS one. 5, e11815 (2010).</li><li>DeMatteo, R. P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Long-lasting+adenovirus+transgene+expression+in+mice+through+neonatal+intrathymic+tolerance+induction+without+the+use+of+immunosuppression.">Long-lasting adenovirus transgene expression in mice through neonatal intrathymic tolerance induction without the use of immunosuppression.</a> Journal of virology. 71, 5330-5335 (1997).</li><li>Gu, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+recombinant+adenovirus-based+vector+elicits+a+specific+humoral+immune+response+against+the+V3+loop+of+HIV-1+gp120+in+mice+through+the+'Antigen+Capsid-Incorporation'+strategy.">A recombinant adenovirus-based vector elicits a specific humoral immune response against the V3 loop of HIV-1 gp120 in mice through the 'Antigen Capsid-Incorporation' strategy.</a> Virology journal. 11, 112 (2014).</li><li>Matthews, Q. L., Krendelchtchikov, A. L. G., Li, Z. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Viral+Vectors+for+Vaccine+Development.">Viral Vectors for Vaccine Development.</a> INTECH. , (2013).</li><li>Tang, D. C., Zhang, J., Toro, H., Shi, Z., Van Kampen, K. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Adenovirus+as+a+carrier+for+the+development+of+influenza+virus-free+avian+influenza+vaccines.">Adenovirus as a carrier for the development of influenza virus-free avian influenza vaccines.</a> Expert review of vaccines. 8, 469-481 (2009).</li><li>Flatt, J. W., Kim, R., Smith, J. G., Nemerow, G. R., Stewart, P. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+intrinsically+disordered+region+of+the+adenovirus+capsid+is+implicated+in+neutralization+by+human+alpha+defensin+5.">An intrinsically disordered region of the adenovirus capsid is implicated in neutralization by human alpha defensin 5.</a> PloS one. 8, e61571 (2013).</li><li>Bradley, R. R., Lynch, D. M., Iampietro, M. J., Borducchi, E. N., Barouch, D. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Adenovirus+serotype+5+neutralizing+antibodies+target+both+hexon+and+fiber+following+vaccination+and+natural+infection.">Adenovirus serotype 5 neutralizing antibodies target both hexon and fiber following vaccination and natural infection.</a> Journal of virology. 86, 625-629 (2012).</li><li>Zaiss, A. K., Machado, H. B., Herschman, H. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+influence+of+innate+and+pre-existing+immunity+on+adenovirus+therapy.">The influence of innate and pre-existing immunity on adenovirus therapy.</a> Journal of cellular biochemistry. 108, 778-790 (2009).</li><li>Sumida, S. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Neutralizing+antibodies+and+CD8++T+lymphocytes+both+contribute+to+immunity+to+adenovirus+serotype+5+vaccine+vectors.">Neutralizing antibodies and CD8+ T lymphocytes both contribute to immunity to adenovirus serotype 5 vaccine vectors.</a> Journal of virology. 78, 2666-2673 (2004).</li><li>Sumida, S. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Neutralizing+antibodies+to+adenovirus+serotype+5+vaccine+vectors+are+directed+primarily+against+the+adenovirus+hexon+protein.">Neutralizing antibodies to adenovirus serotype 5 vaccine vectors are directed primarily against the adenovirus hexon protein.</a> Journal of immunology. 174, 7179-7185 (2005).</li><li>Bradley, R. R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Adenovirus+serotype+5-specific+neutralizing+antibodies+target+multiple+hexon+hypervariable+regions.">Adenovirus serotype 5-specific neutralizing antibodies target multiple hexon hypervariable regions.</a> Journal of virology. 86, 1267-1272 (2012).</li><li>Gahery-Segard, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Immune+response+to+recombinant+capsid+proteins+of+adenovirus+in+humans:+antifiber+and+anti-penton+base+antibodies+have+a+synergistic+effect+on+neutralizing+activity.">Immune response to recombinant capsid proteins of adenovirus in humans: antifiber and anti-penton base antibodies have a synergistic effect on neutralizing activity.</a> Journal of virology. 72, 2388-2397 (1998).</li><li>Gu, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Using+multivalent+adenoviral+vectors+for+HIV+vaccination.">Using multivalent adenoviral vectors for HIV vaccination.</a> PloS one. 8, e60347 (2013).</li><li>Tian, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Protection+against+enterovirus+71+with+neutralizing+epitope+incorporation+within+adenovirus+type+3+hexon.">Protection against enterovirus 71 with neutralizing epitope incorporation within adenovirus type 3 hexon.</a> PloS one. 7, e41381 (2012).</li><li>Wu, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Construction+and+characterization+of+adenovirus+serotype+5+packaged+by+serotype+3+hexon.">Construction and characterization of adenovirus serotype 5 packaged by serotype 3 hexon.</a> Journal of virology. 76, 12775-12782 (2002).</li><li>Wu, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Identification+of+sites+in+adenovirus+hexon+for+foreign+peptide+incorporation.">Identification of sites in adenovirus hexon for foreign peptide incorporation.</a> Journal of virology. 79, 3382-3390 (2005).</li><li>Qiu, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Serotype-specific+neutralizing+antibody+epitopes+of+human+adenovirus+type+3+(HAdV-3)+and+HAdV-7+reside+in+multiple+hexon+hypervariable+regions.">Serotype-specific neutralizing antibody epitopes of human adenovirus type 3 (HAdV-3) and HAdV-7 reside in multiple hexon hypervariable regions.</a> Journal of. 86, 7964-7975 (2012).</li><li>Parker, C. E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Fine+definition+of+the+epitope+on+the+gp41+glycoprotein+of+human+immunodeficiency+virus+type+1+for+the+neutralizing+monoclonal+antibody+2F5.">Fine definition of the epitope on the gp41 glycoprotein of human immunodeficiency virus type 1 for the neutralizing monoclonal antibody 2F5.</a> Journal of virology. 75, 10906-10911 (2001).</li><li>Farrow, A. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Immunization+with+Hexon+Modified+Adenoviral+Vectors+Integrated+with+gp83+Epitope+Provides+Protection+against+Trypanosoma+cruzi+Infection.">Immunization with Hexon Modified Adenoviral Vectors Integrated with gp83 Epitope Provides Protection against Trypanosoma cruzi Infection.</a> PLoS neglected tropical diseases. 8, e3089 (2014).</li><li>Krause, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Epitopes+expressed+in+different+adenovirus+capsid+proteins+induce+different+levels+of+epitope-specific+immunity.">Epitopes expressed in different adenovirus capsid proteins induce different levels of epitope-specific immunity.</a> Journal of virology. 80, 5523-5530 (2006).</li><li>Omori, N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Modification+of+a+fiber+protein+in+an+adenovirus+vector+improves+in+vitro+gene+transfer+efficiency+to+the+mouse+microglial+cell+line.">Modification of a fiber protein in an adenovirus vector improves in vitro gene transfer efficiency to the mouse microglial cell line.</a> Neuroscience letters. 324, 145-148 (2002).</li><li>Dmitriev, I. P., Kashentseva, E. A., Curiel, D. T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Engineering+of+adenovirus+vectors+containing+heterologous+peptide+sequences+in+the+C+terminus+of+capsid+protein+IX.">Engineering of adenovirus vectors containing heterologous peptide sequences in the C terminus of capsid protein IX.</a> Journal of virology. 76, 6893-6899 (2002).</li><li>Xue, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Construction+and+characterization+of+a+recombinant+human+adenovirus+type+3+vector+containing+two+foreign+neutralizing+epitopes+in+hexon.">Construction and characterization of a recombinant human adenovirus type 3 vector containing two foreign neutralizing epitopes in hexon.</a> Virus research. 183, 67-74 (2014).</li><li>Tian, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Construction+and+characterization+of+human+adenovirus+serotype+3+packaged+by+serotype+7+hexon.">Construction and characterization of human adenovirus serotype 3 packaged by serotype 7 hexon.</a> Virus research. 160, 214-220 (2011).</li><li>Kim, J. W., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+adenovirus+vector+incorporating+carbohydrate+binding+domains+utilizes+glycans+for+gene+transfer.">An adenovirus vector incorporating carbohydrate binding domains utilizes glycans for gene transfer.</a> PloS one. 8, e55533 (2013).</li><li>Vasconcelos, J. R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Pathogen-induced+proapoptotic+phenotype+and+high+CD95+(Fas)+expression+accompany+a+suboptimal+CD8++T-cell+response:+reversal+by+adenoviral+vaccine.">Pathogen-induced proapoptotic phenotype and high CD95 (Fas) expression accompany a suboptimal CD8+ T-cell response: reversal by adenoviral vaccine.</a> PLoS pathogens. 8, e1002699 (2012).</li><li>Matthews, Q. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genetic+incorporation+of+a+herpes+simplex+virus+type+1+thymidine+kinase+and+firefly+luciferase+fusion+into+the+adenovirus+protein+IX+for+functional+display+on+the+virion.">Genetic incorporation of a herpes simplex virus type 1 thymidine kinase and firefly luciferase fusion into the adenovirus protein IX for functional display on the virion.</a> Molecular imaging. 5, 510-519 (2006).</li></ol>

Les auteurs ont rien à révéler.

L&#39;application de la stratégie de modification transgénique traditionnelle sur Ad5 pour le développement de vaccins a été diminué principalement en raison du goulet d&#39;étranglement associé à l&#39;Ad5 PEI 4,6. Ce goulot d&#39;étranglement peut être partiellement diminuée par application de l&#39;alternative de la stratégie Antigène capside-Incorporation (figure 1A), puisque cette stratégie peut se soustraire à la neutralisation par Ad5 NAbs en remplaçant épitopes neutr...

Adénovirus humain (Ad) est un de taille moyenne, virus non enveloppé avec une nucléocapside icosaédrique contenant une double génome d&#39;ADN simple brin. Ad appartient à la famille Adenoviridae, avec une classification en sept groupes (A à G). Chaque groupe contient le virus de différents sérotypes. Dont, adénovirus sérotype 5 (Ad5) du groupe C a été la plus étudiée et la plus largement appliquée pour les approches Vectored comme la thérapie génique et la vaccination. La stratégie transgénique traditionnelle a été développée et appliquée à des modifications Ad5, qui est caractérisé par le déplacement des gènes précoces virus avec un gène d&#39;intérêt, et l&#39;expression du gène ciblé d&#39;intérêt chez un hôte. Des exemples sont la construction de pENV9 / Ad5hrΔE3 par le remplacement du gène précoce 3 (E3) avec gène rev de virus de l&#39;immunodéficience simien 1, la construction de AdCMVGag par le remplacement du gène précoce 1 (E1) avec le gène gag de l&#39;immunodéficience humaine(VIH) 2, et la construction du lac de la pub Z en remplaçant E1 avec gène lac Z 3. La large application de la stratégie de transgène traditionnelle sur Ad5 dépend des avantages suivants: la large gamme d&#39;hôtes pour Ad5, le génie génétique réalisable sur le virus et la propagation du virus, le grand établissement de l&#39;insert de gène étranger et la sécurité de l&#39;Ad5 4,5. Cependant, les efficacités réduits de thérapies cliniques Ad5-vectorisé par l&#39;utilisation de cette stratégie a été un obstacle majeur, qui a été cartographiée à être principalement associée à Ad5 PEI, depuis Ad5 est tellement répandue parmi la majorité des enfants et des adultes 4,6. Pour surmonter le principal goulot d&#39;étranglement de l&#39;Ad5, l&#39;objectif principal est de développer une stratégie alternative contournant Ad5 PEI. L&#39;immunité innée 7, l&#39;immunité adaptative tels que des anticorps neutralisants (AcN) 10/08 T CD8 + et des réponses de lymphocytes 10 contre Ad5 a été démontré que la contribute à Ad5 PEI, avec Ad5 NAbs apparaissant à jouer un rôle dominant dans les contributions à Ad5 PEI 10,11. En outre, Ad5 NABS épitopes cibles situées dans des protéines de capside, y compris le principal hexon de protéines, de fibres et de la base du penton. Dont, hexon est la principale cible de Ad5 NAbs 8,11-13. Basé sur ces résultats, une stratégie novatrice Antigène capside-constitution a été introduite. Cette nouvelle stratégie met en évidence le remplacement ou l&#39;incorporation de protéines-de-intérêts sur Ad5 protéines de capside, qui déplace ou masque les épitopes neutralisants Ad5, conduisant à la diminution de la reconnaissance par le NAbs et efficaces administrations vecteur Ad5. Il est à noter que cette stratégie est concurrentiel car il peut aussi aider les hôtes suscitent robuste immunité humorale et l&#39;immunité cellulaire puissante en présentant directement des antigènes d&#39;intérêt pour le système immunitaire 4,14,15. Basé sur cette stratégie, le clonage moléculaire et recombinant Ad vecteur viral de sauvetage peuvent être structurellement divisésen quatre étapes principales: (a) la préparation d&#39;un fragment de gènes d&#39;intérêt soit par réaction en chaîne de la polymérase (PCR) ou la synthèse; (B) la ligation du fragment de gène dans un plasmide navette qui contient le fragment génique d&#39;intérêt et les bras homologues à un squelette de l&#39;adénovirus; (C) la recombinaison homologue par co-transformation de la navette de plasmide contenant le fragment génique d&#39;intérêt avec le squelette plasmidique linéarisé PAD5 / ΔH5 (GL) 16; (D) la transfection de plasmide linéarisé adénovirus recombinant pour sauver le vecteur Ad recombinant incorporé avec des antigènes-de-intérêt. Notre groupe et quelques autres ont étendu cette stratégie alternative d&#39;incorporation de la pub pour Ad développement d&#39;un vaccin vectorisé contre différents agents pathogènes infectieux. Nous avons signalé la génération d&#39;un vecteur Ad recombinant Ad-HVR1-LGS-His 6 -V3 en incorporant un marquage His VIH-1 antigène V3 dans la locale de l&#39;Ad5 HVR1 hexon (hexon5). Ce vecteur généré str déclenchéréponse immunitaire humorale spécifique ong à l&#39;épitope V3 4. Nous avons également signalé le développement de Ad5 / HVR2-MPER-L15ΔE1 en intégrant le VIH-1 membrane région ectodomaine proximale (MPER) dans les paramètres régionaux HVR2 de hexon5 2. En outre, le groupe de M. Zhou a utilisé les avantages de cette stratégie de constitution de la pub pour développer Ad sérotype 3 (Ad3) Les vaccins vectorisées, ie., La génération de vecteur viral R1SP70A3 en incorporant un SP70 épitope de neutralisation de l&#39;entérovirus 71 dans le HVR1 des Ad3 hexon (hexon3). R1SP70A3 généré NAbs solides et la production d&#39;IFN-γ spécifiques à l&#39;épitope de SP70, qui conduisent au taux élevé de protection contre l&#39;entérovirus 71 15 défi. Aux fins de référence technique, notre étude a profité de la stratégie Antigène capside-Incorporation qualitative de se concentrer sur la génération d&#39;un vecteur Ad5 divalent Ad5 / H5-HVR1-Kwas-HVR5-His 6 en incorporant un antigène du VIH-1 dans HVR1 uneda Sa balise dans HVR5 de hexon5. Le vecteur viral généré a également été évalué immunologiquement. La stratégie Antigène capside-Incorporation pourrait être utilisé pour le développement d&#39;approches de vaccination Ad5-vectorisé contre différentes maladies infectieuses.

<table border="0" cellpadding="0" cellspacing="0">
	<tbody>
		<tr>
			<td>1x DPBS</td>
			<td>Thermo Scientific</td>
			<td>SH30256.01</td>
			<td>for cell spliting&#160;</td>
		</tr>
		<tr>
			<td>10x DPBS</td>
			<td>Thermo Scientific</td>
			<td>SH30378.02</td>
			<td>for dialysis buffer preparation</td>
		</tr>
		<tr>
			<td>glycerol</td>
			<td>SIGMA</td>
			<td>G5516-1L</td>
			<td>for dialysis buffer preparation</td>
		</tr>
		<tr>
			<td>SDS</td>
			<td>BIO-RAD</td>
			<td>161-0301</td>
			<td>for virus lysis buffer preparation</td>
		</tr>
		<tr>
			<td>Fetal Bovine Serum (FBS)</td>
			<td>Thermo Scientific</td>
			<td>SH30910.03</td>
			<td>component of culture medium</td>
		</tr>
		<tr>
			<td>100X Non-Essential Amino Acids&#160;</td>
			<td>Thermo Scientific</td>
			<td>SH30238.01</td>
			<td>component of culture medium</td>
		</tr>
		<tr>
			<td>200mM/L L-glutamine</td>
			<td>Cellgro</td>
			<td>25-005-CI</td>
			<td>component of culture medium</td>
		</tr>
		<tr>
			<td>penicillin/streptomycin solution&#160;</td>
			<td>Cellgro</td>
			<td>30-002-CI</td>
			<td>component of culture medium</td>
		</tr>
		<tr>
			<td>DMEM with high glucose</td>
			<td>Thermo Scientific</td>
			<td>SH30081.01</td>
			<td>for HEK293 cell culture</td>
		</tr>
		<tr>
			<td>Minimum Essential Medium Eagle</td>
			<td>SIGMA</td>
			<td>M5650</td>
			<td>for HeLa cell culture</td>
		</tr>
		<tr>
			<td>phenol:chloroform:isoamyl alcohol&#160;</td>
			<td>SIGMA</td>
			<td>P3803-100ML</td>
			<td>for large size of DNA purification</td>
		</tr>
		<tr>
			<td>cesium chloride&#160;</td>
			<td>Research Products International Corp.</td>
			<td>C68050</td>
			<td>for virus purificiation</td>
		</tr>
		<tr>
			<td>HEPES</td>
			<td>Cellgro</td>
			<td>25-060-CI</td>
			<td>for CsCl solution preparation</td>
		</tr>
		<tr>
			<td>HEK293</td>
			<td>ATCC</td>
			<td>51-0036</td>
			<td>for virus rescue and upscale</td>
		</tr>
		<tr>
			<td>HeLa</td>
			<td>ATCC</td>
			<td>CCL-2</td>
			<td>for neutralization assay</td>
		</tr>
		<tr>
			<td>T-25 flask</td>
			<td>Thermo Scientific</td>
			<td>156367</td>
			<td>for cell culture&#160;</td>
		</tr>
		<tr>
			<td>T-75 flask</td>
			<td>CORNING</td>
			<td>430641</td>
			<td>for cell culture&#160;</td>
		</tr>
		<tr>
			<td>T-175 flask</td>
			<td>Thermo Scientific</td>
			<td>159910</td>
			<td>for cell culture&#160;</td>
		</tr>
		<tr>
			<td>Ultracentrifuge</td>
			<td>BECKMAN</td>
			<td>NA</td>
			<td>for virus purification</td>
		</tr>
		<tr>
			<td>Ultracentrifuge tube</td>
			<td>BECKMAN</td>
			<td>344059</td>
			<td>for virus purification</td>
		</tr>
		<tr>
			<td>dialysis cassette&#160;</td>
			<td>Thermo Scientific</td>
			<td>66380</td>
			<td>for virus dialysis</td>
		</tr>
		<tr>
			<td>ELISA plate</td>
			<td>Thermo Scientific</td>
			<td>442404</td>
			<td>for ELISA</td>
		</tr>
		<tr>
			<td>human anti-gp41 (2F5) mAb</td>
			<td>NIH AIDS Reagent Program</td>
			<td>1475</td>
			<td>for immunological assays</td>
		</tr>
		<tr>
			<td>mouse anti-His tag mAb</td>
			<td>GenScript</td>
			<td>A00186</td>
			<td>for immunological assays</td>
		</tr>
		<tr>
			<td>SOC medium</td>
			<td>CORNING</td>
			<td>46-003-CR</td>
			<td>for transformation</td>
		</tr>
		<tr>
			<td>PCR master mix solution</td>
			<td>QIAGEN</td>
			<td>201445</td>
			<td>for PCR</td>
		</tr>
		<tr>
			<td>Animal lancet (point length at 5mm)</td>
			<td>MEDIpoint</td>
			<td></td>
			<td>for mice bleeding&#160;</td>
		</tr>
		<tr>
			<td>Biophotometer</td>
			<td>Eppendorf</td>
			<td></td>
			<td>for virus physical titer titration</td>
		</tr>
	</tbody>
</table>

utilizing the antigen capsid-incorporation strategy for the development of adenovirus serotype 5-vectored vaccine approaches

L&#39;adénovirus sérotype 5 (Ad5) a été largement modifié par des méthodes traditionnelles de transgène pour le développement de vaccins. Les efficacités réduites de ces vecteurs Ad5 traditionnellement modifiés dans les essais cliniques pourraient être principalement corrélées avec Ad5 immunité pré-existante (PEI) parmi la majorité de la population. Pour promouvoir le développement d&#39;un vaccin Ad5-vectorisé par la résolution de la préoccupation de l&#39;Ad5 PEI, la stratégie innovante Antigène capside-constitution a été employé. Par le mérite de cette stratégie, Ad5-guidé nous avons d&#39;abord construit la navette hexon plasmide HVR1-Kwas-HVR5-Ses 6 / pH5S par sous-clonage de la région hypervariable (HVR) 1 de hexon dans un plasmide navette construite précédemment HVR5-Ses 6 / pH5S, qui avait son étiquette 6 incorporé dans le HVR5. Ce fragment HVR1 ADN contenant un épitope ELDKWAS VIH a été synthétisé. HVR1-Kwas-HVR5-Ses 6 / pH5S était alors linéarisé et co-transformé avec le plasmide linéarisé épine dorsale PAD5 / ΔH5 (GL),pour la recombinaison homologue. Ce plasmide recombiné PAD5 / H5-HVR1-Kwas HVR5-6-His a été transfecté dans des cellules afin de générer le vecteur viral d&#39;Ad5 / H5-HVR1-Kwas HVR5-6-His. Ce vecteur a été validé à avoir les aptitudes qualitative indiqué par titre virale physique (VP / ml), titre infectieux (IP / ml) et le ratio de VP correspondant / IP. Tant l&#39;épitope VIH et son étiquette 6 étaient exposés en surface sur la capside Ad5, et conservés antigénicité spécifique d&#39;épitope de leur propre. Un essai de neutralisation a indiqué la capacité de ce vecteur divalent de contourner neutralisation par des sérums positifs Ad5 in vitro. l&#39;immunisation de souris a démontré la génération de robustes immunité humorale spécifique à l&#39;épitope du VIH et son 6. Cette étude de preuve de principe a suggéré que le protocole associé à la stratégie de l&#39;antigène de capside-incorporation pourrait être faisable utilisé pour la génération de vaccins à vecteur Ad5 en modifiant différentes protéines de capside. Ce protocole pourrait même être Futres modifié pour la production de vaccins à vecteur d&#39;adenovirus de serotype rare.

La stratégie Antigène capside-Incorporation (figure 1A) a été utilisé pour générer le bivalent Ad5 vecteur viral Ad5 / H5-HVR1-Kwas-HVR5-His 6. Tout d&#39;abord, le plasmide navette HVR1-Kwas HVR5-6-His / pH5S a été construit en sous-clonant le fragment HVR1-Kwas dans le plasmide navette de construction précédente HVR5-His 6/17 pH5S. En second lieu, le plasmide PAD5 / H5-HVR1-Kwas HVR5-6-His 14 a été construit par une recombi...

Watch this Scientific Journal Video about Utilizing the Antigen Capsid-Incorporation Strategy for the Development of Adenovirus Serotype 5-Vectored Vaccine Approaches at JoVE.com

Utilizing the Antigen Capsid-Incorporation Strategy for the Development of Adenovirus Serotype 5-Vectored Vaccine Approaches

Ici, nous présentons un protocole pour générer un type bivalent adénovirus 5 (Ad5) vecteur preuve-de-principe Ad5 / H5-HVR1-Kwas-HVR5-His 6 en utilisant la stratégie Antigène capside-Incorporation. Ce vecteur a été démontrée à exposer remise en forme qualitative, la capacité d&#39;échapper sérums Ad5 positif in vitro, et l&#39;antigénicité ainsi que l&#39;immunogénicité des antigènes incorporés.

Utilisant la stratégie capside-Incorporation Antigen pour le développement d&#39;approches adénovirus sérotype 5 Vectored vaccins

Adenovirus serotype 5 (Ad5) has been extensively modified with traditional transgene methods for the vaccine development. The reduced efficacies of these ...

utilizing-antigen-capsid-incorporation-strategy-for-development

Research

JoVE Journal

Immunology and Infection

10.3K vues.  University of Alabama at Birmingham.  Ici, nous présentons un protocole pour générer un type bivalent adénovirus 5 (Ad5) vecteur preuve-de-principe Ad5 / H5-HVR1-Kwas-HVR5-His 6 en utilisant la stratégie Antigène capside-Incorporation. Ce vecteur a été démontrée à exposer remise en forme qualitative, la capacité d'échapper sérums Ad5 positif in vitro, et l'antigénicité ainsi que l'immunogénicité des antigènes incorporés. 

Vidéo: Utilizing the Antigen Capsid-Incorporation Strategy for the Development of Adenovirus Serotype 5-Vectored Vaccine Approaches

Efficient Recombinant Parvovirus Production with the Help of Adenovirus-derived Systems

Rodent parvoviruses (PV) such as rat H-1PV and MVM, are small icosahedral, single stranded, DNA viruses. Their genome includes two promoters P4 and P38 which regulate the expression of non-structural (NS1 and NS2) and capsid proteins (VP1 and VP2) respectively1. They attract high interest as anticancer agents for their oncolytic and oncosuppressive abilities while being non-pathogenic for humans2. NS1 is the major effector of viral cytotoxicity3. In order to further enhance their natural antineoplastic activities, derivatives from these vectors have been generated by replacing the gene encoding for the capsid proteins with a therapeutic transgene (e.g. a cytotoxic polypeptide, cytokine, chemokine, tumour suppressor gene etc.)4. The recombinant parvoviruses (recPVs) vector retains the NS1/2 coding sequences and the PV genome telomeres which are necessary for viral DNA amplification and packaging. Production of recPVs occurs only in the producer cells (generally HEK293T), by co-transfecting the cells with a second vector (pCMV-VP) expressing the gene encoding for the VP proteins (Fig. 1)4. The recPV vectors generated in this way are replication defective. Although recPVs proved to possess enhanced oncotoxic activities with respect to the parental viruses from which they have been generated, their production remains a major challenge and strongly hampers the use of these agents in anti-cancer clinical applications.
We found that introduction of an Ad-5 derived vector containing the E2a, E4(orf6) and the VA RNA genes (e.g. pXX6 plasmid) into HEK293T improved the production of recPVs by more than 10 fold in comparison to other protocols in use. Based on this finding, we have constructed a novel Ad-VP-helper that contains the genomic adenoviral elements necessary to enhance recPVs production as well as the parvovirus VP gene unit5. The use of Ad-VP-helper, allows production of rec-PVs using a protocol that relies entirely on viral infection steps (as opposed to plasmid transfection), making possible the use of cell lines that are difficult to transfect (e.g. NB324K) (Fig. 2). We present a method that greatly improves the amount of recombinant virus produced, reducing both the production time and costs, without affecting the quality of the final product5. In addition, large scale production of recPV (in suspension cells and bioreactors) is now conceivable.

Here we describe a protocol based only on cell infection, which improves the efficiency of recombinant parvovirus production by more than 100 fold in comparison to other protocols in use. This protocol relies on the use of a novel adenovirus 5-based helper containing the parvovirus VP transcription unit (Ad-VP).

Efficacité de la production Parvovirus recombinant avec l&#39;aide d&#39;adénovirus dérivés Systems

Rodent parvoviruses (PV) such as rat H-1PV and MVM, are small icosahedral, single stranded, DNA viruses. Their genome includes two promoters P4 and P38 ...

Recherche

Immunologie et infection

Generation of Recombinant Arenavirus for Vaccine Development in FDA-Approved Vero Cells

The development and implementation of arenavirus reverse genetics represents a significant breakthrough in the arenavirus field 4. The use of cell-based arenavirus minigenome systems together with the ability to generate recombinant infectious arenaviruses with predetermined mutations in their genomes has facilitated the investigation of the contribution of viral determinants to the different steps of the arenavirus life cycle, as well as virus-host interactions and mechanisms of arenavirus pathogenesis 1, 3, 11 . In addition, the development of trisegmented arenaviruses has permitted the use of the arenavirus genome to express additional foreign genes of interest, thus opening the possibility of arenavirus-based vaccine vector applications 5 . Likewise, the development of single-cycle infectious arenaviruses capable of expressing reporter genes provides a new experimental tool to improve the safety of research involving highly pathogenic human arenaviruses 16 . The generation of recombinant arenaviruses using plasmid-based reverse genetics techniques has so far relied on the use of rodent cell lines 7,19 , which poses some barriers for the development of Food and Drug Administration (FDA)-licensed vaccine or vaccine vectors. To overcome this obstacle, we describe here the efficient generation of recombinant arenaviruses in FDA-approved Vero cells.

Rescue of recombinant arenaviruses from cloned cDNAs, an approach referred to as reverse genetics, allows researchers to investigate the role of specific viral gene products, as well as the contribution of their different specific domains and residues, to many different aspects of the biology of arenavirus. Likewise, reverse genetics techniques in FDA-approved cell lines (Vero) for vaccine development provides novel possibilities for the generation of effective and safe vaccines to combat human pathogenic arenaviruses.

Génération de Arenavirus recombinant pour le développement de vaccins approuvés par la FDA des cellules Vero

The development and implementation of arenavirus reverse genetics represents a significant breakthrough in the arenavirus field  4. The use of cell-based ...

Using Click Chemistry to Measure the Effect of Viral Infection on Host-Cell RNA Synthesis

Many RNA viruses have evolved the ability to inhibit host cell transcription as a means to circumvent cellular defenses. For the study of these viruses, it is therefore important to have a quick and reliable way of measuring transcriptional activity in infected cells. Traditionally, transcription has been measured either by incorporation of radioactive nucleosides such as 3H-uridine followed by detection via autoradiography or scintillation counting, or incorporation of halogenated uridine analogs such as 5-bromouridine (BrU) followed by detection via immunostaining. The use of radioactive isotopes, however, requires specialized equipment and is not feasible in a number of laboratory settings, while the detection of BrU can be cumbersome and may suffer from low sensitivity.
The recently developed click chemistry, which involves a copper-catalyzed triazole formation from an azide and an alkyne, now provides a rapid and highly sensitive alternative to these two methods. Click chemistry is a two step process in which nascent RNA is first labeled by incorporation of the uridine analog 5-ethynyluridine (EU), followed by detection of the label with a fluorescent azide. These azides are available as several different fluorophores, allowing for a wide range of options for visualization.
This protocol describes a method to measure transcriptional suppression in cells infected with the Rift Valley fever virus (RVFV) strain MP-12 using click chemistry. Concurrently, expression of viral proteins in these cells is determined by classical intracellular immunostaining. Steps 1 through 4 detail a method to visualize transcriptional suppression via fluorescence microscopy, while steps 5 through 8 detail a method to quantify transcriptional suppression via flow cytometry. This protocol is easily adaptable for use with other viruses.

This method describes the use of click chemistry to measure changes in host cell transcription after infection with the Rift Valley fever virus (RVFV) strain MP-12. Results can be visualized qualitatively via fluorescence microscopy or obtained quantitatively through flow cytometry. This method is adaptable for use with other viruses.

Utilisation de Click Chemistry pour mesurer l&#39;effet de l&#39;infection virale sur Host-Cell Synthèse des ARN

Many RNA viruses have evolved the ability to inhibit host cell transcription as a means to circumvent cellular defenses. For the study of these viruses, ...

In Vitro Analysis of Myd88-mediated Cellular Immune Response to West Nile Virus Mutant Strain Infection

An attenuated West Nile virus (WNV), a nonstructural (NS) 4B-P38G mutant, induced higher innate cytokine and T cell responses than the wild-type WNV in mice. Recently, myeloid differentiation factor 88 (MyD88) signaling was shown to be important for initial T cell priming and memory T cell development during WNV NS4B-P38G mutant infection. In this study, two flow cytometry-based methods &#8211; an in vitro T cell priming assay and an intracellular cytokine staining (ICS) &#8211; were utilized to assess dendritic cells (DCs) and T cell functions. In the T cell priming assay, cell proliferation was analyzed by flow cytometry following co-culture of DCs from both groups of mice with carboxyfluorescein succinimidyl ester (CFSE) - labeled CD4+ T cells of OTII transgenic mice. This approach provided an accurate determination of the percentage of proliferating CD4+ T cells with significantly improved overall sensitivity than the traditional assays with radioactive reagents. A microcentrifuge tube system was used in both cell culture and cytokine staining procedures of the ICS protocol. Compared to the traditional tissue culture plate-based system, this modified procedure was easier to perform at biosafety level (BL) 3 facilities. Moreover, WNV- infected cells were treated with paraformaldehyde in both assays, which enabled further analysis outside BL3 facilities. Overall, these in vitro immunological assays can be used to efficiently assess cell-mediated immune responses during WNV infection.

In Vitro Analysis of Myd88-mediated Cellular Immune Response to West Nile Virus Mutant Strain Infection

Two flow cytometry-based methods &#8211; an in vitro T cell priming assay and intracellular cytokine staining were utilized to measure antigen presenting capacity of dendritic cells and antigen-specific T cell responses to a West Nile virus mutant infection in mice.

Analyse in vitro de la réponse immunitaire cellulaire Myd88 médiation au virus du Nil occidental souche mutante Infection

An attenuated West Nile virus (WNV), a nonstructural (NS) 4B-P38G mutant, induced higher innate cytokine and T cell responses than the wild-type WNV in ...

Detection of Human Leukocyte Antigen Biomarkers in Breast Cancer Utilizing Label-free Biosensor Technology

According to the American Cancer Society, more than 200,000 women will be diagnosed with invasive breast cancer each year and approximately 40,000 will die from the disease. The human leukocyte antigen (HLA) class I samples peptides derived from proteasomal degradation of cellular proteins and presents these fragments on the cell surface for interrogation by circulating cytotoxic T lymphocytes (CTL). Generation of T-cell receptor mimic (TCRm) monoclonal antibodies (mAbs) which recognize breast cancer specific peptide/HLA-A*02:01 complexes such as those derived from macrophage migration inhibitory factor (MIF19-27) and NY-ESO-1157-165 enable detection and destruction of breast cancer cells in the absence of an effective anti-tumor CTL response. Intact class I HLA/peptide complexes are shed by breast cancer cells and represent potentially relevant cancer biomarkers. In this work, a breakthrough biomarker screening system for cancer diagnostics incorporating T-cell receptor mimic monoclonal antibodies combined with a novel, label-free biosensor utilizing guided-mode resonance (GMR) sensor technology is presented. Detection of shed MIF/HLA-A*02:01 complexes in MDA-MB-231 cell supernatants, spiked human serum, and patient plasma is demonstrated. The impact of this work could revolutionize personalized medicine through development of companion disease diagnostics for targeted immunotherapies.

Intact class I HLA/peptide complexes are shed by cancer cells, representing a potential relevant cancer biomarker. Utilizing label-free sensor technology and T-cell receptor mimicking monoclonal antibodies, detection of shed MIF/HLA-A*02:01 complexes in MDA-MB-231 cell supernatants, spiked human serum, and patient plasma is demonstrated, enabling development of a novel cancer diagnostic platform.

Détection de l&#39;antigène leucocytaire humain biomarqueurs du cancer du sein Utilisant la technologie des biocapteurs Sans étiquette

According to the American Cancer Society, more than 200,000 women will be diagnosed with invasive breast cancer each year and approximately 40,000 will ...

Development of an in vitro model system for studying the interaction of Equus caballus IgE with its high-affinity receptor Fc&#949;RI

The interaction of IgE with its high-affinity Fc receptor (Fc&#949;RI) followed by an antigenic challenge is the principal pathway in IgE mediated allergic reactions. As a consequence of the high affinity binding between IgE and Fc&#949;RI, along with the continuous production of IgE by B cells, allergies usually persist throughout life, with currently no permanent cure available. Horses, especially race horses, which are commonly inbred, are a species of mammals that are very prone to the development of hypersensitivity responses, which can seriously affect their performance. Physiological responses to allergic sensitization in horses mirror that observed in humans and dogs. In this paper we describe the development of an in situ assay system for the quantitative assessment of the release of mediators of the allergic response pertaining to the equine system. To this end, the gene encoding equine Fc&#949;RI&#945; was transfected into and expressed onto the surface of parental Rat Basophil Leukemia (RBL-2H3.1) cells. The gene product of the transfected equine &#945;-chain formed a functional receptor complex with the endogenous rat &#946;- and &#947;-chains 1. The resultant assay system facilitated an assessment of the quantity of mediator secreted from equine Fc&#949;RI&#945; transfected RBL-2H3.1 cells following sensitization with equine IgE and antigenic challenge using &#946;-hexosaminidase release as a readout 2, 3. Mediator release peaked at 36.68% &#177; 4.88% at 100 ng ml-1 of antigen. This assay was modified from previous assays used to study human and canine allergic responses 4, 5. We have also shown that this type of assay system has multiple applications for the development of diagnostic tools and the safety assessment of potential therapeutic intervention strategies in allergic disease 6, 2, 3.

Development of an &lt;em&gt;in vitro&lt;/em&gt; model system for studying the interaction of &lt;em&gt;Equus&lt;/em&gt; &lt;em&gt;caballus&lt;/em&gt; IgE with its high-affinity receptor Fc&amp;#949;RI

The current study describes the development and applications of a genetically engineered assay system based on the transfection of rat basophilic leukemia cells with the equine Fc&#949;RI&#945; gene. Transfected cells express a functional receptor where the release of mediators of the allergic response can be activated by IgE and antigen.

Développement d&#39;un<em&gt; In vitro</em&gt; Système modèle pour l&#39;étude de l&#39;interaction de<em&gt; Equus</em&gt;<em&gt; Caballus</em&gt; IgE avec son récepteur de haute affinité FcsRI

The interaction of IgE with its high-affinity Fc receptor (Fc&#949;RI) followed by an antigenic challenge is the principal pathway in IgE mediated ...

Imaging CD4 T Cell Interstitial Migration in the Inflamed Dermis

The ability of CD4 T cells to carry out effector functions is dependent upon the rapid and efficient migration of these cells in inflamed peripheral tissues through an as-yet undefined mechanism. The application of multiphoton microscopy to the study of the immune system provides a tool to measure the dynamics of immune responses within intact tissues. Here we present a protocol for non-invasive intravital multiphoton imaging of CD4 T cells in the inflamed mouse ear dermis. Use of a custom imaging platform and a venous catheter allows for the visualization of CD4 T cell dynamics in the dermal interstitium, with the ability to interrogate these cells in real-time via the addition of blocking antibodies to key molecular components involved in motility. This system provides advantages over both in vitro models and surgically invasive imaging procedures. Understanding the pathways used by CD4 T cells for motility may ultimately provide insight into the basic function of CD4 T cells as well as the pathogenesis of both autoimmune diseases and pathology from chronic infections.

The mechanisms that govern the interstitial motility of CD4 effector T cells at sites of inflammation are relatively unknown. We present a non-invasive approach to visualize and manipulate in vitro-primed CD4 T cells in the inflamed ear dermis, allowing for study of the dynamic behavior of these cells in situ.

Imagerie CD4 T Cellule interstitielle Migration dans les Derme Enflammé

The ability of CD4 T cells to carry out effector functions is dependent upon the rapid and efficient migration of these cells in inflamed peripheral ...

Development of Stem Cell-derived Antigen-specific Regulatory T Cells Against Autoimmunity

Autoimmune diseases arise due to the loss of immunological self-tolerance. Regulatory T cells (Tregs) are important mediators of immunologic self-tolerance. Tregs represent about 5 - 10% of the mature CD4+ T cell subpopulation in mice and humans, with about 1 - 2% of those Tregs circulating in the peripheral blood. Induced pluripotent stem cells (iPSCs) can be differentiated into functional Tregs, which have a potential to be used for cell-based therapies of autoimmune diseases. Here, we present a method to develop antigen (Ag)-specific Tregs from iPSCs (i.e., iPSC-Tregs). The method is based on incorporating the transcription factor FoxP3 and an Ag-specific T cell receptor (TCR) into iPSCs and then differentiating on OP9 stromal cells expressing Notch ligands delta-like (DL) 1 and DL4. Following in vitro differentiation, the iPSC-Tregs express CD4, CD8, CD3, CD25, FoxP3, and Ag-specific TCR and are able to respond to Ag stimulation. This method has been successfully applied to cell-based therapy of autoimmune arthritis in a murine model. Adoptive transfer of these Ag-specific iPSC-Tregs into Ag-induced arthritis (AIA)-bearing mice has the ability to reduce joint inflammation and swelling and to prevent bone loss.

We present here a method to develop functional antigen (Ag)-specific regulatory T cells (Tregs) from induced pluripotent stem cells (iPSCs) for immunotherapy of autoimmune arthritis in a murine model.

Développement de cellules souches dérivées de cellules T régulatrices spécifiques de l&#39;antigène contre Autoimmunité

Autoimmune diseases arise due to the loss of immunological self-tolerance. Regulatory T cells (Tregs) are important mediators of immunologic ...

Evaluation of Host-Pathogen Responses and Vaccine Efficacy in Mice

Vaccines are a 20th century medical marvel. They have dramatically reduced the morbidity and mortality caused by infectious diseases and contributed to a striking increase in life expectancy around the globe. Nonetheless, determining vaccine efficacy remains a challenge. Emerging evidence suggests that the current acellular vaccine (aPV) for Bordetella pertussis (B. pertussis) induces suboptimal immunity. Therefore, a major challenge is designing a next-generation vaccine that induces protective immunity without the adverse side effects of a whole-cell vaccine (wPV). Here we describe a protocol that we used to test the efficacy of a promising, novel adjuvant that skews immune responses to a protective Th1/Th17 phenotype and promotes a better clearance of a B. pertussis challenge from the murine respiratory tract. This article describes the protocol for mouse immunization, bacterial inoculation, tissue harvesting, and analysis of immune responses. Using this method, within our model, we have successfully elucidated crucial mechanisms elicited by a promising, next-generation acellular pertussis vaccine. This method can be applied to any infectious disease model in order to determine vaccine efficacy.

Here we present an elegant protocol for in vivo evaluation of vaccine effectiveness and host immune responses. This protocol can be adapted for vaccine models that study viral, bacterial, or parasitic pathogens.

Évaluation des réponses de l’hôte-pathogène et l’efficacité du vaccin chez la souris

Vaccines are a 20th century medical marvel. They have dramatically reduced the morbidity and mortality caused by infectious diseases and contributed to a ...

Use of an Influenza Antigen Microarray to Measure the Breadth of Serum Antibodies Across Virus Subtypes

The influenza virus remains a significant cause of mortality worldwide due to the limited effectiveness of currently available vaccines. A key challenge to the development of universal influenza vaccines is high antigenic diversity resulting from antigenic drift. Overcoming this challenge requires novel research tools to measure the breadth of serum antibodies directed against many virus strains across different antigenic subtypes. Here, we present a protocol for analyzing the breadth of serum antibodies against diverse influenza virus strains using a protein microarray of influenza antigens.
This influenza antigen microarray is constructed by printing purified hemagglutinin and neuraminidase antigens onto a nitrocellulose-coated membrane using a microarray printer. Human sera are incubated on the microarray to bind antibodies against the influenza antigens. Quantum-dot-conjugated secondary antibodies are used to simultaneously detect IgG and IgA antibodies binding to each antigen on the microarray. Quantitative antibody binding is measured as fluorescence intensity using a portable imager. Representative results are shown to demonstrate assay reproducibility in measuring subtype-specific and cross-reactive influenza antibodies in human sera.
Compared to traditional methods such as ELISA, the influenza antigen microarray provides a high throughput multiplexed approach capable of testing hundreds of sera for multiple antibody isotypes against hundreds of antigens in a short time frame, and thus has applications in sero-surveillance and vaccine development. A limitation is the inability to distinguish binding antibodies from neutralizing antibodies.

We present a protocol for using a protein microarray constructed by printing influenza antigens onto nitrocellulose-coated slides to simultaneously probe serum for multiple antibody isotypes against over 250 antigens from different virus strains, thus allowing measurement of the breadth of serum antibodies across virus subtypes.

Utilisation d'un microréseau d'antigène de la grippe pour mesurer l'étendue des anticorps sériques à travers les sous-types de virus

The influenza virus remains a significant cause of mortality worldwide due to the limited effectiveness of currently available vaccines. A key challenge ...