JoVE Logo
Faculty Resource Center

Sign In

Summary

Abstract

Introduction

Protocol

Representative Results

Discussion

Acknowledgements

Materials

References

Biology

A Protocol for Functional Assessment of Whole-Protein Saturation Mutagenesis Libraries Utilizing High-Throughput Sequencing

Published: July 3rd, 2016

DOI:

10.3791/54119

1Green Center for Systems Biology, University of Texas Southwestern Medical Center

We present a protocol for the functional assessment of comprehensive single-site saturation mutagenesis libraries of proteins utilizing high-throughput sequencing. Importantly, this approach uses orthogonal primer pairs to multiplex library construction and sequencing. Representative results using TEM-1 β-lactamase selected at a clinically relevant dosage of ampicillin are provided.

Site-directed mutagenesis has long been used as a method to interrogate protein structure, function and evolution. Recent advances in massively-parallel sequencing technology have opened up the possibility of assessing the functional or fitness effects of large numbers of mutations simultaneously. Here, we present a protocol for experimentally determining the effects of all possible single amino acid mutations in a protein of interest utilizing high-throughput sequencing technology, using the 263 amino acid antibiotic resistance enzyme TEM-1 β-lactamase as an example. In this approach, a whole-protein saturation mutagenesis library is constructed by site-directed mutagenic PCR, randomizing each position individually to all possible amino acids. The library is then transformed into bacteria, and selected for the ability to confer resistance to β-lactam antibiotics. The fitness effect of each mutation is then determined by deep sequencing of the library before and after selection. Importantly, this protocol introduces methods which maximize sequencing read depth and permit the simultaneous selection of the entire mutation library, by mixing adjacent positions into groups of length accommodated by high-throughput sequencing read length and utilizing orthogonal primers to barcode each group. Representative results using this protocol are provided by assessing the fitness effects of all single amino acid mutations in TEM-1 at a clinically relevant dosage of ampicillin. The method should be easily extendable to other proteins for which a high-throughput selection assay is in place.

Mutagenesis has long been employed in the laboratory to study the properties of biological systems and their evolution, and to produce mutant proteins or organisms with enhanced or novel functions. While early approaches relied on methods which produce random mutations in organisms, the advent of recombinant DNA technology enabled researchers to introduce select changes to DNA in a site-specific manner, i.e., site-directed mutagenesis1,2. With current techniques, typically using mutagenic oligonucleotides in a polymerase chain reaction (PCR), it is relatively facile to create and assess small numbers of mutations (e.g., point mutations) in....

Log in or to access full content. Learn more about your institution’s access to JoVE content here

Note: See Figure 1 for outline of protocol. Several steps and reagents in the protocol require safety measures (indicated with "CAUTION"). Consult material safety data sheets before use. All protocol steps are performed at RT unless other indicated.

1. Prepare Culture Media and Plates

  1. Prepare and sterilize by autoclaving 1 L purified water, 100 ml Super Optimal Broth (SOB; Table 1), 1 L Luria-Bertani broth (LB; Table 2.......

Log in or to access full content. Learn more about your institution’s access to JoVE content here

The plasmid map for the five modified pBR322 plasmids containing orthogonal priming sites (pBR322_OP1 - pBR322_OP5) is shown in Figure 2A. To test whether the orthogonal primers are specific, PCRs were performed using each pair of orthogonal primers individually, along with all five pBR322_OP1-5 plasmids, or with all plasmids minus the plasmid matching the orthogonal primer pair. The correct product was only obtained when the matching plasmid was included, and no product .......

Log in or to access full content. Learn more about your institution’s access to JoVE content here

Here a protocol is described for performing the functional assessment of whole-protein saturation mutagenesis libraries, using high-throughput sequencing technology. An important aspect of the method is the use of orthogonal primers during the cloning process. Briefly, each amino acid position is randomized by mutagenic PCR, and mixed together into groups of positions whose combined sequence length is accommodated by high-throughput sequencing. These groups are cloned into plasmid vectors containing pairs of orthogonal p.......

Log in or to access full content. Learn more about your institution’s access to JoVE content here

R.R. acknowledges support from the National Institutes of Health (RO1EY018720-05), the Robert A. Welch Foundation (I-1366), and the Green Center for Systems Biology.

....

Log in or to access full content. Learn more about your institution’s access to JoVE content here

Name Company Catalog Number Comments
Typtone Research Products Intl. Corp. T60060-1000.0
Yeast extract Research Products Intl. Corp. Y20020-500.0
Sodium chloride Fisher Scientific BP358-212
Potassium chloride Sigma-Aldrich P9333-500G
Magnesium sulfate Sigma-Aldrich M7506-500G
Agar Fisher Scientific BP1423-500
Tetracycline hydrochloride Sigma-Aldrich T7660-5G
petri plates Corning 351029
MATLAB  Mathworks http://www.mathworks.com/products/matlab/
Oligonucleotide primers Integrated DNA Technologies https://www.idtdna.com/pages/products/dna-rna/custom-dna-oligos 25 nmol scale, standard desalting
pBR322_AvrII available upon request pBR322 plasmid modified to contain AvrII restriction site downstream of the TEM-1 gene
pBR322_OP1 – pBR322_OP5 available upon request five modified pBR322 plasmids each containing a pair of orthogonal priming sites
Q5 high-fidelity DNA polymerase New England Biolabs M0491L includes 5X PCR buffer and PCR additive (GC enhancer)
15 mL conical tube Corning 430025
Multichannel pipettes (Eppendorf ResearchPlus) Eppendorf
PCR plate, 96 well Fisher Scientific 14230232
96 well plate seal Excel Scientific F-96-100
Veriti 96-well thermal cycler Applied Biosystems 4375786
6X gel loading dye New England Biolabs B7024S
Agarose Research Products Intl. Corp. 20090-500.0
Ethidium bromide Bio-Rad 161-0433
UV transilluminator (FOTO/Analyst ImageTech) Fotodyne Inc. http://www.fotodyne.com/content/ImageTech_gel_documentation
EB buffer Qiagen 19086
96-well black-walled, clear bottom assay plates Corning 3651
Lambda phage DNA New England Biolabs N3011S
PicoGreen dsDNA reagent Invitrogen P7581 dsDNA quantitation reagent, used in protocol step 2.2.4
Victor 3V microplate reader PerkinElmer
DNA purification kit Zymo Research D4003
Microcentrifuge tubes Corning 3621
Long-wavelength UV illuminator Fisher Scientific FBUVLS-80
Agarose gel DNA extraction buffer Zymo Research D4001-1-100
AatII New England Biolabs R0117S
AvrII New England Biolabs R0174L
T4 DNA ligase New England Biolabs M0202S
EVB100 electrocompetent E. coli Avidity EVB100
Electroporator (E. coli Pulser) Bio-Rad 1652102
Electroporation cuvettes Bio-Rad 165-2089
Spectrophotometer (Ultrospec 3100 pro) Amersham Biosciences 80211237
50 mL conical tubes Corning 430828
Plasmid purification kit Macherey-Nagel 740588.25
8 well PCR strip tubes Axygen 321-10-551
Qubit dsDNA HS assay kit Invitrogen Q32854 dsDNA quantitation reagent
Qubit assay tubes Invitrogen Q32856
Qubit fluorometer Invitrogen Q32866
Ampicillin sodium salt Akron Biotechnology 50824296
MiSeq reagent kit v2 (500 cycles) Illumina MS-102-2003
MiSeq desktop sequencer Illumina http://www.illumina.com/systems/miseq.html alternatively, one could sequence on Illumina HiSeq platform
FLASh software John Hopkins University - open source http://ccb.jhu.edu/software/FLASH/ software to merge paired-end reads from next-generation sequencing data
AatII_F GATAATAATGGTTTCTTAGACGTCAGGTGGC
AvrII_R CTTCACCTAGGTCCTTTTAAATTAAAAATGAAG
AvrII_F CTTCATTTTTAATTTAAAAGGACCTAGGTGAAG
AatII_OP1_R ACCTGACGTCCGTATTTCAACTGTCCGGTCTAAGAAACCATTATTATCATGACATTAAC
AatII_OP2_R ACCTGACGTCCGCTCACGGAGTGTACTAATTAAGAAACCATTATTATCATGACATTAAC
AatII_OP3_R ACCTGACGTCGTACGTCTGAACTTGGGACTTAAGAAACCATTATTATCATGACATTAAC
AatII_OP4_R ACCTGACGTCCCGTTCTCGATACCAAGTGATAAGAAACCATTATTATCATGACATTAAC
AatII_OP5_R ACCTGACGTCGTCCGTCGGAGTAACAATCTTAAGAAACCATTATTATCATGACATTAAC
OP1_F GACCGGACAGTTGAAATACG
OP1_R CGACGTACAGGACAATTTCC
OP2_F ATTAGTACACTCCGTGAGCG
OP2_R AGTATTAGGCGTCAAGGTCC
OP3_F AGTCCCAAGTTCAGACGTAC
OP3_R GAAAAGTCCCAATGAGTGCC
OP4_F TCACTTGGTATCGAGAACGG
OP4_R TATCACGGAAGGACTCAACG
OP5_F AGATTGTTACTCCGACGGAC
OP5_R TATAACAGGCTGCTGAGACC
Group1_F ACACTCTTTCCCTACACGACGCTCTTCCGATCTNNNNNGCATTTTGCCTACCGGTTTTTGC
Group1_R GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTNNNNNTCTTGCCCGGCGTCAAC
Group2_F ACACTCTTTCCCTACACGACGCTCTTCCGATCTNNNNNGAACGTTTTCCAATGATGAGCAC
Group2_R GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTNNNNNGTCCTCCGATCGTTGTCAGAAG
Group3_F ACACTCTTTCCCTACACGACGCTCTTCCGATCTNNNNNAGTAAGAGAATTATGCAGTGCTGCC
Group3_R GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTNNNNNTCGCCAGTTAATAGTTTGCGC
Group4_F ACACTCTTTCCCTACACGACGCTCTTCCGATCTNNNNNCCAAACGACGAGCGTGACAC
Group4_R GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTNNNNNGCAATGATACCGCGAGACCC
Group5_F ACACTCTTTCCCTACACGACGCTCTTCCGATCTNNNNNCGGCTGGCTGGTTTATTGC
Group5_R GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTNNNNNTATATGAGTAAACTTGGTCTGACAG
501_F AATGATACGGCGACCACCGAGATCTACACTATAGCCTACACTCTTTCCCTACACGAC
502_F AATGATACGGCGACCACCGAGATCTACACATAGAGGCACACTCTTTCCCTACACGAC
503_F AATGATACGGCGACCACCGAGATCTACACCCTATCCTACACTCTTTCCCTACACGAC
504_F AATGATACGGCGACCACCGAGATCTACACGGCTCTGAACACTCTTTCCCTACACGAC
505_F AATGATACGGCGACCACCGAGATCTACACAGGCGAAGACACTCTTTCCCTACACGAC
701_R CAAGCAGAAGACGGCATACGAGATCGAGTAATGTGACTGGAGTTCAGACGTG
702_R CAAGCAGAAGACGGCATACGAGATTCTCCGGAGTGACTGGAGTTCAGACGTG

  1. Hutchison, C. A., et al. Mutagenesis at a specific position in a DNA sequence. J Biol Chem. 253 (18), 6551-6560 (1978).
  2. Mullis, K. B., Faloona, F. A. Specific synthesis of DNA in vitro via a polymerase-catalyzed chain reaction. Methods Enzymol. 155, 335-350 (1987).
  3. Papworth, C., Bauer, J. C., Braman, J., Wright, D. A. Site-directed mutagenesis in one day with >80% efficiency. Strategies. 9 (3), 3-4 (1996).
  4. Higuchi, R., Krummel, B., Saiki, R. K. A general method of in vitro preparation and specific mutagenesis of DNA fragments: study of protein and DNA interactions. Nucleic Acids Res. 16 (15), 7351-7367 (1988).
  5. Rennell, D., Bouvier, S. E., Hardy, L. W., Poteete, A. R. Systematic mutation of bacteriophage T4 lysozyme. J Mol Biol. 222 (1), 67-88 (1991).
  6. Markiewicz, P., Kleina, L. G., Cruz, C., Ehret, S., Miller, J. H. Genetic studies of the lac repressor. XIV. Analysis of 4000 altered Escherichia coli lac repressors reveals essential and non-essential residues, as well as 'spacers' which do not require a specific sequence. J Mol Biol. 240 (5), 421-433 (1994).
  7. Kleina, L. G., Miller, J. H. Genetic studies of the lac repressor. XIII. Extensive amino acid replacements generated by the use of natural and synthetic nonsense suppressors. J Mol Biol. 212 (2), 295-318 (1990).
  8. Huang, W., Petrosino, J., Hirsch, M., Shenkin, P. S., Palzkill, T. Amino acid sequence determinants of beta-lactamase structure and activity. J Mol Biol. 258 (4), 688-703 (1996).
  9. Fowler, D. M., et al. High-resolution mapping of protein sequence-function relationships. Nat Methods. 7 (9), 741-746 (2010).
  10. Hietpas, R. T., Jensen, J. D., Bolon, D. N. Experimental illumination of a fitness landscape. Proc Natl Acad Sci U S A. 108 (19), 7896-7901 (2011).
  11. McLaughlin, R. N., Poelwijk, F. J., Raman, A., Gosal, W. S., Ranganathan, R. The spatial architecture of protein function and adaptation. Nature. 491 (7422), 138-142 (2012).
  12. Deng, Z., et al. Deep sequencing of systematic combinatorial libraries reveals beta-lactamase sequence constraints at high resolution. J Mol Biol. 424 (3-4), 150-167 (2012).
  13. Stiffler, M. A., Hekstra, D. R., Ranganathan, R. Evolvability as a Function of Purifying Selection in TEM-1 beta-Lactamase. Cell. 160 (5), 882-892 (2015).
  14. Matagne, A., Lamotte-Brasseur, J., Frere, J. M. Catalytic properties of class A beta-lactamases: efficiency and diversity. Biochem J. 330 (Pt2), 581-598 (1998).
  15. Salverda, M. L., De Visser, J. A., Barlow, M. Natural evolution of TEM-1 beta-lactamase: experimental reconstruction and clinical relevance. FEMS Microbiol Rev. 34 (6), 1015-1036 (2010).
  16. Weinreich, D. M., Delaney, N. F., Depristo, M. A., Hartl, D. L. Darwinian evolution can follow only very few mutational paths to fitter proteins. Science. 312 (5770), 111-114 (2006).
  17. Stewart, S. M., Fisher, M., Young, J. E., Lutz, W. Ampicillin levels in sputum, serum, and saliva. Thorax. 25 (3), 304-311 (1970).
  18. Giachetto, G., et al. Ampicillin and penicillin concentration in serum and pleural fluid of hospitalized children with community-acquired pneumonia. Pediatr Infect Dis J. 23 (7), 625-629 (2004).
  19. Ambler, R. P., et al. A standard numbering scheme for the class A beta-lactamases. Biochem J. 276 (Pt 1), 269-270 (1991).
  20. Magoc, T., Salzberg, S. L. FLASH: fast length adjustment of short reads to improve genome assemblies). Bioinformatics. 27 (21), 2957-2963 (2011).
  21. Melamed, D., Young, D. L., Gamble, C. E., Miller, C. R., Fields, S. Deep mutational scanning of an RRM domain of the Saccharomyces cerevisiae poly(A)-binding protein. RNA. 19 (11), 1537-1551 (2013).
  22. Bank, C., Hietpas, R. T., Jensen, J. D., Bolon, D. N. A systematic survey of an intragenic epistatic landscape. Mol Biol Evol. 32 (1), 229-238 (2015).
  23. Dove, S. L., Joung, J. K., Hochschild, A. Activation of prokaryotic transcription through arbitrary protein-protein contacts. Nature. 386 (6625), 627-630 (1997).
  24. Romero, P. A., Tran, T. M., Abate, A. R. Dissecting enzyme function with microfluidic-based deep mutational scanning. Proc Natl Acad Sci U S A. 112 (23), 7159-7164 (2015).

This article has been published

Video Coming Soon

JoVE Logo

Privacy

Terms of Use

Policies

Research

Education

ABOUT JoVE

Copyright © 2024 MyJoVE Corporation. All rights reserved