A subscription to JoVE is required to view this content. Sign in or start your free trial.
Method Article
Capitalizing on a binary genetic strategy we provide a detailed protocol for neural circuit tracing in mice that express complementary transsynaptic tracers after Cre-mediated recombination. Because cell-specific tracer production is genetically encoded, our experimental approach is suitable to study the formation and maturation of neural circuitry during murine embryonic brain development at a single cell resolution.
Anatomical path tracing is of pivotal importance to decipher the relationship between brain and behavior. Unraveling the formation of neural circuits during embryonic maturation of the brain however is technically challenging because most transsynaptic tracing methods developed to date depend on stereotaxic tracer injection. To overcome this problem, we developed a binary genetic strategy for conditional genetic transsynaptic tracing in the mouse brain. Towards this end we generated two complementary knock-in mouse strains to selectively express the bidirectional transsynaptic tracer barley lectin (BL) and the retrograde transsynaptic tracer Tetanus Toxin fragment C from the ROSA26 locus after Cre-mediated recombination. Cell-specific tracer production in these mice is genetically encoded and does not depend on mechanical tracer injection. Therefore our experimental approach is suitable to study neural circuit formation in the embryonic murine brain. Furthermore, because tracer transfer across synapses depends on synaptic activity, these mouse strains can be used to analyze the communication between genetically defined neuronal populations during brain development at a single cell resolution. Here we provide a detailed protocol for transsynaptic tracing in mouse embryos using the novel recombinant ROSA26 alleles. We have utilized this experimental technique in order to delineate the neural circuitry underlying maturation of the reproductive axis in the developing female mouse brain.
Anatomical path tracing is one of the most commonly utilized tools to decipher the relationship between brain and behavior1. Advancement in neural circuit tracing technologies has bestowed neuroscientists with the ability to trace neural circuits from genetically identified neuron populations in mice2. In spite of these technical advancements it remains challenging to unravel the formation of neural circuits especially during embryonic maturation. This is because most of the tracing methods developed to date are based upon stereotaxic injection of transsynaptic tracers or genetically modified neurotropic viruses (Figure 1)2,3. While these techniques achieve spatial and temporal resolution of connectivity, several inherent limitations such as technically challenging tracer injections into the developing brain, the reproducibility of the site of injection, potential inflammation at the injection site and most importantly cytotoxicity caused by neurotropic viruses limit their use4.
An alternative method is to express the transsynaptic tracers as transgenes in genetically altered mice. We have recently modified this technique and developed a binary genetic transsynaptic tracing system to map the neural circuits of any genetically identified neuronal population5. Our experimental strategy is based on two new knock-in mouse strains, which express either the bidirectional tracer barley lectin (BL)6 or the retrograde tracer Tetanus Toxin fragment C fused to GFP (GTT)7 from the ROSA26 locus after Cre-mediated recombination. Here we used these mouse strains to selectively express BL and GTT in neurons that produce kisspeptin, a neuropeptide that is implicated in regulating the maturation of the reproductive axis8,9. We demonstrate that this technique is suitable to visualize the development and maturation of kisspeptin neural circuitry during embryonic development of the female mouse brain5.
Breeding strategy
The R26-BL-IRES-τlacZ (BIZ) and the R26-GFP-TTC (GTT) tracer lines are knock-in strains5 that carry recombinant ROSA26 alleles. The R26-BIZ and the R26-GTT alleles are transcriptionally silent due to the presence of a strong transcriptional stop signal, which is flanked by two loxP sites5. Expression of the BIZ and GTT transgene is activated by Cre-mediated removal of the transcriptional stop signal. The R26-BIZ and R26-GTT alleles can be used independently by simply crossing with a Cre driver line. For analysis animals heterozygous for the respective Cre and R26 alleles can be used. Littermates carrying one Cre or one R26 allele, respectively, should be used as controls. Alternatively, it is also possible to generate triple knock-in animals carrying the Cre, R26-BIZ and R26-GTT alleles, however this will require one additional cross.
Access restricted. Please log in or start a trial to view this content.
NOTE: Ethics Statement: Procedures involving animal subjects were approved by the animal welfare committee of the University of Hamburg and the University of Saarland.
1. Preparation and Fixation of Embryonic Tissue
2. Freezing
3. Cryosectioning
4. Tracer visualization Using the Tyramide Signal Amplification (TSA) Protocol
5. τlacZ Staining for Embryonic Sections
6. Gender and Tracer Genotyping
Access restricted. Please log in or start a trial to view this content.
This section shows representative results that can be obtained working with the R26-BIZ (BL-IRES-τlacZ) and the R26-GTT (GFP-TTC) alleles. Here we use the R26-BIZ and the R26-GTT alleles to analyze the maturation of the neural circuits regulating the reproductive axis. Reproduction in vertebrates is centrally controlled by a small subset of neurons in the hypothala...
Access restricted. Please log in or start a trial to view this content.
Expressing transsynaptic tracers as transgenes to trace the neural circuits of genetically defined neuronal populations has several advantages compared to the stereotaxic injection of tracers or neurotopic viruses. First, the tracer is produced as an endogenous protein and therefore does not elicit any immune response and a selective neural pathway can be analyzed in different animals with high reproducibility. Second, because this is a non-invasive method it can be utilized to trace the circuits from neurons not easily ...
Access restricted. Please log in or start a trial to view this content.
No conflict of interest declared.
We thank Michael Candlish for critical comments on the manuscript. This project was supported by the Deutsche Forschungsgemeinschaft grants BO1743/6 and SFB/TRR 152 P11 and Z02 to Ulrich Boehm.
Access restricted. Please log in or start a trial to view this content.
Name | Company | Catalog Number | Comments |
Bisbenzimide (Hoechst 33258 dye) | Sigma | 14530-100MG | |
Ethanol | Sigma | 32205-1L | |
Cryo mold (Peel-a-way) | Polyscience Inc. | 18646A-1 | 22 x 22 x 20mm |
DMSO | Sigma | D8418-100ML | |
Dimethyl Formamide (DMF) | VWR Chemicals | 23470,293 | |
EGTA | ROTH | 3054.3 | |
Fluoromount G | Southern Biotech | 0100-01 | |
Glutaraldehyde | Sigma | G5882-50ML | |
Hydrogen peroxide | Sigma | 34988-7 | |
Isopentane (Methyl 2-butane) | Sigma | M32631-2.5L | |
Kaiser's glycine gelatin | Merck | 1092420100 | |
Methanol | Sigma | 494437-1L | |
MgCl2 | Sigma | M2670-100G | |
NaCl | ROTH | HN00.2 | |
NBT | Sigma | 298-83-9 | |
Nonidet P40 substitute | Fluka | 743.85 | |
OCT | Leica | 14020108926 | |
PAP pen | Dako | S2002 | |
Parafarmaldehyde | Sigma | P6148-1KG | |
Sodium deoxycholate | Sigma | D6750-25G | |
Sucrose | Sigma | S7903-1KG | |
Superfrost slides | Thermo Scientific | FT4981GLPLUS | |
TSA kit | PerkinElmer | NEL700 | |
TSA plus kit | PerkinElmer | NEL749A001KT | |
Tris | ROTH | AE15.2 | |
Triton-X 100 | ROTH | 3051.2 | |
Tween 20 | ROTH | 9127.1 | |
X-gal | ROTH | 2315.1 | |
Cryostat | Leica | na | |
Light microscope equipped with DIC imaging | Zeiss | Axioskop2 equipped with Axio Vision software | |
Fluroscence microscope | Zeiss | Axioskop2 equipped with Axio Vision software | |
Photoshop | Adobe | PS6 | |
Goat anti-WGA (recognizes BL) | Vector Laboatories | AS-2024 | |
Biotinylayted horse anti-goat IgG | Vector Laboatories | BA-9500 | |
Biotinylated goat anti-rabbit IgG | Vector Laboatories | BA-1000 | |
Rabbit anti-GFP (recognizes GTT) | Invitrogen | A11122 | |
Rabbit anti-GnRH | Affinity Bio Reagent | PA1-121 | |
Dylight488-donkey anti-rabbit IgG | Thermo Scientific | SA5-10038 | |
SA-Alexa Fluor 546 | Life Technologies | S-11225 | |
Primers | |||
BL Fwd (for BIZ genotyping) | Eurofins MWG Operon | ATGAAGATGATGAGCACCAGGGC | |
BL Rev (for BIZ genotyping) | Eurofins MWG Operon | AGCCCTCGCCGCAGAACTC | |
Cre Fwd (for Cre genotyping) | Eurofins MWG Operon | GTCGATGCAACGAGTGATGAGGTTCG | |
Cre Rev (for Cre genotyping) | Eurofins MWG Operon | CCAGGCTAAGTGCCTTCTCTACACCTGC | |
TTC Fwd (for GTT genotyping) | Eurofins MWG Operon | AGCAAGGGCGAGGAGCTGTT | |
TTC Rev (for GTT genotyping) | Eurofins MWG Operon | GTCTTGTAGTTGCCGTCGTCCTTGAA | |
XY Fwd (for gender genotyping) | Eurofins MWG Operon | TGAAGCTTTTGGCTTTGA | |
XY Rev (for gender genotyping) | Eurofins MWG Operon | CCGCTGCCAAATTCTTTG | |
ROSA26 Fwd | Eurofins MWG Operon | CGAAGTCGCTCTGAGTTGTTATC | |
ROSA26 Rev | Eurofins MWG Operon | GCAGATGGAGCGGGAGAAAT | |
SA Rev | Eurofins MWG Operon | CGAAGTCGCTCTGAGTTGTTATC |
Access restricted. Please log in or start a trial to view this content.
Request permission to reuse the text or figures of this JoVE article
Request PermissionThis article has been published
Video Coming Soon
Copyright © 2025 MyJoVE Corporation. All rights reserved